Information

C8. Mitogen aktivierte Proteinkinasen - Biologie

C8. Mitogen aktivierte Proteinkinasen - Biologie


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Es ist oft der Fall, dass besetzte Rezeptoren Proteinkinasen aktivieren, die andere Proteinkinasen aktivieren, die wiederum andere Proteinkinasen aktivieren, um Phosphoproteine ​​zu produzieren, die als Transkriptionsfaktoren wirken können. Ein Beispiel ist die Mitogen-aktivierte Proteinkinase (MAPK-System). Ein Mitogen ist ein externes chemisches Signal, das Mitose oder Zellteilung verursacht. Eine Aktivierung von Transkriptionsfaktoren durch ihre Phosphorylierung durch eine mitogen aktivierte Kinase ist erforderlich. Der Ablauf der Ereignisse ist:

  • Bindung eines externen Signals an den Membranrezeptor und Aktivierung der Rezeptorkinase
  • Phosphorylierung der Rezeptorkinase und Interaktion mit einem Aktivator-GTP-bindenden Protein wie ras
  • Bindung von aktiviertem G-Protein an und Aktivierung einer mitogenaktivierten Proteinkinase-Kinase-Kinase (MAPKKK)
  • MKKK phosphoryliert und aktiviert eine andere Kinase, MAPKK
  • MKK phosphoryliert und aktiviert mitogenaktivierte Proteinkinase, MAPK
  • MAPK phosphoryliert inaktive Transkriptionsfaktoren (oder andere Proteine) und aktiviert sie. Wenn die aktivierten Proteine ​​selbst Proteinkinase sind, werden sie leider (vom Namensgesichtspunkt her) als Mitogen-aktivierte Proteinkinase-aktivierte Proteinkinasen (MAPKAPK) bezeichnet.

Es gibt sieben Arten von MAPKs, vier konventionelle und drei atypische. Vier typische sind in der folgenden Tabelle beschrieben.

Aktivator GTP-bindendes ProteinRas:GTP
MAPKKK oder MAPK3Raf-1A/B
c-Mos
MEKK1-4
DLK
MLK2
MEKK1-4
DLK
MLK2
MEKK2/3
Tpl-2
MAPKK oder MAPK2MEK1,2MEK4,7MEK3,6MEK5
MAPK oder MAKERK1,2JNK1-3p38ERK5
MAPKAPKRSK 1-4
MNK2
MSK 1,2
MK2,3MSK1,2
MK2,3
RSK1-4
Ein eventuelles
Proteinziel
c-Junic-Juni

MAP-Kinase-System von Cell Signaling

MAP-Kinase-System-Animation von Promega

Mitwirkende

  • Prof. Henry Jakubowski (College of St. Benedikt/St. John's University)

Protein C Juni

D Rolle von c-Jun in Axon-Schwann-Zell-Interaktionen

Der Transkriptionsfaktor c-Jun, der zur bZIP-Familie der Transkriptionsfaktoren gehört ( 199 ), wird ausschließlich von nicht-myelinisierenden Schwann-Zellen in normalen Nerven und zuvor myelinisierenden Schwann-Zellen nach einer Verletzung exprimiert ( 200 ). Während der PNS-Entwicklung und -Regeneration stimmt das Expressionsmuster von c-Jun mit seiner Regulation durch Axon-Schwann-Zell-Interaktionen überein. Somit ist c-Jun wahrscheinlich an der Bestimmung des differenzierten Zustands von nicht myelinisierenden und axonarmen Schwann-Zellen beteiligt, obwohl die Zielgene für diesen Transkriptionsfaktor in solchen Zellen noch bestimmt werden müssen.


Einführung

Mitogen-aktivierte Proteinkinasen (MAPKs) werden ubiquitär exprimiert und regulieren in nahezu allen Zelltypen verschiedenste Funktionen. Bei Vertebraten umfassen fünf Familien von MAPKs, die von 11 verschiedenen Genen kodiert werden, die extrazelluläre signalregulierte Kinase ERK1/2, c-Jun N-terminale Kinase JNK1/2/3, p38α/β/δ/γ, ERK5 und ERK7 (Uhlik et al., 2004). Spleißvarianten existieren für mehrere der MAPK-Proteine. MAPKs phosphorylieren spezifische Substratproteine, die Zellproliferation, Überleben, Motilität, Metabolismus, Transkription und Translation regulieren. MAPKs tragen zur zellulären Reaktion auf verschiedene Stimuli bei, darunter Wachstumsfaktoren, Zytokine und Stress wie Toxine, zahlreiche Medikamente, Veränderungen der Zelladhärenz, Osmolarität, Sauerstoffradikale, ultraviolettes Licht und Temperatur (Pearson et al., 2001). Es ist daher nicht unerwartet, dass eine fehlregulierte MAPK-Aktivität mit einer Vielzahl von pathologischen Zuständen verbunden ist, einschließlich solchen, die durch Entzündungen entstehen, wie Arthritis und entzündliche Darmerkrankungen (Johnson und Lapadat, 2002 Hollenbach et al., 2004) sowie Syndrome, die umfassen die für Krebs charakteristische unkontrollierte Zellproliferation und Gewebeumbildung (Gollob et al., 2006).

Das Ziel intensiver Forschungsanstrengungen war es, zu verstehen, wie jedes der Arrays von Stimuli, die MAPKs aktivieren, ein bestimmtes Ergebnis induzieren kann. MAPKs sind die terminale Kinase in einem Drei-Kinase-Phosphorelay-Modul, in dem MAPKs durch Mitogen-aktivierte Proteinkinase-Kinase MKKs phosphoryliert und aktiviert werden, die selbst durch Mitogen-aktivierte Proteinkinase-Kinase-Kinase (MKKKs) phosphoryliert und aktiviert werden. Von den MAPK-Signalmodulkomponenten, die in menschlichen Zellen identifiziert wurden, sind MKKKs zahlenmäßig die größten (mindestens 20 Gene), verglichen mit den MKKs (sieben Gene) und MAPKs (11 Gene) (Uhlik et al., 2004) . Die Nummern jedes MKKK, MKK und MAPK sind tatsächlich größer, wenn Spleißvarianten gezählt werden. Interessanterweise können einige MKKKs verschiedene MAPK-Module aktivieren oder dasselbe Modul mit veränderter Dauer oder Lokalisierung aktivieren, um unterschiedliche Ergebnisse zu erzielen (Johnson et al., 2005). Angesichts der Vielfalt von Stimuli, von denen bekannt ist, dass sie die verschiedenen MAPKs aktivieren, stellt die Vielfalt der MKKKs einen vorherrschenden Mechanismus dar, durch den Spezifität bei der MAPK-Aktivierung erreicht wird. Nochmals gesagt, MKKKs können Signale, die von stark unterschiedlichen Eingängen stammen, an MAPK-Signalisierungsmodule weiterleiten, um spezifische funktionale Antworten bereitzustellen. In diesem Sinne stellen MKKKs organisatorische Knoten oder „Hubs“ dar, die Antworten integrieren, um Spezifität bei der MAPK-Aktivierung bereitzustellen.

Abbildung 1 zeigt einen Schaltplan für vier der 20 MKKKs. MEKKs weisen eine signifikante Homologie in ihren Kinasedomänen auf (siehe unten) und regulieren differenziell mehr als eine MAPK (Fanger et al., 1997 Yujiri et al., 1998 Abell et al., 2005). Die Verbindungen im Schaltplan repräsentieren Proteininteraktionen basierend auf veröffentlichten Daten in PubMed. Darüber hinaus wurden gezielte Gen-Knockouts in Mäusen für MEKK1-4 charakterisiert (Yujiri et al., 1998 Garrington et al., 2000 Yang et al., 2000 Abell et al., 2005). Die Knockout-Phänotypen für MEKK1, 2, 3 und 4 definieren eindeutig spezifische Module innerhalb der Verbindungskarte, die für jede MEKK wesentliche physiologische Rollen definiert haben. Für eine solche Anschlusskarte kann ein Modul als diskrete Funktionseinheit definiert werden, die von anderen Komponenten des Systems trennbar ist. Ein Beispiel ist das MEKK3-OSM-KRIT-Modul, das die zerebrale Gefäßintegrität reguliert. Die Mutation von OSM oder KRIT führt zu der Krankheit cerebrale kavernöse Malformationen (CCM), von der in den Vereinigten Staaten einer von 200 Personen betroffen ist (Sahoo et al., 1999 Zawistowski et al., 2005). Man kann sich die Komplexität einer solchen Verbindungskarte für alle 20 MKKKs vorstellen. In diesem Review untersuchen wir die Mechanismen, durch die MKKKs Signale unterschiedlicher Herkunft integrieren, um spezifische funktionelle Ergebnisse aus der MAPK-Aktivierung hervorzurufen.

Verbindungskarte, die Proteininteraktionen für MEKK1, 2, 3 und 4 zeigt. Die Verbindungskarte veranschaulicht MEKKs als funktionelle Signalisierungs-Hubs für die Integration mehrerer Upstream-Eingänge in die Kontrolle spezifischer MAPKs. Die Karten wurden aus PubMed-Datenbanksuchen und Filtern von Daten basierend auf den Phänotypen von Mäusen mit gezielter Genunterbrechung oder Kinase-inaktivierenden Knockins jeder MEKK erstellt. Farbcodes repräsentieren verschiedene Klassen von Proteinen oder Signalwegen, die in die vier MEKKs einspeisen. Grün steht für Gerüstproteine ​​und Rezeptoren, die die Gerüste nutzen, um eine Reaktion zu stimulieren. Pink steht für Tyrosinkinasen. Hellblau steht für Serin-Threonin-Kinasen. Rot steht für Rezeptoren und Regulatoren der Rezeptorantwort. Gelb steht für GTPasen.


MATERIALEN UND METHODEN

Materialien

RT-PCR-Primer wurden von TIB Molbiol (Berlin, Deutschland) bezogen. Sekundärantikörper stammten von Li-Cor Biosciences (Lincoln, NE, USA). Skepinon-L wurde wie zuvor beschrieben synthetisiert (14). Verwendete Materialien: CAY10566, Cayman (Ann Arbor, MI, USA) FlexiTube GeneSolution siRNAs gegen SCD-1 (Qiagen, Hilden, Deutschland) nicht-immunes Ziegenserum, Invitrogen (Carlsbad, CA, USA) DMEM/high Glucose (4,5 g .) /L) Medium, Trypsin/EDTA-Lösung (PAA Laboratories, Coelbe, Deutschland) Maus-Antizyklin D1 (1:2000), Kaninchen-Antizyklin B1 (1:1000), Maus-Antizyklin E (1:1000), Kaninchen- oder Maus-Anti-β-Actin (1:1000), Maus-Anti-Phospho-ERK1/2 (Thr202/Tyr204 1:2000), Kaninchen-Anti-Phospho-MEK1/2 (Ser217/221 1:1000) Kaninchen-Anti- Phospho-myristoylierte Alanin-reiche C-Kinase-Substrate (Ser152/156 1:1000), Kaninchen-Anti-Caspase 3 (1:1000), Kaninchen-Anti-Phospho-Src-Familie (Tyr416 1:1000) Maus-Anti-Phospho-JNK ( Thr183/Tyr185 1:2000), Kaninchen-Anti-Phospho-Akt (Ser473 1:1000), Kaninchen-Anti-Phospho-p38-MAPK (Thr180/Tyr182 1:1000), Kaninchen-Anti-p38-MAPK (1:1000), Maus-Anti- -IκBα (1:1000), Maus-Anti-CHOP (1:1000), Kaninchen-Anti-ATF-4 (1:1000), Kaninchen-Anti-BiP (1:1000: Cell Signaling, Danvers, MA, USA) Maus-Anti- -e ndoplasmatisches Retikulum/Golgi-Zwischenkompartiment (ERGIC) 53, Enzo Life Sciences (Lörrach, Deutschland) Lipidstandards (Avanti Polar Lipids, Alabaster, AL, USA) 1, 2- 3 H-2-Desoxy-D-Glukose (Hartmann Analytics, Braunschweig, Deutschland) Lösungsmittel und alle anderen Chemikalien wurden von Sigma-Aldrich (St. Louis, MO, USA) oder Wako Pure Chemicals (Osaka, Japan), sofern nicht anders angegeben.

Zellen, Zelldifferenzierung und Zellzyklussynchronisation

Maus-NIH-3T3- und 3T3-L1-Fibroblasten wurden bei 37 °C und 5 % CO . gezüchtet2 in DMEM, ergänzt mit 10 % (v/v) hitzeinaktiviertem FCS. Um NIH-3T3-Zellen in der G2/M-Phase des Zellzyklus zu synchronisieren, wurden Zellen (70-80% konfluent) mit Nocodazol (0,4 µg/ml) in DMEM, ergänzt mit 10% fötalem Kälberserum (FCS) für 20 Stunden behandelt (37°C, 5% CO2) wie an anderer Stelle beschrieben ( 15 ). Runde mitotische Zellen wurden durch Schütteln und Spritzen abgelöst, dreimal mit eiskaltem PBS pH 7,4 gewaschen und mit 4 × 10 6 Zellen/75 cm 2 Kolben erneut ausgesät.

3T3-L1-Fibroblasten wurden wie an anderer Stelle beschrieben in Adipozyten differenziert (16). Postkonfluente Zellen (12-Well-Platte) wurden 2 Tage lang mit DMEM behandelt, das 10 % FCS, 1 µg/ml Insulin, 1 µM Dexamethason und 0,5 mM 3-Isobutyl-1-methylxanthin enthielt (37 °C, 5 % CO .).2) und dann weitere 2 Tage in DMEM plus 10 % FCS und 1 µg/ml Insulin kultiviert.

Bestimmung von Zellzahl und Zelllebensfähigkeit

Gesamt- und lebensfähige Zellen wurden nach Trypanblau-Färbung unter Verwendung eines Zellzählers der Vi-Cell-Serie (Beckman Coulter, Krefeld, Deutschland) gezählt. Alternativ wurde die Lebensfähigkeit der Zellen unter Verwendung des kolorimetrischen Thiazolylblau-Tetrazoliumbromid-(MTT)-Farbreduktionsassays gemessen. NIH-3T3-Zellen (7 × 10 3 /96-Well-Platte) wurden für 16 h (37°C, 5% CO .) kultiviert2) und dann mit Vehikel (DMSO) oder CAY10566 für 48 Stunden vorinkubiert. MTT wurde zugegeben, das Formazan-Produkt mit SDS (10%, m/v, in 20 mM HCl) nach 3 Stunden solubilisiert und die Extinktion bei 595 nm abgelesen, wie an anderer Stelle beschrieben (17).

Hemmung von SCD-1 durch RNA-Interferenz

NIH-3T3-Zellen wurden in 25 cm 2 Schalen bis zu ungefähr 60% Konfluenz gezüchtet und mit siRNA-Duplex-Oligonukleotiden (15 nM) unter Verwendung von Lipofectamine RNAiMax-Transfektionsreagenz (10 &mgr;l, Invitrogen) gemäß dem Protokoll des Herstellers transfiziert. Die 3 SCD-1-siRNAs zielten auf die Sequenzen 1) 5'-CACAACAGCTTTAAATAATAA-3', 2) 5'-TAGTGAGATTTGAATAATTAA-3' bzw. 3) 5'-CCGGTACAGTATTCTTATAAA-3'. On-TargetPlus non-targeting siRNA #1 (Thermo Scientific, Waltham, MA, USA) wurde als verwürfelte Kontroll-siRNA verwendet.

Extraktion von Lipiden

Lipide wurden aus NIH-3T3-Zellen (5 × 10 5 in PBS pH 7,4) durch aufeinanderfolgende Zugabe von Methanol, Chloroform und Kochsalzlösung (Endverhältnis: 14:34:35:17) extrahiert, wie zuvor beschrieben (18). Die organische Schicht wurde verdampft und die extrahierten Lipide wurden in 100 μl Methanol gelöst und verdünnt, und 1,2-Dimyristoyl-sn-Glycero-3-phosphatidylcholin und 1,2-Dimyristoyl-sn-Glycero-3-phosphatidylethanolamin wurden als interne Standards verwendet.

Umkehrphasen-Flüssigchromatographie

Lipide wurden auf einer Acquity UPLC BEH C8-Säule (1,7 &mgr;m, 1 × 100 mm, Waters, Milford, MA, USA) unter Verwendung eines Acquity Ultraperformance LC-Systems (Waters) wie zuvor beschrieben (15) aufgetrennt. Für die Phospholipid-Analyse wurde die Chromatographie bei einer Flussrate von 0,75 ml/min bei 45 °C unter Verwendung eines Gradienten von 30 % mobiler Phase A (Acetonitril/Wasser, 10/90, 10 mM Ammoniumacetat)/70 % mobiler Phase B ( Acetonitril/Wasser, 95/5, 10 mM Ammoniumacetat) auf 20 % mobile Phase A/80 % mobile Phase B innerhalb von 5 Minuten und auf 100 % mobile Phase B innerhalb von 2 Minuten gefolgt von einer isokratischen Elution für weitere 2 Minuten. Triacylglycerine und Cholesterinester wurden mit einer Fließgeschwindigkeit von 0,75 ml/min bei 45 °C unter Verwendung eines Gradienten von 100 % mobiler Phase A (Acetonitril/Wasser, 95:5, 10 mM Ammoniumacetat) zu 70 % mobiler Phase A/20 . getrennt % mobile Phase B (Isopropanol) innerhalb von 6 Minuten und anschließende isokratische Elution für 3 Minuten.

Massenspektrometer

Das Chromatographiesystem wurde mit einem QTRAP 5500-Massenspektrometer (AB Sciex, Darmstadt, Deutschland) oder einem Vantage-Triple-Stage-Quadrupol-Massenspektrometer (Thermo Scientific für die Zellzyklusanalyse) gekoppelt. Beide waren mit Elektrospray-Ionisationsquellen ausgestattet. Die Quantifizierung von Glycerophospholipiden mit dem QTRAP 5500-Massenspektrometer basierte auf dem Nachweis beider Fettsäureanionenfragmente durch Mehrfachreaktionsüberwachung gemäß (15). Für die Quantifizierung wurde der intensivste Übergang ausgewählt. Die Ionensprühspannung wurde im negativen Ionenmodus auf 4500 V eingestellt und die Stoßenergie auf 46, 38, 20, 62 und 52 V für Phosphatidylcholine, Ethanolamine, Serine, PI bzw. Phosphatidylglycerine. Sphingomyeline wurden quantifiziert als [M + H + ] durch m/z =184 Vorläuferionen-Scans (Kollisionsenergie: 33 V).

Mit dem Vantage-Triple-Stage-Quadrupol-Massenspektrometer wurden zellzyklusabhängige Veränderungen der Lipidzusammensetzung durch m/z =184 Vorläuferionen-Scans im positiven Ionenmodus (Kollisionsenergie: 35 V Phosphatidylcholine und Sphingomyeline) oder vollständige Scans im negativen Ionenmodus (alle anderen Phospholipide), wie an anderer Stelle beschrieben (19). Phosphatidylethanolamin- und -serin-Kopfgruppen wurden durch m = 141,0 oder m = 87,0 Neutralverlustscans (Kollisionsenergie: 25 V, positiver bzw. negativer Ionenmodus) und Phosphatidylcholin- und PI-Kopfgruppen durch . bestätigt m/z = 184 oder m/z = 241,0 Vorläuferionen-Scans (Kollisionsenergie: 35 V, positiver bzw. negativer Ionenmodus) . Die Fettsäurezusammensetzung wurde bei einer Kollisionsenergie von 40 V durch Produkt-Ionen-Scans bestimmt. Die höhere Signalintensität von sn-1 als sn-2 Fettsäureanionen wurden verwendet, um die isomere Position der Fettsäuren abzuschätzen (20).

Triacylglycerine und Cholesterinester wurden als [M + NH4] + -Addukte durch Mehrfachreaktionsüberwachung unter Verwendung eines QTRAP 5500-Massenspektrometers analysiert. Übergänge zu [M-Fettsäureanion] + Fragmenten wurden zur Lipididentifizierung gemessen. Für die Quantifizierung wurde der intensivste (und artspezifischste) Übergang ausgewählt. Die Isomerenpositionen der Fettsäuren in Triacylglycerinen wurden nicht bestimmt. Abweichend von den oben beschriebenen und referenzierten Einstellungen wurde die Ionensprühspannung im positiven Ionenmodus auf 5500 V eingestellt, die Temperatur der beheizten Kapillare auf 350-400°C, der Hüllgasdruck auf 55-60 psi, der Hilfsgasdruck bis 70 psi, das Dekolusterierungspotential auf 55-120 V und die Kollisionsenergie auf 35 V (Triacylglycerole) oder 22 V (Cholesterinester).

Massenspektren wurden unter Verwendung der Software Analyst 1.6 (AB Sciex) oder Xcalibur 2.0 (Thermo Scientific) wie an anderer Stelle beschrieben (15, 20) verarbeitet. Der Anteil der Lipidarten (=relative Intensität) wird in Prozent der Summe aller Arten der jeweiligen Unterklasse (=100 %) angegeben. Die Gesamtintensitäten der Phospholipid-Subklasse fassen die Intensitäten aller Spezies der jeweiligen Subklasse zusammen und wurden auf die Zellzahl und den internen Standard 1, 2-Dimyristoyl-sn-Glycero-3-phosphatidylcholin.

Probenvorbereitung, SDS-PAGE und Western Blot

Die Zellen wurden beschallt (2 × 5 s, auf Eis) in 20 mM Tris-HCl pH 7,4, 150 mM NaCl, 2 mM EDTA, 1% (v/v) Triton X-100, 1 mM Phenylmethansulfonylfluorid, 60 µg/ml Sojabohnen-Trypsin-Inhibitor, 10 µg/ml Leupeptin, 5 mM Natriumfluorid, 1 mM Natriumvanadat und 2,5 mM Natriumpyrophosphat. Nach Zentrifugation (12.000 g, 5 min, 4°C), der Überstand wurde in 1 × SDS/PAGE-Probenladepuffer aufgenommen [125 mM Tris-HCl pH 6,5, 25% (m/v) Saccharose, 5% SDS (m/v), 0,25% (m/v) Bromphenolblau und 5% (v/v) β-Mercaptoethanol] und 5 Minuten bei 95ºC gekocht. Aliquots (10 &mgr;g Protein) wurden durch 10 oder 12% (m/v) SDS-PAGE aufgelöst und auf eine Hybond ECL-Nitrocellulosemembran (GE Healthcare, München, Deutschland) übertragen. Die Membranen wurden mit 5% (m/v) BSA oder Magermilch 1 Stunde bei Raumtemperatur blockiert und mit primären Antikörpern über Nacht bei 4°C inkubiert. Immunreaktive Banden wurden mit IRDye 800CW-markiertem (jeweils 1:10.000) und/oder IRDye 680LT-markiertem Anti-Kaninchen- oder Anti-Maus-IgG (jeweils 1:80.000) gefärbt und mit einem Odyssey Infrarot-Imager (Li-Cor Biosciences .) visualisiert ). Die Daten aus der densitometrischen Analyse wurden hintergrundkorrigiert.

Nahrungsergänzung mit Fettsäuren

Das Kulturmedium von NIH-3T3-Zellen wurde durch DMEM ersetzt, das 10 % (v/v) hitzeinaktiviertes FCS plus Palmitat, Palmitoleat oder Oleat in den angegebenen Konzentrationen enthielt. Mit 400 &mgr;M Palmitat angereichertes Kulturmedium wurde vor der Verwendung 20 Minuten lang bei 40 °C beschallt. Die Zellen wurden bei 37 °C und 5 % CO . inkubiert2 zu den angegebenen Zeiten.

Zelluläre Aufnahme von 2-Desoxy-D-glucose

Die zelluläre Aufnahme von 2-Desoxy-D-glucose wurde nach Yand und Yao (16) bestimmt. Differenzierte 3T3-L1-Adipozyten (25-cm2-Flasche) wurden mit CAY10566 (3 μM), Skepinon-L (1 μM) oder Vehikel (DMSO) 48 Stunden lang (37°C, 5% CO .) behandelt2). Die Zellen wurden gewaschen, mit Vehikel (DMSO), Skepinon-L (1 μM) oder dem Kontrollinhibitor Cytochalasin B ergänzt und mit Insulin (100 nM) in 10 mM HEPES/10 mM Natriumphosphatpuffer (pH 7,4) mit 128 stimuliert mM Natriumchlorid, 4,7 mM Kaliumchlorid, 1,25 mM Calciumchlorid und 1,25 mM Magnesiumsulfat für 15 Minuten. Dann wurde 3 H-markierte 2-Desoxy-D-glucose (0,5 µCi/ml bei 0,5 mM) zugegeben.Nach 10 Minuten wurden die Zellen dreimal mit eiskaltem PBS pH 7,4 plus 10 mM Glucose gewaschen, sofort in 0,1 N NaOH lysiert und mit Rotiszint eco plus (3 ml, Carl Roth GmbH, Karlsruhe, Deutschland) zur Flüssigszintillationszählung unter Verwendung von ein Packard TRI-CARB 2100TR Flüssigszintillationsanalysator.

Immunfluoreszenzfärbung und Mikroskopie

NIH-3T3-Zellen (2 × 10 4 /cm 2 ) wurden auf Deckgläser ausgesät und in Gegenwart von CAY10566 (3 μM), Skepinon-L (1 μM) oder Vehikel (DMSO 37 °C, 5 % CO .) kultiviert2). Das Kulturmedium wurde nach 42 Stunden gegen Kulturmedium ausgetauscht, das Palmitat (400 μM) plus CAY10566 (3 μM), Skepinon-L (1 μM) oder Vehikel (DMSO) enthielt. Dieser Schritt wurde für Experimente mit nicht gestressten Zellen weggelassen. Nach 6 Stunden wurden die Proben mit 4% Paraformaldehyd fixiert, mit 0,3% Triton X-100 permeabilisiert und mit 5% normalem Ziegenserum blockiert (10 Minuten, Raumtemperatur). Die Proben wurden mit Maus-Anti-ERGIC53-Antikörper (1:100 Enzo Life Sciences) 1 Stunde bei Raumtemperatur inkubiert, gefolgt von Ziegen-Anti-Maus-IgG Alexa Fluor 555 (1:1000 1 Stunde, Invitrogen bei Raumtemperatur). DNA wurde mit 0,1 µg/ml DAPI für 3 Minuten bei Raumtemperatur gefärbt. Die Deckgläser wurden mit Mowiol, das 2,5% n-Propylgallat (Sigma-Aldrich) enthielt, auf Glasobjektträger aufgebracht. Die Fluoreszenz wurde mit einem Axio Observer.Z1 Mikroskop und einem Plan-Apochromat 40X/1.3 Oil DIC M27 Objektiv (beide Carl Zeiss GmbH, Jena Deutschland) visualisiert. Die Bilder wurden bei Raumtemperatur mit einer AxioCam MR3-Kamera aufgenommen und mit der Software AxioVision 4.8 (Carl Zeiss GmbH) aufgenommen, geschnitten, in Gesamthelligkeit und Kontrast linear angepasst und in TIF exportiert.

Gen Sense-Primer (5′ → 3′) Antisense-Primer (5′ → 3′)
mSCD-1 CATCATTCTCATGGTCCTGCTG AGCCGTGCCTTGTAAGTTCTGT
mSCD-2 GGAGGAACATCATTCTCATGGC AGCCGTGCCTTGTATGTTCTGT
mβ-Aktin GCTGTGCTATGTTGCTCTAGACTT AATTGAATGTAGTTTCATGGATGC
mGAPDH TGACAATGAATACGGCTACAGCA CTCCTGTTATTATGGGGGTCTGG

Quantitative RT-PCR

Gesamt-RNA wurde unter Verwendung von E.Z.N.A. Gesamt-RNA-Kit I (Omega Bio-tek, Norcross, GA, USA). Erststrang-cDNAs wurden aus 1 &mgr;g RNA unter Verwendung von Superscript III (Invitrogen) synthetisiert. Die PCR wurde in Mx3000P 96-Well-Platten (25 &mgr;l) unter Verwendung eines Mx3005P qPCR-Systems (Agilent Technologies, Santa Clara, CA, USA) durchgeführt. Der PCR-Mix enthielt cDNA (2,5 µl), Maxima SYBR Green/Rox qPCR Master Mix (1x, Thermo Scientific) sowie Vorwärts- und Rückwärtsprimer (jeweils 0,5 µM). Erste Informationen finden Sie in Tisch 1. Das Zyklusprogramm begann mit 10 Minuten bei 95 °C und umfasste 40 Zyklen von 15 Sekunden bei 95 °C, 30 Sekunden bei 63 °C und 30 Sekunden bei 72 °C. cDNA-Spiegel wurden mit der MxPro QPCR-Software quantifiziert. Die mRNA-Expression wurde für Knockdown-Experimente auf Glyceraldehyd-3-Phosphat-Dehydrogenase oder für Zellzyklusstudien auf die RNA-Menge normalisiert. Die Ergebnisse werden in willkürlichen Einheiten angegeben.

Statistiken

Die Daten werden als Mittelwert ± SE von dargestellt n Beobachtungen. Die statistische Auswertung der Daten erfolgte durch 1-Weg-ANOVAs für unabhängige oder korrelierte Stichproben, gefolgt von der ehrlichen signifikanten Differenz nach Tukey (HSD). post hoc Tests oder von Student's T Test auf gepaarte und korrelierte Stichproben. P-Werte <0,05 wurden als statistisch signifikant angesehen. Alle statistischen Berechnungen wurden mit GraphPad InStat 3.10 (GraphPad Software Inc., La Jolla, CA, USA) durchgeführt.


Ergebnisse

Identifizierte Phosphopeptide

(a) Das Ziel dieser Studie war es, als Routinemethode eine Methode zur Identifizierung und Charakterisierung der einzelnen phosphorylierten Kinasen p38 und HuR . zu etablieren in vitro Verwendung: TiO2, IMAC, SIMAC gekoppelt an MSA und MS3NL auf dem LTQ-Ionenfallen-Massenspektrometer (Thermo). Aufreinigungs- und Fusionsproteine ​​wurden in Escherichia coli exprimiert. Der Kinase-Assay wurde inkubiert mit verschiedenen Typen von Protein-Phosphatase-Inhibitoren durchgeführt, um die Spiegel der Protein-Kinasen-Phosphorylierung vor der Analyse zu erhöhen. Tatsächlich wurde auch Natriumpervanadat, ein Tyrosin-Phosphatase-Inhibitor, gekoppelt an eine Kombination von zwei Phosphatase-Inhibitor-Cocktails von Sigma (ein Cocktail mit Serin/Threonin-Phosphatase-Inhibitoren und einer mit Tyrosin-Phosphatase-Inhibitoren) verwendet. Proteinkinasen wurden mit Lysyl-Endopeptidase und Trypsin verdaut und anschließend mit TiO . für phosphorylierte Peptide angereichert2, IMAC- und SIMAC-Phosphoanreicherungen. Die isolierten Phosphopeptide wurden entsalzt, gereinigt und durch Nano-LC ESI-MS/MS unter Verwendung eines Thermo LTQ Ionenfallen-MSMS-Instruments analysiert. Alle Experimente wurden dreifach durchgeführt. Die LC-MS/MS-Experimente und die Suche in der Maskottchen-Datenbank ergaben insgesamt signifikante Peptidtreffer. Alle Peptide wurden mit einem Massenfehler von weniger als 5,5 ppm bestimmt. Insgesamt 6 Phosphopeptide wurden durch manuelle Auswertung der LC-MS/MS-Datensätze aus den vier dreifachen Experimenten validiert. Von diesen wurden 6 einzigartigen phosphorylierten Aminosäuresequenzen zugeordnet, was in allen Experimenten zur Identifizierung von 3 einzigartigen Proteinen führte.

(b) Die Analyse der 5 μl (

3 μg) der mit IMAC gereinigten und mit R3/C18 entsalzten und gereinigten Probe ermöglichten es uns, 2 unbekannte phosphorylierte Peptide zu erhalten, wenn MSA auf dem nano-LC-LTQ-Ionenfallen-Instrument verwendet wurde. Beide phosphorylierten Peptide wurden manuell validiert und entsprechen: R.VLVDQTTGLSR.G und R.SLFSSIGEVESAK.L. Diese beiden Phosphopeptide gehören zum HuR-RNA-Bindungsprotein gi/1022961-Protein. Die Analyse von 5 μl (

3 µg) der mit TiO . gereinigten Probe2 und entsalzt und gereinigt durch R3/C18 ermöglichte es uns, 4 unbekannte phosphorylierte Peptide zu erhalten, wenn MSA auf dem nano-LC-LTQ-Instrument verwendet wurde.

Die vier phosphorylierten Peptide wurden manuell validiert und entsprechen: R.VLVDQTTGLSR.G, R.SLFSSIGEVESAK.L, K.DVEDMFSR.F, die zum HuR-RNA-Bindungsprotein gi/1022961 und einem anderen Phosphopeptid gehören: K.DLSSIFR.G, das zu p38 MAP Kinase gi/1469306 gehört (Tabelle 1).

3 μg) der mit SIMAC gereinigten und mit R3/C18 entsalzten und gereinigten Probe ermöglichten es uns, 6 unbekannte phosphorylierte Peptide zu erhalten, wenn MSA auf dem nano-LC-LTQ-Ionenfallen-Instrument verwendet wurde. Die sechs phosphorylierten Peptide wurden manuell validiert und entsprechen: K.DVEDMFSR.F, R.VLVDQTTGLSR.G, K.DANLYISGLPR.T, R.SLFSSIGEVESAK.L, die zum HuR-RNA-Bindungsprotein gi/1022961 gehören, und R.TAVINAASGR.Q, das zu Kette B gehört, Structure Of Appbp1-Uba3-nedd8-Mgatp-Ubc12 (c111a), A Trapped Ubiquitin-Like Protein Activation Complex gi/126031226 und K.DLSSIFR.G, das zu p38 MAP Kinase gi/1469306 gehört (Tabelle 1).

Daher ist die Effizienz von SIMAC (6 gereinigte, identifizierte und validierte Phosphopeptide) bei Verwendung von MSA mit dem LTQ Ion Trap-Instrument höher als die von TiO2 (4 gereinigte und identifizierte Phosphopeptide) und IMAC (2 gereinigte, identifizierte und validierte Phosphopeptide) für diese untersuchten Proteinkinasen. Es wurde beschrieben, dass IMAC leicht mehrere phosphorylierte Peptide anreichert, während TiO2 monophosphorylierte. Tatsächlich wurde SIMAC optimiert, um die beste Effizienz von IMAC und TiO . zu erzielen2 und ergänzen beide in nur einer Methode (siehe zuvor erwähnte Referenz [34]). Dies unterstützt unsere Daten.

In jedem Fall empfehlen wir, zur Untersuchung von Kinase-phosphorylierten Proteinkinasen die drei Harze (oder immer mehr Phosphoanreicherungsmethoden) zu kombinieren, um so viele Phosphopeptide wie möglich zu reinigen [46]. Der Grund dafür ist, dass jede Probe mit unterschiedlichen komplementären Strategien optimiert und getestet werden muss. Die Analyse der 5 µl (

3 μg) der mit SIMAC gereinigten und mit R3/C18 entsalzten und gereinigten Probe ermöglichten es uns, 5 unbekannte phosphorylierte Peptide zu erhalten, wenn wir Data Dependent Neutral Loss MS3 (DDNLMS3) auf dem nano-LC-LTQ-Ionenfallen-Instrument verwenden. Die fünf phosphorylierten Peptide wurden manuell validiert und entsprechen: K.DVEDMFSR.F, K.DANLYISGLPR.T, R.SLFSSIGEVESAK.L, die zum HuR-RNA-Bindungsprotein gi/1022961 K.DL . gehörenSSIFR.G, das zu p38 MAP Kinase gi/1469306 gehört und R.TAVINAASGR.Q, das zu Kette B gehört, Struktur von Appbp1-Uba3-nedd8-Mgatp-Ubc12 (c111a), A Trapped Ubiquitin-like Protein Activation Complex gi/126031226 (Tabelle 1).

(c) SIMAC gekoppelt an MAS- und MS3-NL-Massenspektrometrieanalyse. Der bevorzugte Ansatz zum Analysieren von Proben unter Verwendung von Massenspektrometrie besteht darin, strukturell signifikante Produkt-Ionen unter Verwendung des Verfahrens der Ionendissoziation zu erzeugen. Eine Methode, die allgemein als Data Dependent Neutral Loss MS3 (DDNLMS3) (entwickelt von Coon und Mitarbeitern [47]) bekannt ist, ermöglicht eine selektive Fragmentierung, indem ein Neutralverlustionenfragment aus einem MS/MS-Experiment isoliert und dann einer weiteren Dissoziation unterzogen wird [ 48]. Trotzdem konnten wir mit DDNLMS3 keine so effizienten Ergebnisse erzielen wie bei der Verwendung von MSA für unsere Protein-Kinasen-Analysen. Es ist bekannt, dass die Produktion neutraler Verlustionen bei MS/MS fast immer von einer teilweisen Fragmentierung des Vorläuferions begleitet wird und diese diagnostischen Fragmentionen anschließend verloren gehen, wenn die neutralen Verlustionen für MS3 isoliert werden. Die mehrstufige Aktivierung (oder Pseudo-MS3) ermöglichte es uns, Spektren zu erhalten, die eine Kombination aus MS/MS und MS3-Fragmentierung waren und so die informativen Fragmente des Vorläuferions effizienter zurückhalten. Dies ist auf die Tatsache zurückzuführen, dass MSA strukturell informativere Ionen produzierte, indem der Ionenisolationsschritt zwischen MS/MS und MS3 für die Untersuchung der phosphorylierten Proteinkinasen p38 und HuR . eliminiert wurde in vitro. Wir haben beobachtet, dass - in dieser Forschungsstudie zu den zuvor phosphorylierten Proteinen nach in vitro Kinasereaktion – mehrstufige Aktivierung war ein schnellerer Weg zu informationsreicheren Spektren, da die Ionenfalle für den MS3-Scan nicht nachgefüllt werden muss, wie beim traditionellen Neutralverlustexperiment (DDNLMS3). Wir schlossen während der ersten Test-Analysen der Proteinkinasen in vitro, dass im Vergleich zu DDNLMS3 eine mehrstufige Aktivierung Spektren mit erhöhter Signalintensität und einer größeren Anzahl strukturell diagnostischer Ionen für phosphorylierte Peptide erzeugte. Daher haben wir MSA als Routinemethode für diese Art von Analyse gewählt (p38- und HuR-phosphorylierte Kinasen in vitro). Weitere Vorteile der mehrstufigen Aktivierung werden in anderen Studien zu Phosphopeptiden, einschließlich groß angelegter Analysen, gezeigt [49]. Die durch mehrstufige Aktivierung erzeugten informationsreichen Spektren waren für diese Verbindungen besonders wichtig, da bei MS/MS oft ein erheblicher Verlust an sequenzinformativen Fragmentionen auftritt. Für diese Studie wurden mit mehrstufiger Aktivierung mehr Ionen identifiziert als mit MS/MS oder MS3 in der DDNLMS3-Methode. Darüber hinaus waren die Signalintensitäten bei mehrstufiger Aktivierung im Allgemeinen höher als bei MS/MS oder MS3 der DDNLMS3-Methode. Tatsächlich führte die mehrstufige Aktivierung zu mehr Informationen für die untersuchten Phosphopeptide (Tabelle 1) (siehe ein Beispiel für das Spektrum eines identifizierten phosphorylierten Peptids bei Verwendung von SIMAC gekoppelt an MSA im LTQ-Ionenfallen-Massenspektrometer und Mascot, Abbildung 2) .

Phospho-Site-Zuordnung und manuelle Validierung des phosphorylierten Peptids VLVDQ TTph GLSR erhalten durch Maskottchen-Analyse. Die resultierende monoisotope Masse des neutralen Peptids Mr (ber.) betrug 1267.6173. Als feste Modifikationen wurden gewählt: Carbamidomethyl (C), während für variable Modifikationen T7: Phospho (ST) mit neutralen Verlusten 97,9769 (in Tabelle gezeigt) gewählt wurde. Das y5-Ion und b7 sind diejenigen, die die Identifizierung des Treonins (5) als phosphorylierte (ph) Aminosäure (T in roter Farbe) ermöglichten. Darüber hinaus ist der Phosphat-Fingerabdruck des Neutralverlusts (NL) vom Elternion auch ein positives Signal für die Phosphorylierung. Sechs b-Ionen bzw. 8 y-Ionen wurden kontinuierlich angepasst.

Dennoch muss darauf hingewiesen werden, dass Jiang und Mitarbeiter für ihre Studien (mit unterschiedlichen Stichproben) eine spezifische Klassifikationsfilterstrategie entwickelt haben, die die Abdeckung der Phosphoproteomanalyse bei Verwendung von NLMS3 signifikant verbessert (siehe oben genannte Referenz [48]). Tatsächlich erreichten Jiang und Mitarbeiter eine höhere Abdeckung der Phosphopeptid-Identifizierungen bei der Verarbeitung und Filterung spezifischer Methoden, die sie für die Spektren von NLMS3 entwickelt hatten, verglichen mit MS2- und MSA-Strategien. In diesem Zusammenhang sollten wir sagen, dass nur ein weiteres Phosphopeptid identifiziert und validiert wurde, als wir SIMAC gekoppelt an MSA (neue 6 identifizierte Phoshopeptide) verwendeten, verglichen mit der Kopplung von SIMAC an DDNLMS3 (5 neu identifizierte Phosphopeptide). Darüber hinaus sind diese 5 neuen identifizierten phosphorylierten Peptide und ihre Phospho-Stellen-Zuordnungen in jeder spezifischen Aminosäure nach beiden Strategien die gleichen (siehe Abbildung 3 und Tabelle 1). Darüber hinaus zeigten die 6 neuen Phosphopeptide und Phospho-Site-Zuordnungen in allen Fällen während der vier dreifachen Experimente, die wir durchgeführt haben, eine hohe Reproduzierbarkeit.

Die Effizienz und Reproduzierbarkeit der Phosphopeptid-Aufreinigung und -Identifikation bei der Verwendung

3 µg Proteinkinasen pro Harz und/oder Phosphoanreicherungsmethode (SIMAC, TiO 2und IMAC) gekoppelt an R3/C18 und MSA-LTQ Ionenfallen-Massenspektrometer dargestellt. [EIN] Es wurden vier Dreifachversuche durchgeführt, um die Phosphopeptide zu identifizieren. Die Identifizierungen der Phosphostellen wurden aus gepoolten und nicht gepoolten Assays (Inter- und Intra-Assays) durchgeführt, was eine hohe Reproduzierbarkeit bestätigt. Die 6 identifizierten phosphorylierten Peptide wurden isoliert und in den vier Dreifachanalysen nicht nur von Mascot (mindestens 4 kontinuierlich -y- und -b-Ionen abgeglichen) sondern auch durch manuelle Inspektion aller Spektren validiert. SIMAC ermöglichte die Reinigung von 3 phosphorylierten Proteinen: HuR-RNA-Bindung, p38-MAP-Kinase und Trapped Ubiquitin-Like Protein Activation Complex sowie 6 phosphorylierte Peptide, die mit den zuvor genannten Proteinen verwandt sind. TiO2 und IMAC ermöglichten die Isolierung von 2 phoshorylierten Proteinen: HuR-RNA-Bindung und p38-MAP-Kinase sowie 1 Phosphopeptid, das mit der Proteinkinase-HuR-RNA-Bindung verwandt ist. [B] SIMAC gekoppelt an MSA ermöglichte die Identifizierung eines weiteren Phosphopeptids im Vergleich zu SIMAC gekoppelt an DDNLMS3. Dennoch ermöglichten beide Strategien (SIMAC gekoppelt an MSA und SIMAC gekoppelt an DDNLMS3) die Identifizierung der gleichen Anzahl von phosphorylierten Proteinen (3). [C] und [D] Drei phosphorylierte Proteine ​​und sechs Phosphopeptide wurden identifiziert, wenn SIMAC an MSA gekoppelt wurde. Von diesen drei identifizierten Phosphoproteinen wurden sechs Phosphopeptide identifiziert: (a) TiO2 an MSA gekoppelt ermöglichte die Identifizierung von zwei gleichen/gleichen phosphorylierten Proteinen und vier gleichen/gleichen Phosphopeptiden wie SIMAC und (b) IMAC ermöglichte die Identifizierung von einem gleichen/gleichen Protein und zwei gleichen/gleichen Phosphopeptiden. Somit ist SIMAC effizienter als die anderen getesteten Harze für diese Studie, während TiO2 und IMAC bestätigen die Reproduzierbarkeit der identifizierten phosphorylierten Proteine ​​und Phosphopeptide.

Alle unsere MS-Analysen wurden von CID durchgeführt. Wir gehen davon aus, dass die Kombination von CID mit ETD- oder ECD-Fragmentierung wahrscheinlich mehr und/oder komplementäre Daten gemäß der methodologischen Studie von Navajas und Mitarbeitern erhalten würde [50]. ECD tritt nur auf dem Peptidrückgrat auf - was ein Vorteil ist - und labile Phosphatgruppen bleiben an den resultierenden c- und z-Fragmentionen intakt, wodurch eine komplementäre Identifizierung anderer spezifischer Phosphorylierungsstellen ermöglicht würde [51, 52]. Wir empfehlen daher zunächst CID zu verwenden und würden empfehlen, auf ETD umzusteigen, falls Sie die Phosphorylierungsstelle nicht bestimmen konnten, wenn Sie die Möglichkeit des benötigten Instruments haben [53–57]. Die gereinigten, identifizierten und validierten Phosphopeptide, einschließlich der Ortszuordnungen der Phosphatgruppe, sind in Tabelle 1 dargestellt.

Die Effizienz und Reproduzierbarkeit der Phosphopeptid-Aufreinigung und -Identifikation bei der Verwendung

3 µg Proteinkinasen pro Harz und/oder Phosphoanreicherungsmethode (SIMAC, TiO2 und IMAC) gekoppelt an R3/C18 und MSA-LTQ Ionenfallen-Massenspektrometer ist in Abbildung 3 dargestellt.

Ein Beispiel für eine Phospho-Site-Zuordnung und manuelle Validierung des phosphorylierten Peptids (VLVDQTTphGLSR), die durch Mascot-Analyse erhalten wurden, ist in Abbildung 2 dargestellt.

Bioinformatische Modellierung und Molekulardynamiksimulationen

Um die potentielle funktionelle Wirkung der Serinphosphorylierung an den oben angegebenen Sequenzstellen zu untersuchen, wurden 3D-Strukturmodelle für den phosphorylierten Zustand von sowohl MAP-Kinase p38beta (p38B) als auch HuR unter Verwendung bioinformatischer Verfahren erstellt. Wie in 4 gezeigt, befindet sich phosphoryliertes Ser-279 von p38B in einer Schleife, die auf der äußeren Oberfläche der Proteinstruktur platziert ist, weit weg vom aktiven Zentrum der Kinase. Es ist vorstellbar, dass die Phosphorylierung dieses Rests die p38B-Strukturstabilität oder -faltung nicht beeinflusst, aber externe Kontakte zu begleitenden Proteinen modulieren die Natur der mutmaßlichen Wechselwirkung (siehe zuvor erwähnte Referenz [39]).

Lage von phosphoryliertem Ser-279 in der Proteinstruktur der humanen MAP-Kinase p38beta (p38B). Ein Modell für phosphoryliertes Serin wurde in der strukturellen Position des Rests Ser-279 in den kristallographischen 3D-Koordinaten von p38B (Proteindatenbankcode: 3GC8) lokalisiert. Die Position der ATP-Bindungsstelle ist angegeben. Der Plot wurde unter Verwendung von PyMOL (DeLano Scientific, San Carlos, CA) erstellt.

Im Fall von HuR fällt nur einer der vier gefundenen phosphorylierten Reste (Ser-48) in eine Strukturdomäne des zuvor kristallisierten Proteins: das dimmerisierte erste RNA-Erkennungsmotiv (siehe zuvor erwähnte Referenz [40]). Somit konnte nur der mutmaßliche strukturelle Effekt des phosphorylierten und nicht phosphorylierten Zustands von Ser-48 durch strukturelle Bioinformatik-Tools einschließlich Molecular Dynamics (MD)-Simulation analysiert werden.

Wie in 5A gezeigt, befindet sich Ser-48 in der Dimmerisierungsoberfläche, umgeben von den Resten Glu-47 und Lys-50, die ein Paar von Salzbindungen bilden, die möglicherweise an der Stabilisierung des Dimmers beteiligt sind.Um die Wirkung der Anwesenheit eines phosphorylierten Sers auf die Aufrechterhaltung der Quartärstruktur zu testen, wurden zwei uneingeschränkte MD-Computersimulationen in Anwesenheit oder Abwesenheit eines phosphorylierten Sers in Position 48 durchgeführt, wie unter "Materialien und Methoden" angegeben. Die nach 10 ns MD erhaltenen Ergebnisse zeigten, dass im Fall der nicht phosphorylierten Dimmerstruktur (nicht phosphoryliertes Ser-48) beide Monomere eine signifikante Verschiebung von ihren anfänglichen relativen Positionen zeigten, was zu einer vollständigen Desorganisation der Quartärstruktur führte (Abbildung 5B -links-). Die Messung der quadratischen Mittelwertabweichung (RMSD) der Monomere und des Dimmers sowie der Abstände zwischen den C-Atomen der Kontaktreste (Glu47A-Lys50B, Ser48A-Ser48B und Lys50A-Glu48B) zeigten eine klare und irreversible Verschiebung von die Anfangswerte während der ersten Schritte der MD-Simulation (Abbildung 5C, obere Diagramme). Wenn dagegen dieselbe MD-Simulation in Gegenwart eines phosphorylierten Sers in Position 48 beider Monomere durchgeführt wurde, wurde eine klare Stabilisierung der dimmerisierten Struktur erhalten, die keine Verschiebung von ihrer ursprünglichen Position zeigte (Abbildung 5B -rechts-) und konstante . aufwies Werte von RMSD-Werten und unveränderlichen RMSD-Werten und Abständen zwischen Kontaktresten (Abbildung 5C, untere Diagramme).

Einfluss der Phosphorylierung von Ser-48 auf die Stabilität der Dimmerstruktur des ersten RNA-Erkennungsmotivs von HuR. [EIN] Kristallstruktur des HuR-Dimmers (Proteindatenbankcode: 3HI9, Ketten B und D), die die Position von Ser-48, Glu-47 und Lys-50 in der Dimmerisierungsoberfläche anzeigt. [B] Relative räumliche Position der beiden HuR-Monomere nach 10 ns uneingeschränkter Molecular Dynamics (MD)-Simulation sowohl des nicht-phosphorylierten (rote Struktur, links) als auch des phosphorylierten (grüne Struktur, rechts) Zustands von Ser-48. Die Position der anfänglichen Dimmerstruktur vor der MD-Simulation ist zum Vergleich enthalten (in grau). Beachten Sie die große Verschiebung des nicht phosphorylierten Zustands im Gegensatz zur Stabilität des Dimmers in Gegenwart von phosphoSer48. Die jeweiligen Positionen von Ser-48 und PhosphoSer-48 sind angegeben. [C] Links: gemessene RMSD-Werte für HuR-Dimmer (rot) Monomer A (blau) und Monomer B (grün) während der 10-ns-Trajektorie der uneingeschränkten MD-Simulation des Dimmers in Gegenwart von nicht phosphoryliertem Ser-48 (HUR-Plot, oberes Feld .) ) oder phosphoryliertes pSer-48 (HURP-Diagramm, unteres Feld). Rechts: kontinuierliche Messung der Cα Cα-Abstände zwischen den Resten E47(A)-K50(B) (rot), S48(A)-S48(B) (blau) und E47(A)-K50(B) (grün), während die MD-Trajektorie. Die Verzerrung des HuR-Dimmers in Gegenwart von Ser-48 (HUR-Plot, oberes Feld) im Vergleich zum phosphorylierten Zustand des Proteins (HURP-Plot, unteres Feld) ist sowohl bei RMSD- als auch bei Cα-Cα-Messungen offenkundig. Strukturplots wurden wie in Abbildung 4 erstellt.

Diese Ergebnisse legen nahe, dass die Phosphorylierung von Ser48 im ersten Protein-RNA-Erkennungsmotiv von HuR möglicherweise eine stabilisierende Wirkung hat und eine regulatorische Rolle auf die biologische Funktion des Proteins ausübt, indem es die Aufrechterhaltung des dimmerisierten quartären Zustands reguliert, eine Voraussetzung für den Komplex vor RNA-Bindungsaktivität [58].


Abstrakt

Myelinbasisches Protein (MBP) bindet an negativ geladene Lipide auf der zytosolischen Oberfläche von Oligodendrozytenmembranen und ist höchstwahrscheinlich für die Adhäsion dieser Oberflächen in der mehrschichtigen Myelinscheide verantwortlich. Es kann auch Aktin polymerisieren, F-Aktin-Filamente bündeln und Aktin-Filamente durch elektrostatische Wechselwirkungen an Lipiddoppelschichten binden. MBP besteht aus einer Reihe posttranslational modifizierter Isomere unterschiedlicher Ladung, von denen einige aus der Phosphorylierung an mehreren Stellen durch verschiedene Kinasen, einschließlich Mitogen-aktivierter Proteinkinase (MAPK), resultieren. Die Phosphorylierung von MBP in Oligodendrozyten erfolgt als Reaktion auf verschiedene extrazelluläre Stimuli. Phosphorylierung/Dephosphorylierung von MBP tritt auch in der Myelinscheide als Reaktion auf elektrische Aktivität im Gehirn auf. Hier untersuchen wir die Wirkung der Phosphorylierung von MBP auf seine Wechselwirkung mit Aktin in vitro, indem wir das am höchsten geladene unmodifizierte Isomer, C1, an zwei Stellen mit MAPK phosphorylieren. Die Phosphorylierung verringerte die Fähigkeit von MBP, Aktin zu polymerisieren und Aktinfilamente zu bündeln, hatte jedoch keinen Einfluss auf die Dissoziationskonstante des MBP-Actin-Komplexes oder auf die Fähigkeit von Ca 2+ -Calmodulin, den Komplex zu dissoziieren. Der bedeutendste Effekt der Phosphorylierung auf den MBP-Actin-Komplex war eine dramatische Verringerung seiner Fähigkeit, an negativ geladene Lipiddoppelschichten zu binden. Der Effekt war viel größer als der zuvor für ein anderes Ladungsisomer von MBP, C8, berichtete, bei dem sechs Arginine zu Citrullin deiminiert wurden, was zu einer Verringerung der positiven Nettoladung um 6 führte der Wechselwirkung von MBP mit Aktin kann die Phosphorylierung aufgrund eines ortsspezifischen elektrostatischen Effekts oder einer Konformationsänderung einen zusätzlichen Effekt haben. Somit schwächt die Phosphorylierung von MBP, die als Reaktion auf verschiedene extrazelluläre Signale sowohl in Myelin als auch in Oligodendrozyten auftritt, die Fähigkeit von MBP ab, Aktin zu polymerisieren und zu bündeln und es an eine negativ geladene Membran zu binden.

Diese Arbeit wurde durch ein Stipendium des Canadian Institutes of Health Research an JMB unterstützt.

An wen ist die Korrespondenz zu richten: Division of Structural Biology and Biochemistry, Hospital for Sick Children, 555 University Ave., Toronto, ON, Kanada M5G 1X8. Tel.: (416) 813-5919. Fax: (416) 813-5022. E-Mail: [E-Mail protected]

Abteilung für Strukturbiologie und Biochemie, Forschungsinstitut, Krankenhaus für kranke Kinder.

Abteilung für Pädiatrische Laboratoriumsmedizin, Krankenhaus für kranke Kinder.


Material und Methoden

Materialverfügbarkeit

Weitere Informationen und Anfragen nach Ressourcen und Reagenzien sind an Chiara Francavilla zu richten und werden von dieser per E-Mail an [email protected] bearbeitet.

Tabelle Reagenzien und Werkzeuge

Diese Informationen sind in einer separaten Reagenzien- und Werkzeugtabelle enthalten.

Reagenz oder Ressource Quelle Kennung
Antikörper
Kaninchen-Anti-Phospho-EGF-Rezeptor (Tyr1068) Antikörper Zellsignaltechnologie 2234S
Monoklonales Phospho-p38-MAPK der Maus (Thr180/Tyr182) (28B10) Zellsignaltechnologie 9216S
Polyklonales CDK1 vom Kaninchen (Phospho T161) Abcam ab47329-100ug
Kaninchen polyklonales CDK1 Abcam ab131450-100ug
Monoklonaler FIP1/RCP-Antikörper der Maus Biotechnologie NBP2-20033
Maus monoklonal ERK 1/2 Santa Cruz Biotechnologie sc-135900
Monoklonales γ-Tubulin . der Maus Sigma-Aldrich T5326
Monoklonales Maus-Vinculin Sigma Aldrich V9264-200UL
Kaninchen polyklonaler pEGFR Thr669 Zellsignaltechnologie 3056s
Kaninchen monoklonaler pEGFR Thr669 Zellsignaltechnologie 8808s
Kaninchen monoklonal p44/42 MAPK (Erk1/2) (137F5) Zellsignaltechnologie 4695S
Maus monoklonales GAPDH Abcam ab8245-100ug
Monoklonaler Maus-EGFR (Ab-1) Merck GR01L-100UG
Kaninchen polyklonaler EGFR Millipore 06-847
Monoklonaler FGFR1-Antikörper vom Kaninchen D8E4 Zellsignaltechnologie 9740
Kaninchen polyklonal SH3BP4 Abcam-SPS ab106609-100ug
Monoklonaler Kaninchen-FGF-Rezeptor 2 (D4L2V) Zellsignaltechnologie 23328S
Kaninchen monoklonal P38 Zellsignaltechnologie 9212
Monoklonales GFP vom Kaninchen Zellsignaltechnologie 2956
Peroxidase-AffiniPure F(ab')2-Fragment Ziege Anti-Maus-IgG (H + L) (min X Hu, Bov, Hrs Sr Prot) Stratech 115-036-062-JIR-0.5ml
Peroxidase-AffiniPure F(ab')2-Fragment Ziege Anti-Kaninchen IgG (H + L) (min X Hu Sr Prot) Stratech 111-036-045-JIR-0.5m
Maus monoklonal zu EEA1 BD Biowissenschaften 610457
Ziege anti-Kaninchen IgG (H + L) Sekundärantikörper, Alexa Fluor® 488 Konjugat Invitrogen A11034
Ziege anti-Maus IgG (H + L) Sekundärantikörper, Alexa Fluor® 488 Konjugat Invitrogen A11001
Ziege anti-Kaninchen IgG (H + L) Sekundärantikörper, Alexa Fluor® 568 Konjugat Invitrogen A11011
Donkey Anti-Maus IgG (H + L) Sekundärantikörper, Alexa Fluor® 647 Konjugat Invitrogen A31571
Donkey Anti-Kaninchen IgG (H + L) Sekundärantikörper, Alexa Fluor® 647 Konjugat Invitrogen A31573
Bakterien- und Virusstämme
NEB® 10-beta Kompetente E. coli (High Efficiency) New England Biolabs Katze. Nr: C3019H
Biologische Proben
Chemikalien, Peptide und rekombinante Proteine
Trypsin Schweinepankreas (Proteomics grade) Sigma-Aldrich T6567
Lysyl-Endopeptidase FUJIFILM Wako Chemicals 2541
TiO-Perlen „Titansphären“ GL Wissenschaften 5020-75000
Vorgefertigtes Verlaufsgel: Nu-PAGE 4-12% Bis-Tris Gel 1.0mm 10 Well Invitrogen NP0321BOX
Sep-Pak Classic C18 Patronen Gewässer WAT051910
Festphasen-Extraktionsscheibe „Empore“ C18 (Octadecyl) 3 M Agilent-Technologien 2215
Festphasen-Extraktionsscheibe „Empore“ C8 (Octyl) 3 M Agilent-Technologien 2214
L-ARGININ:HCL Cambridge Isotope Laboratories CLM-2265-H-0,25
L-ARGININ:HCL Cambridge Isotope Laboratories CNLM-539-H-0.5
L-ARGININ:HCL Sigma-Aldrich A6969
L-LYSIN:2HCL Cambridge Isotope Laboratories DLM-2640-0.5
L-LYSIN:2HCL Cambridge Isotope Laboratories CNLM-291-H-0.5
L-LYSIN:2HCL Sigma-Aldrich L8662
2,5-Dihydroxybenzoesäure Sigma-Aldrich 85707
RPMI 1640 Medium für SILAC ThermoFisher Scientific 88365
TRIzol™ Reagenz ThermoFisher Scientific Katze. Nr. 15596026
DIHYDROETHIDIUM Cambridge Bioscience 12013-5mg-CAY
Höchst 33342 New England Biolabs 4082S
Lipofectamin RNAiMAX Transfektionsreagenz ThermoFisher Scientific 10601435
Lipofectamin-Transfektionsreagenz Lebenstechnologien 18324020
FuGENE HD Transfektionsreagenz Promega Deutschland E2311
Natriumpyruvat-Lösung 100mM (100ml) Sigma-Aldrich S8636-100ML
Kristallviolett-Lösung Sigma-Aldrich V5265-250ML
Carestream Kodak BioMax MR-Folie Kodak Z350370-50EA
Xtra-Clear flache 8-Streifen-Kappen Sternlabore I1400-0900-C
96-Well-PCR-Platte Non-Skirted Low Profile Natural Sternlabore E1403-0200-C
RPMI 1640 Medium Glutamax Ergänzung (500ml) Gibco 61870010
ReliaPrep RNA-Zell-Miniprep-System NEB Z6011
Farblich vorgefärbter Proteinstandard, breites Sortiment NEB P7712S
Vorgefärbter Proteinstandard, breite Palette Sigma-Aldrich SDS7B2
PURELINK QUICK MINI NEB? K210010
T4-DNA-Ligase 20.000 u NEB? M0202S
DMEM High Glucose HEPES ohne Glutamin und Natriumpyruvat Sigma-Aldrich D6171-6X500ML
DMEM AQ-Medium Sigma-Aldrich D0819-500ml
RPMI 1640 w/L-Glutamin-Bicarbonat Sigma-Aldrich R8758-6X500ML
Q5 High Fidelity 2x Mastermix NEB M0492S
Nährstoffmischung F12 HAM Sigma-Aldrich N6658-500ML
Menschliches EGF (tierfrei) PeproTech AF-100-15-1000
VORGEFÄRBTER MOLEKULARGEWICHTSMARKER, MW 2 Sigma-Aldrich SDS7B2-1VL
MG132 Fisher Wissenschaft 15465519
HYPERFILM ECL 18X24CM VWR International Ltd 28-9068-37
Albumin, Rinderfraktion V (BSA), 100 Gramm Kat.-Nr.: A30075-100.0 Melford Biolaboratories Ltd A30075-100.0
Bradford-Reagenz Bio-Rad 5000205
Klarheit ECL Bio-Rad 1705061
GoScript Reverse Transcription Mix, zufällige Primer Promega A2801
Pierce Protease-Inhibitor-Tabletten-20 Tabletten Lebenstechnologien A32963
MEMBRAN PROTRAN 0,45uM NC 300MMX4 M VWR 10600002
qPCRBIO SyGreen Mix Separate-ROX pcr-biosysteme PB20.14-50
ProLong Diamond Antifade Mountant-2 ml Lebenstechnologien P36965
ExoSAP-IT Lebenstechnologien 78250.40.ul
DMSO Sigma-Aldrich 276855-250ml
ACETONITRIL VWR International Ltd 1.00030.2500
HEPARIN-NATRIUMZELLKULTUR GETESTET Sigma-Aldrich H3149-100KU
Eskorte IV SLS L3287-1ML
Penicillin-Streptomycin (10.000 U/ml) Life Technologies Ltd 15140122
Menschliches EGF Sigma-Aldrich E9644-.2MG
Humanes TGFα Pepro Tech Limited 100-16A
Menschliches FGF1 Pepro Tech Limited 100-17A-50
Menschliches FGF7 Francavilla et al 2013 PI: Prof. Olsen
Menschliches FGF3 Biotechnologie 1206-F3-025
Menschliches FGF10 Francavilla et al 2013 PI: Prof. Olsen
Enkamin-E Pepro Tech Limited A14-529EP
PD173074 Selleckchem S1264
AG1478 Zellsignalisierungstechnologien 9842
U2106 Zellsignalisierungstechnologien 9903
MEK162 APEXBIO A1947
BMS582949 Selleck Chem S8124
Collagen I, HC, Rattenschwanz, 100 mg Corning 354249
FIBRONEKTIN AUS RINDER PLASMA Sigma F1141-1MG
DMEM-Pulver, hochglukose Thermo Fisher 52100021
Fetales Rinderserum, südamerikanischer Ursprung Lebenstechnologien 10270106
TW PC MEMBRANE,6.5MM,8.0UM Transwell-Einsätze Sigma Aldrich CLS3422-48EA
Calcein AM-Zelle permanenter Farbstoff Fisher Scientific C1430
Eisessig (HPLC-Qualität) Fisher Scientific Deutschland 10060000
Ameisensäure (HPLC-Qualität) Sigma-Aldrich 5438040250
Trifluoressigsäure (Spektroskopiequalität) Sigma-Aldrich 1082621000
Entsorgen Stammzelltechnologien 7913
Matrigel Corning 354230
DAPI (4',6-Diamidino-2-Phenylindol, Dihydrochlorid) Lebenstechnologie D1306
Transferrin aus Humanserum, Alexa Fluor™ 647 Konjugat Invitrogen T23366
Transferrin aus Humanserum, Tetramethylrhodamin-Konjugat Invitrogen T2872
Kritische kommerzielle Tests
Click-iT EdU Alexa Fluor 488 Imaging Kit-1 Kit Lebenstechnologien C10337
Venor®GeM Classic Mycoplasma PCR Detection Kit (100 Tests) Cambridge Bioscience 11-1100
ProtoScript II-Erststrang-cDNA-Synthese-Kit New England Biolabs E6560L
ReliaPrep RNA-Zell-Miniprep-System Promega Z6011
Tumordissoziationskit Miltenyi Biotec 130-095-929
Isolate II PCR- und Gel-Kit Bio-Linie BIO-52059
Isolat II-Plasmid-Mini-Kit Bio-Linie BIO-52056
Hinterlegte Daten
Rohdaten (MS) Dieses Papier http://proteomecentral.proteomexchange.org/cgi/GetDataset (Datensatzkennung PXD018184)
Experimentelle Modelle: Zelllinien
MCF-7 LGC ATCC® HTB-22
MDA-MB-415 LGC ATCC® HTB-24
BT20 LGC ATCC® HTB-19
HCC1937 LGC ATCC® CRL-2336
T47D LGC ATCC® HTB-133
BT549 LGC ATCC® HTB-122
Experimentelle Modelle: Organismen/Stämme
BB6RC37 Eyre et al ( 2016 ) PI: R. Clarke
Oligonukleotide
SIRNA UNIV NEGATIVE KONTROLLE #2 Sigma-Aldrich SIC002
GGAGAUGAAAGUGUCAAGCCGAGAUA Invitrogen SH3BP4HSS119149
CCCAGGAUCUCAAGGUCUGUAUGUU Invitrogen SH3BP4HSS119150
CCUGAUUGACCUGAGCGAAGGGUUU Invitrogen SH3BP4HSS119151
GGUCCUCAAACAGAAGGAAACGAUA Invitrogen RAB11FIP1HSS149439
GAAGACUACAUUGACAACCUGCUUG Invitrogen RAB11FIP1HSS149440
UCCGCAUCCCGACUCAGGUUGGCAA Invitrogen RAB11FIP1HSS149441
CGGAAUAGGUAUUGGUGAAUUUAAA Invitrogen EGFRHSS176346 (G01)
CCUAUGCCUUAAGCAGUCUUAUCUAA Invitrogen EGFRSS103116 (G06)
CCCGUAAUUAUGUGGUGACAGAUCA Invitrogen EGFRSS103114 (G09)
CCN1 F- GGTCAAAGTTACCGGGCAGT R- GGAGGCATCGAATCCCAGC Im Haus n / A
DUSP1 F- GCCTTGCTTACCTTATGAGGAC R-GGGAGAGATGATGCTTCGCC Im Haus n / A
FOS F- AGGAGGGAGCTGACTGATACACT R- TTTCCTTCTCCTTCAGCAGGTT Im Haus n / A
JUNB F- ACGACTCATACACAGCTACGG R- GCTCGGTTTCAGGAGTTTGTAGT Im Haus n / A
TIMP3 F- CATGTGCAGTACATCCATACGG R- CATCATAGACGCGACCTGTCA Im Haus n / A
EGR1 F- GAGAAGGTGCTGGTGGAGAC R- CACAAGGTGTTGCCACTGTT Im Haus n / A
BCL10 F- GTGAAGAAGGACGCCTTAGAAA R- TCAACAAGGGTGTCCAGACCT Im Haus n / A
CTGF F- CAGCATGGACGTTCGTCTG R- AACCACGGTTTGGTCCTTGG Im Haus n / A
MCL1 F-ATCTCTCGGTACCTTCGGGAGC R- GCTGAAAACATGGATCATCACTCG Im Haus n / A
DUSP6 F- CCGCAGGAGCTATACGAGTC R- CGTAGAGCACCACTGTGTCG Im Haus n / A
ABHD5 F- GCTGCTGCTTACTCGCTGAA R- TCTGATCCAAACTGGAATTGGTC Im Haus n / A
KDM6B F- CACCCCAGCAAACCATATTATGC R- CACACAGCCATGCAGGGATT Im Haus n / A
MXD1 F- CGTGGAGAGCACGGACTATC R- CCAAGACACGCCTTGTGACT Im Haus n / A
NDRG1 F CTCCTGCAAGAGTTTGATGTCC - R- TCATGCCGATGTCATGGTAGG Im Haus n / A
SPRY2 F- CCTACTGTCGTCCCAAGACCT R- GGGGCTCGTGCAGAAGAAT Im Haus n / A
ID4 F- TGCCTGCAGTGCGATATGAA R- GCAGGTCCAGGATGTAGTCG Im Haus n / A
FGFR2b F- AACGGGAAGGAGTTTAAGCAG R- CTCGGTCACATTGAACAGAG Im Haus n / A
BETA-AKTIN F- TGGAACGGTGAAGGTGACAG R- AACAACGCATCTCATATTTGGAA Im Haus n / A
GAPDH F- CAATGACCCCTTCATTGACC R- GACAAGCTTCCCGTTCTCAG Im Haus n / A
Rekombinante DNA
EGFR (pRK5-EGFR) Addgene Plasmid #65225
EGFRT693A Mutagenese von oben
eGFP-Rab11 Addgene Plasmid #12674
eGFP-Rab11_S52N Mutagenese von oben
Dynamin_K44a-eGFP Mutagenese des Addgen-Plasmids Plasmid # 34680
HA-FGFR1c Francavilla et al ( 2009 ) PI: Dr. Cavallaro
HA-FGFR2b Francavilla et al ( 2013 ) PI: Prof. Olsen
HA_FGFR2b_Y656F/Y657F Francavilla et al ( 2013 ) PI: Prof. Olsen
HA-FGFR4 kloniert unter Verwendung von humaner cDNA mit den Primern F-GGGGCCCAGCCGGCCAGACTGGAGGCCTCTGAGGAAGTGGAGCTTGAGCC R -GTCGACCTGCAGTGTCTGCACCCCAGACCCGAAGGGGAAGGAGCTGGATCC Für diese Studie erstellt n / A
Software und Algorithmen
Fidschi - Image J-Version: 1.52p Schindelin et al ( 2012 ) https://imagej.net/Fidschi
GraphPad Prism-Version 8.0.0 GraphPad-Software www.graphpad.com
MaxQuant-Version 1.5.6.5 Cox und Mann ( 2008 ) http://www.coxdocs.org/doku.php?id=maxquant:start
WebGestalt 2019 Liao et al (2019) http://www.webgestalt.org/
Perseus-Versionen 1.6.5.0 oder 1.6.2.1.: Tyanova et al (2016) http://www.coxdocs.org/doku.php?id=maxquant:start
Cytoscape-Version 3.7.2 Shannon et al ( 2003 ) https://www.cytoscape.org
STRING-Version 11 Schreibklarczyk et al ( 2019 ) https://string-db.org/
R-Framework R-Kernteam ( 2018 ) https://www.r-project.org/
Sonstiges
Konfokales Mikroskop Leica Sp8 invertiert Lecia
Mx3000P qPCR-Gerät Agilent
UltiMate® 3000 Rapid Separation LC Dionex
QE-HF LC-MS/MS Thermo Fisher Scientific

Methoden und Protokolle

Experimentelle Modelle

Zellkultur und SILAC-Markierung

Humane Brustkrebszelllinien wurden von ATCC gekauft, durch Short Tandem Repeat (STA)-Analyse von 21 Markern von Eurofins Genomics authentifiziert, monatlich auf Mykoplasmen über einen PCR-basierten Nachweisassay (Venor®GeM – Cambio) überprüft und in den angegebenen Medien gezüchtet ergänzt mit 2 mM L-Glutamin und 100 E/ml Penicillin, 100 µg/ml Streptomycin und 10 % fötalem Rinderserum. MCF-7 wurde in DMEM/F12 gezüchtet. MDA-MB-415 und BT20 wurden in DMEM gezüchtet. HCC1937, T47D und BT549 wurden in RPMI gezüchtet. 1 mM Natriumpyruvat wurde zu T47D gegeben.

Für die quantitative Massenspektrometrie wurden BT549- oder T47D-Zellen in SILAC RPMI (PAA Laboratories GmbH, Deutschland) markiert, ergänzt mit 10 % dialysiertem fötalem Rinderserum (Sigma), 2 mM Glutamin (Gibco), 100 U/ml Penicillin und 100 µg/ml Streptomycin für 15 Tage, um den vollständigen Einbau der Aminosäuren sicherzustellen, was durch MS-Analyse bestätigt wurde. Drei Zellpopulationen wurden erhalten: eine mit natürlichen Varianten der Aminosäuren markiert (leichte Markierung Lys0, Arg0), die zweite mit mittleren Varianten von Aminosäuren (mittlere Markierung L-[13C6] Arg (+6) und L-[2H4 ]Lys (+4) Lys4/Arg6) und die dritte mit schweren Varianten der Aminosäuren (schwere Markierung L-[13C6,15N4]Arg (+10) und L-[13C6,15N2]Lys (+8) Lys8 /Arg10).Die leichten Aminosäuren stammten von Sigma, während ihre mittleren und schweren Varianten von Cambridge Isotope Labs (Massachusetts, USA) stammten.

Organoidkultur und Proteinisolierung bei Brustkrebs

Organoide wurden aus einem dreifach-negativen Brustkrebs-PDX-Tumor BB6RC37 (Eyre et al., 2016). Die Tumoren wurden zerkleinert und mit einem Tumordissoziationskit (Miltenyi Biotec) auf einem Orbitalschüttler bei 37 °C für 1–2 h verdaut. Die Zellen wurden nacheinander durch 100-µm- und 40-µm-Maschen gesiebt. 50.000 Zellen wurden in 50 µl kaltem Wachstumsfaktor-reduziertem Matrigel (Corning 354230) resuspendiert, als Kuppeln in einer 24-Well-Platte für 30 Minuten gesetzt und bei 37 °C in Medien kultiviert, wie von (Sachs et al., 2018). Die Organoide wurden in Medien mit oder ohne FGF7/10 14 Tage lang kultiviert, und EGF/Heregulin wurden 24 Stunden vor Erhalt der Lysate aus den Medien entfernt. Lysate wurden hergestellt durch mechanisches Auflösen der Kuppeln und Verdauen des Matrigels für 1 Stunde unter Verwendung von Dispase bei 37ºC (Stem Cell Technologies, 7913). Die Zellen wurden in PBS gewaschen und in Lysepuffer resuspendiert, wie zuvor beschrieben (Santiago-Gomez et al., 2019 ).

Quantitative Phosphoproteomik

Experimentelles Design und Probenvorbereitung

TPA1: für jede Zelllinie und jeden Stimulus analysierten wir Duplikate für jeden Zeitpunkt, wobei sowohl 1- als auch 8-Minuten berücksichtigt wurden. Zeitpunkte als repräsentativ für die frühe Signalisierung. Daher verglichen wir vier markierungsfreie Proben für jeden Stimulus in jeder Zelllinie (Datensätze EV1 und EV2). Das Zellpellet wurde in Denaturierungspuffer (6 M Harnstoff, 2 M Thioharnstoff in 10 mM HEPES pH 8) gelöst. Wir erhielten 1 mg Proteine ​​aus jeder Probe. Cysteine ​​wurden mit 1 mM Dithiothreitol (DTT) reduziert und mit 5,5 mM Chloracetamid (CAA) alkyliert. Proteine ​​wurden mit Endoproteinase Lys-C (Wako, Osaka, Japan) und modifiziertem Trypsin von Sequenziergrad (modifizierter Sequenziergrad, Sigma) verdaut, gefolgt von Quenchen mit 1% Trifluoressigsäure (TFA). Peptide wurden unter Verwendung von Umkehrphasen-Sep-Pak-C18-Kartuschen (Waters, Milford, MA) gereinigt und mit 50% Acetonitril (ACN) eluiert. Nach Entfernen von ACN durch einen Vakuumkonzentrator bei 60ºC wurden die Peptide in Phosphopeptid-Immunpräzipitationspuffer (50 mM MOPS pH 7,2, 10 mM Natriumphosphat, 50 mM NaCl) suspendiert und über Nacht gelöst. Geklärte Peptide wurden in ein neues Röhrchen überführt, das immobilisierte phosphorylierte Tyrosin-Antikörperkügelchen (pY100-AC, Cell Signaling Technologies) enthielt, und zwei Stunden lang bei 4°C inkubiert. Nach fünf Waschungen mit Immunpräzipitationspuffer gefolgt von zwei Waschungen mit 50 mM NaCl wurden die angereicherten Peptide dreimal mit 50 μL 0,1% TFA von den Kügelchen eluiert, auf C18 STAGE-Spitzen geladen und von STAGE-Spitzen mit 20 μL von eluiert 40 % ACN gefolgt von 10 µL 60 % ACN und reduziert auf 5 µL mit SpeedVac und 5 µL 0,1 % Ameisensäure (FA) 5 % ACN hinzugefügt. Peptide aus dem Überstand wurden unter Verwendung von Umkehrphasen-Sep-Pak-C18-Kartuschen (Waters, Milford, MA) gereinigt und mit 50% ACN eluiert und weiter mit Titansphere-Chromatographie für phosphorylierte Serin- und phosphorylierte Threonin-haltige Peptide angereichert. Zu den eluierten Peptiden wurden 6 ml 12% TFA in ACN zugegeben und anschließend mit TiO 2 -Kügelchen (5 µm, GL Sciences Inc., Tokio, Japan) angereichert. Die Kügelchen wurden in 20 mg/ml 2,5-Dihydroxybenzoesäure (DHB), 80 % ACN und 6 % TFA suspendiert und die Proben wurden im Batch-Modus in einem Verhältnis von Probe zu Kügelchen von 1:2 (w/w) inkubiert 15 min mit Rotation. Nach 5-minütiger Zentrifugation wurde der Überstand gesammelt und ein zweites Mal mit einer zweifachen Verdünnung der vorherigen Bead-Suspension inkubiert. Die Kügelchen wurden mit 10 % ACN, 6 % TFA, gefolgt von 40 % ACN, 6 % TFA gewaschen und auf C8-STAGE-Spitzen gesammelt und schließlich mit 80 % ACN, 6 % TFA gewaschen. Die Elution der phosphorylierten Peptide erfolgte mit 20 &mgr;l 5% NH3 gefolgt von 20 &mgr;l 10 % NH3 in 25 % ACN, die in einem Geschwindigkeitsvakuum auf ein Endvolumen von 5 &mgr;l eingedampft wurden. Die konzentrierten phosphorylierten Peptide wurden durch Zugabe von 20 µL 0,1% TFA, 5% ACN angesäuert und auf C18 STAGE-Spitzen aufgetragen. Peptide wurden von STAGE-Spitzen mit 20 μL 40% ACN, gefolgt von 10 μL 60% ACN und ACN eluiert und mit SpeedVac auf 5 μL reduziert und 5 μL 0.1% FA, 5% ACN hinzugefügt.

Eine kleine Menge der eluierten Peptide (1%) wurde zur Proteomanalyse vor der Anreicherung der phosphorylierten Peptide entnommen: Nach Eindampfen im Speed-Vakuum wurden 40 µl 0,1% TFA, 5% ACN zugegeben und anschließend MS-Analyse durchgeführt.

TPA2: Wir analysierten markierungsfreie Triplikate für jede Bedingung, T47D verarmt oder nicht an TTP oder RCP und stimuliert oder nicht mit FGF10. Die Zellen wurden mit PBS gewaschen und bei 4°C in eiskaltem 1% Triton-Lyse-Puffer, ergänzt mit Pierce-Protease-Inhibitor-Tablette (Life Technologies) und Phosphatase-Inhibitoren: 5 nM Na3VO4, 5 mM NaF und 5 mM β-Glycerophosphat, lysiert. Proteine ​​wurden über Nacht bei –20 °C in vierfachem Überschuss an eiskaltem Aceton präzipitiert. Die mit Aceton präzipitierten Proteine ​​wurden in Denaturierungspuffer (10 mM HEPES, pH 8,0,6 M Harnstoff, 2 M Thioharnstoff) solubilisiert, und 5 mg Proteine ​​wurden wie oben beschrieben reduziert, alkyliert und verdaut. Alle Schritte wurden bei Raumtemperatur durchgeführt. Die Peptidmischung wurde entsalzt und auf einer C18-Sep-Pak-Kartusche konzentriert, eluiert und mit TiO2-Beads angereichert, wie oben beschrieben.

TPA3: wir analysierten Duplikate von SILAC-markiertem BT549, transfiziert und behandelt wie in 2A beschrieben. Wir folgten dem gleichen Verfahren, das für TPA2 beschrieben wurde, mit dem einzigen Unterschied, dass 5 mg jedes SILAC-markierten Lysats in gleicher Menge vor dem Verdau und der TiO2-Chromatographie gemischt wurden.

EGFR- und EGFR_T693A-exprimierende T47D-Zellen: wir analysierten Duplikate von SILAC-markiertem T47D, transfiziert und behandelt wie in Fig. 6A beschrieben. Wir folgten dem gleichen Verfahren, das für TPA1 beschrieben wurde, mit dem einzigen Unterschied, dass 5 mg jedes SILAC-markierten Lysats in gleichen Mengen vor dem Verdau und der Anreicherung mit phosphoryliertem Tyrosin gefolgt von TiO2-Chromatographie und Peptidreinigung gemischt wurden.

Massenspektrometer

Gereinigte Peptide wurden durch LC-MS/MS unter Verwendung eines UltiMate® 3000 Rapid Separation LC (RSLC, Dionex Corporation, Sunnyvale, CA), gekoppelt an ein QE-HF (Thermo Fisher Scientific, Waltham, MA)-Massenspektrometer, analysiert. Die mobile Phase A war 0,1% FA in Wasser und die mobile Phase B war 0,1% FA in ACN und die Säule war eine 75 mm × 250 &mgr;m Innendurchmesser 1,7 &mgr;M CSH C18, analytische Säule (Waters). Ein 1 µl-Aliquot der Probe (für die Proteomanalyse) oder ein 3 µl-Aliquot wurde in eine 5 µl-Schleife überführt und mit einem Fluss von 300 nl/min bei 5% B für 5 bzw. 13 min auf die Säule geladen. Die Schleife wurde dann aus der Leitung genommen und der Fluss wurde von 300 nl/min auf 200 nl/min in 1 min und auf 7% B reduziert. Peptide wurden unter Verwendung eines Gradienten von 7% auf 18% B in 64 . getrennt min., dann von 18 % auf 27 % B in 8 min. und schließlich von 27% B auf 60% B in 1 min. Die Säule wurde 3 min bei 60 % B gewaschen. und dann für weitere 6,5 min reäquilibriert. Bei 85 min wurde der Fluss auf 300 nl/min bis zum Ende des Laufs bei 90 min erhöht. Massenspektrometriedaten wurden datengerichtet für 90 min im positiven Modus erfasst. Peptide wurden für die Fragmentierung automatisch durch datenabhängige Analyse auf Basis der Top 8 (Phosphoproteom-Analyse) oder Top 12 (Proteom-Analyse) mit m/z zwischen 300 und 1750 Th und einem Ladungszustand von 2, 3 oder 4 mit einem dynamischen Ausschluss auf 15 s eingestellt. Die MS-Auflösung wurde auf 120.000 mit einem AGC-Ziel von 3e6 und einer maximalen Füllzeit von 20 ms eingestellt. Die MS2-Auflösung wurde auf 60.000 mit einem AGC-Ziel von 2e5 und einer maximalen Füllzeit von 110 ms für Top12-Methoden und 30.000 mit einem AGC-Ziel von 2e5 und einer maximalen Füllzeit von 45 ms für die Top8-Analyse eingestellt. Das Isolationsfenster betrug 1,3 Th (2,6 Th für SILAC-markierte Proben) und die Kollisionsenergie 28.

Analyse von Rohdateien

Rohdaten wurden von der MaxQuant Software Suite (Cox & Mann, 2008) (https://www.maxquant.org Version 1.5.6.5) unter Verwendung der integrierten Andromeda-Suchmaschine (Cox et al., 2011). Proteine ​​wurden identifiziert, indem die HCD-MS/MS-Peaklisten mit einer Ziel-/Köderversion der menschlichen UniProt-Knowledgebase-Datenbank durchsucht wurden, die aus den vollständigen Proteom-Sets und Isoformen bestand (v.2016 https.//uniprot.org/proteomes/UP000005640_9606) ergänzt mit häufig beobachteten Kontaminanten wie Schweinetrypsin und Rinderserumproteinen. Tandem-Massenspektren wurden anfänglich mit einer Massentoleranz von 7 ppm für Vorläufermassen und 0,02 Da oder 20 ppm für Fragmentionen abgeglichen. Als feste Modifikation wurde Cystein-Carbamidomethylierung gesucht. Als variable Modifikationen wurden Protein-N-Acetylierung, N-Pyro-Glutamin, oxidiertes Methionin und Phosphorylierung von Serin, Threonin und Tyrosin gesucht. Als variable Modifikationen für die Proteom-Experimente wurden Protein-N-Acetylierung, oxidiertes Methionin und Deamidierung von Asparagin und Glutamin gesucht. Für die Quantifizierung von SILAC-markierten Proben wurden markiertes Lysin und Arginin als feste oder variable Modifikation angegeben, je nach Vorwissen über das Elternion (MaxQuant SILAC Triplett-Identifikation). In allen anderen Experimenten wurden markierungsfreie Parameter wie beschrieben verwendet (Cox et al., 2014). Die Rate der falschen Entdeckungen wurde für Peptide, Proteine ​​und Modifikationsstellen auf 0,01 gesetzt. Die minimale Peptidlänge betrug sechs Aminosäuren. Standortlokalisierungswahrscheinlichkeiten wurden von MaxQuant unter Verwendung des PTM-Scoring-Algorithmus (Olsen et al., 2006). Die Datensätze wurden nach der Posterior-Error-Wahrscheinlichkeit gefiltert, um eine Fehlentdeckungsrate von unter 1% für Peptide, Proteine ​​und Modifikationsstellen zu erreichen. Es wurden nur Peptide mit einem Andromeda-Score > 40 eingeschlossen.

Daten und statistische Analyse

Alle statistischen und bioinformatischen Analysen wurden mit der frei verfügbaren Software Perseus, Version 1.6.5.0 oder 1.6.2.1 durchgeführt. (Tyanova & Cox, 2018), R-Framework (R Core Team, 2018), Bioconductor R-Paket LIMMA (Bolstad et al., 2003 ), WebGestalt (Liao et al., 2019 ), STRING (Szklarczyk et al., 2019 ), Cytoscape (Version 3.7.2) (Shannon et al., 2003). Alle gemessenen Peptidintensitäten wurden mit der Funktion „normalizeQuantiles“ aus dem Bioconductor R-Paket LIMMA normalisiert, die die Peptidintensitäten so normalisiert, dass jedes Quantil für jede Probe auf den Mittelwert dieses Quantils über den Datensatz eingestellt wird, was zu Peptidintensitätsverteilungen führt, die sind empirisch identisch. Jeder Datensatz wurde einzeln normalisiert. Die anschließende Datenanalyse wurde mit Microsoft Office Excel, R und Perseus durchgeführt. Für die SILAC-Datensätze haben wir die normalisierten SILAC-Verhältnisse aus den MaxQuant-Ausgabe-txt-Dateien verwendet. Nur Peptide mit Lokalisierungswahrscheinlichkeiten höher als 0,75 (Klasse I, gezeigt in den Datensätzen EV1, EV3–EV6 Olsen et al., 2006 ) wurden in die nachgelagerte Bioinformatik-Analyse aufgenommen. Die Pearson-Korrelation wurde in R berechnet. Für TPA1 imputieren wir fehlende Werte unter Verwendung der Perseus-Standardeinstellungen, wir haben die Kontrolle von den logarithmischen Intensitätswerten abgezogen, um alle Zelllinien miteinander vergleichen zu können, und wir haben den Median für jede Bedingung verwendet. Hierarchisches Clustering basierend auf Korrelation wurde nach einem Multi-Sample-ANOVA-Test mit Standardparametern in Perseus durchgeführt. Für TPA2 haben wir den Median berechnet und dann nur Zeilen mit vier gültigen Werten betrachtet, gefolgt von hierarchischem Clustering basierend auf dem euklidischen Abstand in Perseus. Für TPA3 und den EGFR/EGFR_T693A T47D-Datensatz haben wir fehlende Werte unter Verwendung der Perseus-Standardeinstellungen imputiert und dann den Median berechnet, gefolgt von einer hierarchischen Clusterbildung basierend auf der euklidischen Distanz in Perseus. Die in der Folgeanalyse verwendeten Cluster wurden von Perseus definiert und manuell überprüft.

Die Anreicherung von KEGG- oder GO-Termen wurde in WebGestalt mit den ORA-Standardparametern durchgeführt und deutlich überrepräsentierte Terme in den Daten wurden in Balkendiagrammen dargestellt. Der Bezug von Genen zu anderen Krankheiten wurde anhand der Datenbank KRANKHEITEN (Pletscher-Frankild et al., 2015 ).

Alle Proteininteraktionsnetzwerke wurden unter Verwendung der STRING-Proteininteraktionsdatenbank mit hoher Konfidenz und Interaktionen aus den Evidenzkanälen Experimente und Datenbanken erhalten. Die Datenvisualisierung erfolgte mit der Software Cytoscape. Das Venn-Diagramm wurde mit dem Webtool http://bioinformatics.psb.ugent.be/cgi-bin/liste/Venn/calculate_venn.htpl erstellt.

Biochemische Assays

RNA-Isolierung und Echtzeit-PCR-Analyse

RNA aus Zelllinien wurde mit TRIZOL® (Invitrogen) isoliert. Nach Chloroform-Extraktion und Zentrifugation wurden 5 µg RNA unter Verwendung des RNase-freien DNase-Sets (Qiagen) DNase-behandelt und 1 µg DNase-behandelter RNA wurde dann für die cDNA-Synthese unter Verwendung des Protoscript I-Erststrang-cDNA-Synthesekits (New England Biolabs) entnommen. Ausgewählte Gene wurden durch quantitative Echtzeit-PCR (RT-qPCR) mit Sygreen (PCR Biosystems) amplifiziert. Die relative Expression wurde unter Verwendung der Delta-Delta-CT-Methodik berechnet, und Beta-Aktin wurde als Referenz-Housekeeping-Gen verwendet. Sequenzen für verwendete Primer sind in der beigefügten Reagenzientabelle zu finden. Als qPCR-Gerät wurde Applied Biosystems MX300P verwendet.

Transfektion und RNA-Interferenz

Alle Transfektionen wurden in Gibco opti-MEM Glutamax-reduzierten Serummedien (Thermo Fisher Scientific) durchgeführt. Für die RNA-Interferenz wurden alle Zellen mit Lipofectamine RNAiMax (Thermo Fisher Scientific) gemäß den Anweisungen des Herstellers transfiziert. Zur RNA-Interferenz wurden validierte doppelsträngige Stealth-siRNA-Oligonukleotide verwendet. siRNA Universal Negative Control #2 (Sigma-Aldrich) wurde als Kontrolle in allen RNA-Interferenzexperimenten verwendet. BT549- und BT20-Zellen wurden mit Lipofectamine 3000 (Thermo Fisher Scientific) gemäß den Anweisungen des Herstellers, 24 h nach RNA-Interferenztransfektion, wo angegeben, transfiziert. T47D-Zellen wurden unter Verwendung von Escort IV gemäß den Anweisungen des Herstellers wie oben transfiziert. Die Assays wurden 36 h nach der Transfektion durchgeführt, wie zuvor beschrieben (Francavilla et al., 2016). Wenn Assays mehr als 36 Stunden nach der Transfektion durchgeführt wurden, wurden RNAi und Expression zum Zeitpunkt des Assays bewertet, um die Expression zu bestätigen.

Zelllyse, Proteinimmunpräzipitation und Western Blotting

Die Zellen wurden über Nacht in serumfreiem Medium Serum ausgehungert und für die angegebenen Zeitpunkte mit 100 ng/ml FGF7, FGF10, EGF oder TGFα stimuliert. Liganden wurden alle 24 h für eine langfristige (24–72 h) Stimulation aufgefüllt. Wo angegeben, wurden die Zellen 2 h mit 100 nM PD173074, 500 nM AG1478, 20 µM U1206, 1 µM MEK162 oder 10 µM BMS582949 vorinkubiert. Kontrollzellen wurden mit DMSO allein vorinkubiert. Nach der Stimulation wurden Zellextraktion und Immunblotting wie zuvor beschrieben durchgeführt (Francavilla et al., 2016). Proteine ​​wurden durch SDS-PAGE aufgelöst und auf Nitrozellulosemembranen (Protran, Biosciences) übertragen. Die interessierenden Proteine ​​wurden unter Verwendung spezifischer Antikörper sichtbar gemacht, gefolgt von Peroxidase-konjugierten sekundären Antikörpern und einem verbesserten Chemilumineszenz-Kit (Amersham Biosciences). Die Blots wurden entweder durch Filmbelichtung oder das Universal Hood II Gel Molecular Imaging System (Bio-Rad) sichtbar gemacht. Jedes Experiment wurde mindestens dreimal wiederholt und ergab ähnliche Ergebnisse.

Die Immunpräzipitation von FGFR2 aus Zellextrakten wurde wie zuvor beschrieben durchgeführt (Francavilla et al., 2016 ), unter Verwendung von anti-BEK (Santa Cruz Biotechnology, sc-121). Jedes Experiment wurde mindestens dreimal wiederholt und ergab ähnliche Ergebnisse.

Biotinylierungsassays

Biotinylierungs-Pulldown-Experimente wurden wie zuvor beschrieben durchgeführt (Lobingier et al., 2017). Kurz gesagt wurden Biotinylierungsexperimente durchgeführt, indem GFP-Rab11-APEX2-Konstrukte in 2 Millionen Zellen transfiziert wurden, die in 10-cm-Schalen ausplattiert wurden. Die Zellen wurden vorinkubiert (40 min) mit Biotin-Phenol (Iris Biotech), nach Stimulation mit Liganden wurde Wasserstoffperoxid (Sigma-Aldrich) für 1 min zugegeben, bevor mit Trolox (Sigma-Aldrich) und Natriumascorbat (VWR) während eiskalte Lyse. Anschließend wurde ein 2-stündiger RT-Pulldown mit Streptavidin-Kügelchen durchgeführt, wobei der Überstand gegen die gebundenen Proteine ​​laufen gelassen wurde.

Proliferationsassays

Incucyte-Zellproliferationsassay

Die angezeigten Zelllinien wurden in 24-Well-Platten mit einer Dichte von 15.000–20.000 Zellen pro Well ausgesät, abhängig von der Wachstumsrate und dem Design des Experiments. Nach dem Ausplattieren wurden die Zellen alle 24 Stunden ausgehungert und mit den angegebenen Liganden stimuliert und jede Stunde unter Verwendung des Incucyte ZOOM (Essen Bioscience) abgebildet. Phasenkontrastbilder wurden analysiert, um die Zellproliferation basierend auf der Zellkonfluenz nachzuweisen. Und der durchschnittliche Konfluenzwert über 4 h wurde verwendet, um die Anfangskonfluenz zu bestimmen, aus der eine relative Wachstumsänderung berechnet wurde. Die statistische Analyse wurde am Endpunkt über die Wiederholungen hinweg durchgeführt, wie in den Legenden der Abb. angegeben.

Kristallviolett

Die angezeigten Zellen wurden nach dem Experimentieren gefärbt, indem sie mit 0,5% w/v Kristallviolett (Sigma) in 4% w/v Paraformaldehyd/PBS für 30 min fixiert wurden. Die fixierten Zellen wurden dann in 2% w/v SDS/PBS solubilisiert und die Absorption bei 595 nm unter Verwendung eines Synergy H1-Mikroplatten-Lesegeräts (BioTek) gemessen. Die statistische Analyse wurde am Endpunkt über die Wiederholungen hinweg durchgeführt, wie in den Legenden der Abb. angegeben.

EdU-Gründung

Angezeigte Zellen wurden mit 20 µM 5-Ethinyl-2'-desoxyuridin (EdU) für 4 h markiert und nach dem Protokoll des Herstellers verarbeitet (Click-iT® EdU Alexa Fluor® 488 Imaging Kit, Thermo Fisher). Vor der Bildgebung wurden die Zellen dann 15 min lang mit 5 ng/ml Hoecsht 3342 gefärbt. Gefärbte Zellen wurden unter Verwendung eines Leica Mikroskopsystems analysiert. Die statistische Analyse wurde am Endpunkt über die Wiederholungen hinweg durchgeführt, wie in den Legenden der Abb. angegeben.

Invasionsassay

Von Rattenschwanz stammendes Kollagen I (Corning) wurde mit 25 µg/ml humanem Fibronektin (Sigma) in DMEM ergänzt und in 8 µm Transwell-Inserts (Corning) für 30 Minuten bei Raumtemperatur, gefolgt von 30 Minuten bei 37 °C/5 . polymerisiert % CO2. 5 × 10 4 BT20-Zellen wurden auf der Rückseite jedes Einsatzes ausgesät und 6 h bei 37 °C/5 % CO2 inkubiert. Die Einsätze wurden vorsichtig gewaschen und in serumfreies DMEM gelegt und die obere Kammer mit DMEM, ergänzt mit 10 % FCS (Life Technologies) und entweder PBS oder 100 ng/ml FGF10 (PeproTech), gefüllt. Nach 72 h wurden die Zellen mit 500 ng/ml Calcein AM (Thermo Fisher) für 1 h gefärbt und durch Leica Sp8 invertierte konfokale Mikroskopie in seriellen Schnitten von 20 &mgr;m sichtbar gemacht. Die Fluoreszenzintensität jedes Schnitts wurde mit ImageJ v. 1.52p (Schindelin et al., 2012 ) und Anteil der eindringenden Zellen, geschätzt durch Vergleich der Gesamtintensität über 40 µm mit der Gesamtgesamtintensität pro Insert unter Verwendung von GraphPad PRISM Version 8.0.0. Die statistische Analyse wurde am Endpunkt über die Wiederholungen hinweg durchgeführt, wie in den Legenden der Abb. angegeben.

Immunfluoreszenz

Die Immunfluoreszenzfärbung wurde wie zuvor beschrieben durchgeführt (Francavilla et al., 2016). Um HA-FGFR2b oder endogenen FGFR2 nachzuweisen, inkubierten wir Zellen mit 10 μg/ml Anti-HA (Covance) oder Anti-FGFR2-Antikörper (Cell Signalling) für 45 Minuten unter leichter Bewegung. Die Bindung des Antikörpers aktivierte weder die Rezeptorsignalisierung in unbehandelten Zellen noch induzierte sie die Rezeptorinternalisierung (siehe Kontrollzellen in Abb. 1), wie zuvor berichtet (Francavilla et al., 2009). Nach der Stimulation wurden die Zellen bei 37 °C für verschiedene Zeitpunkte inkubiert. Wenn angezeigt, wurde jeder Inhibitor vor der Stimulation zugegeben. Zu jedem Zeitpunkt wurden nicht-permeabilisierte Zellen entweder fixiert, um den Rezeptor auf der Zelloberfläche (Plasmamembran) sichtbar zu machen, oder in eiskaltem Puffer (50 mM Glycin, pH 2,5) mit Säure gewaschen, um oberflächengebundene Antikörper zu entfernen. Mit Säure gewaschene Zellen wurden dann fixiert und permeabilisiert, um den internalisierten Rezeptor (Zytoplasma) sichtbar zu machen. Schließlich wurden zum Nachweis von FGFR2b Zellen mit AlexaFluor488-konjugiertem Esel-Anti-Maus oder Anti-Kaninchen (Jackson ImmunoResearch Laboratories) gefärbt. Kerne wurden mit DAPI gefärbt. Deckgläser wurden dann in Eindeckmedium (Vectashield Vector Laboratories) montiert.

Für Co-Lokalisierungsexperimente wurden die Zellen mit Säure gewaschen, fixiert, mit 0,02% Saponin (Sigma) permeabilisiert, mit einem primären Antikörper gegen FGFR2, EGFR, TTP, RCP, phosphoryliertem T693 EGFR, EEA1 60 min bei 37 °C behandelt und gefärbt mit AlexaFluor488 (oder 568 oder 647)-konjugiertem Esel-Anti-Maus oder Anti-Kaninchen. Proben, die entweder GFP-markierte Proteine ​​exprimierten oder mit TRITC-Transferrin oder Alexa 647-Transferrin (um den Transferrin-Rezeptor, Tf-R zu färben) behandelt wurden und dem Medium in einer Endkonzentration von 50 µg/ml zugesetzt wurden, wurden im Dunkeln aufbewahrt. Kerne wurden mit DAPI gefärbt. Deckgläser wurden dann in Eindeckmedium (Vectashield Vector Laboratories) montiert.

Alle Bilder wurden bei Raumtemperatur auf einem invertierten konfokalen Leica TCS SP8 AOBS unter Verwendung eines 100-fachen Ölimmersionsobjektivs und eines 2,5-fachen konfokalen Zooms aufgenommen. Die konfokalen Einstellungen waren wie folgt: Pinhole, 1 luftige Einheit, Format, 1.024 × 1.024. Bilder wurden unter Verwendung der folgenden Detektionsspiegeleinstellungen gesammelt: FITC 494-530nm Texasrot 602-665nm Cy5 640-690nm. Die Bilder wurden nacheinander gesammelt. Rohbilder wurden als .lsm-Dateien exportiert und die Anpassungen in Bildkontrast und Helligkeit wurden für alle Bilder in einem gegebenen Experiment mit der frei verfügbaren Software ImageJ v. 1.52p (Schindelin et al., 2012 ).

Quantifizierung des Recycling-Assays

Die Quantifizierung des Recyclings wurde wie beschrieben durchgeführt (Francavilla et al., 2016). Für jeden Zeitpunkt und jede Behandlung wurden das Vorhandensein (gesamt) und die Lokalisation (Zelloberfläche versus internalisiert) von HA-FGFR2 oder endogenem FGFR2 in mindestens sieben zufällig ausgewählten Feldern bewertet. Ungefähr 100 Zellen pro Bedingung (sowohl säuregewaschen als auch nicht) wurden aus drei unabhängigen Experimenten analysiert. Die Ergebnisse sind als Prozentsatz der Rezeptor-positiven Zellen (grün) gegenüber den Gesamtzellen (entsprechend DAPI-gefärbten Kernen) ausgedrückt und beziehen sich auf die zum Zeitpunkt Null erhaltenen Werte. Die statistische Analyse wurde über Wiederholungen hinweg durchgeführt, wie in den Legenden der Fig. angegeben.

Quantifizierung von Expressionsfraktion, Überlappungsfraktion und Co-Lokalisierung

Die Bilder wurden unter Verwendung eines „À trous“-Wavelet-Bandpassfilters vorverarbeitet, um den Beitrag von hochfrequentem gesprenkeltem Rauschen zu den Co-Lokalisationsberechnungen zu reduzieren. Die Pixelintensitäten wurden dann vom ursprünglichen 8-Bit-Bereich [0,255] bis [0,1] normalisiert. Um sicherzustellen, dass die Co-Lokalisierung nur in wohldefinierten Regionen von Interesse (ROI) berechnet wurde, verwendeten wir das Fiji/ImageJ (Schindelin et al., 2012 ) integrierter ROI-Manager zum Erstellen und Aufzeichnen dieser Regionen.

Um schließlich den tatsächlichen Grad der Kolokalisation zwischen zwei Markern (z. B. R und G) zu quantifizieren, verwendeten wir die Manders-Kolokalisationskoeffizienten (MCC) M1 und M2 (Manders et al., 1996). M1 misst den Anteil des R-Markers in Kompartimenten, die auch den G-Marker enthalten, und M2, den Anteil des G-Markers in Kompartimenten, die auch den R-Marker enthalten. Untere Grenzwerte für Pixelintensitäten ichR und ichg wurden automatisch nach der Costes-Methode (Costes et al., 2004 ).

Um die gleichzeitige Überlappung unserer drei roten, dunkelroten und grünen Marker (R, F, G) zu messen, haben wir zuerst das Überlappungsbild zwischen Marker R und Marker F wie oben definiert verwendet (d. h. INS = ichF × IchR). Wir haben dann den MCC-Kolokalisierungsparameter dieses kombinierten Bildes gegen einen grünen Marker unter Verwendung der obigen MCC-Formeln zusammen mit der Costes-Methode gemessen, um den T . zu bestimmenNS und Tg Schwellen.

Die Skripte zur Quantifizierung der Co-Lokalisierung wurden in Python geschrieben und der Code für Costes-adjusted MCC wörtlich aus dem CellProfiler (McQuin et al., 2018) Codebasis.

Anschließend wurde der Student-t-Test verwendet, um die Differenz des Pixelüberlappungsanteils oder des Manders (Kosten)-Koeffizienten zwischen verschiedenen experimentellen Bedingungen in Abb. 1 und Abb. 5 und Anhang Abb. S4 und S6 zu bestimmen.


Hintergrund

Die Alzheimer-Krankheit (AD) ist eine häufige progressive neurodegenerative Erkrankung, die durch einen schweren neuronalen Verlust gekennzeichnet ist, der zu kognitiven Dysfunktionen führt. Gegenwärtig gibt es kein wirksames Medikament oder keine wirksame Behandlung zur Vorbeugung oder Heilung dieser Krankheit [1, 2, 3]. Das wichtigste neuropathologische Merkmal der AD ist die Aggregation und Ablagerung von Amyloid-β (Aβ)-Peptiden, die als einer der Hauptrisikofaktoren und -ursachen für AD gelten [3, 4]. Aggregierte Aβ-Peptide spielen eine entscheidende Rolle bei neuronaler Degeneration, Neuroinflammation und oxidativem Stress [5, 6]. Somit können therapeutische Ansätze zur wirksamen Entfernung von Aβ-Ablagerungen neuroprotektive Vorteile bei AD bieten.

Nach kürzlich veröffentlichten Studien kann AD durch Neuroinflammation sowie Aβ-Peptide verschlimmert werden. Neuroinflammation wird hauptsächlich durch Mikrogliazellen vermittelt, die residente Immunzellen im Zentralnervensystem (ZNS) sind [6, 7]. Unter physiologischen Bedingungen sind Mikrogliazellen an verschiedenen Funktionen beteiligt, einschließlich der Regulierung der Gehirnentwicklung, der Aufrechterhaltung der Homöostase und der Beseitigung alter Synapsen oder anderer Trümmer wie Aβ-Peptide. Bei AD ist bekannt, dass Mikroglia chronisch aktiviert sind, was zu einer Beeinträchtigung der Aβ-Clearance, einer Überexpression von proinflammatorischen Signalen und folglich einer Neurotoxizität führt [8, 9]. Daher kann die Regulierung der Mikroglia-Aktivierung eine wichtige therapeutische Strategie der AD sein, indem eine übermäßige proinflammatorische Immunchemotaxis gesenkt und die neuroprotektive Funktion verbessert wird, was zur Modulation der Neuroinflammation führt [10, 11].

Die Aktivierung von Mikroglia spielt eine wichtige Rolle in mehreren bekannten proinflammatorischen Signalkaskaden [12], einschließlich derer, die durch Mitogen-aktivierte Proteinkinase (MAPK) vermittelt werden. Die MAPK-Familie ist eine Familie von Serin/Threonin-Proteinkinasen, die Zelleigenschaften als Reaktion auf extrazelluläre Stimuli wie Wachstumsfaktoren und inflammatorische Zytokine regulieren [13]. P38-MAPKs, eine der drei MAPKs in Säugerzellen, werden hauptsächlich durch entzündliche Zytokine und Umweltstress aktiviert [14]. P38-MAPKs haben vier Isoformen α, β, γ und δ, die in zwei Untergruppen unterteilt werden können, eine ist p38α und p38β und die andere ist p38γ und p38δ [15]. Unter diesen werden p38α- und p38β-MAPKs im Gehirn von erwachsenen Mäusen stark exprimiert [16]. SB203580, ein traditioneller p38α/β-MAPK-Inhibitor, hatte im LPS-induzierten Depressionsmodell und im AD-Mausmodell therapeutische Wirkungen gezeigt [17, 18]. Kürzlich zeigten zwei selektive p38α-MAPK-Inhibitoren, Neflamapimod (VX-745) und MW150, auch therapeutische Wirkungen bei alten Ratten bzw. bei AD-Mausmodellen [19, 20]. Die klinischen Phase-2a-Studien mit Neflamapimod zeigten Verbesserungen des episodischen Gedächtnisses bei frühen AD-Patienten [21, 22]. Diese Ergebnisse legen nahe, dass p38α/β-MAPKs potenziell wichtige Ziele in AD-Therapeutika sind und daher ihre Inhibitoren vielversprechende Medikamente sein könnten.

In unserer vorherigen Studie konnte ein neuartiger, selektiver p38α/β-MAPK-Inhibitor, NJK14047, erfolgreich die Mikroglia-vermittelte Neuroinflammation lindern [23]. Es reduzierte durch Lipopolysaccharid (LPS) vermittelte Entzündungsreaktionen in den BV2-Zellen und im Mausmodell. Basierend auf diesem Befund wollten wir das Potenzial von NJK14047 als Therapeutikum für AD untersuchen. In dieser Studie verwendeten wir fünf transgene Mäuse mit familiärer Alzheimer-Krankheit (5XFAD), die häufig als AD-Mausmodelle verwendet wurden. 5XFAD-Mäuse überexprimieren menschliches Amyloid-Vorläuferprotein (hAPP) mit drei FAD-Mutationen [Schwedisch (K670N, M671L) Florida (I716V) und London (V717I)] und menschliches Presenilin 1 (PS1) mit zwei FAD-Mutationen (M146L und L286V) unter der Kontrolle des neuronenspezifischen Thy1 Promotor [24]. Hier wurde vorgeschlagen, dass die Verabreichung von NJK14047 an das 5XFAD-Mausmodell Gedächtnisverlust, Aβ-Ablagerung, Neuroinflammation und neuronale Degeneration über die selektive Hemmung von p38α/β-MAPKs verbessert.


ERGEBNISSE

Komplement aktiviert p38 in GEC. Wir und andere haben zuvor berichtet, dass das Komplement C5b-9 Kinasen wie Proteinkinase C, ERK (3) und JNK (31) in GEC aktiviert. In der aktuellen Studie haben wir untersucht, ob Komplement eine andere MAPK, p38, aktiviert. Wenn Antikörper-sensibilisierte GEC NS ausgesetzt wurden, um das Komplement C5b-9 zu bilden, erhöhte sich die p38-Phosphorylierung um das 2,2 ± 0,5-fache im Vergleich zur Kontrolle (Zellen, die HIS ausgesetzt waren) [keine Behandlung 0,7 ± 0,1, HIS 1,0, NS 2,2 ± 0,5 (P < 0,01 vs. HIS), Anisomycin 4,6 ± 1,4 (P < 0,001 vs. HIS), n = 6 Abb. 1EIN]. Die Enzymaktivität von p38, quantifiziert durch Immunkomplex-Kinase-Assay, erhöhte sich auch in Komplement-behandelten Zellen um das 2,4 ± 0,3-fache, was mit der Zunahme der Phosphorylierung korreliert [keine Behandlung 0,4 ± 0,3, HIS 1, NS 2,4 ± 0,3 (P < 0,01 vs. HIS), H2Ö2 4.5 ± 1.1 (P < 0,05 vs. HIS), n = 3–4 Abb. 1B]. Um zu überprüfen, ob der C5b-9-Zusammenbau tatsächlich für die p38-Aktivierung erforderlich war, inkubierten wir Antikörper-behandelte GEC mit C8D, mit oder ohne Rekonstitution mit gereinigtem C8. C8D ohne C8 bildet C5b-7, von dem zuvor gezeigt wurde, dass es in GEC biologisch inaktiv ist (2). Mit C8D inkubiertes GEC zeigte im Vergleich zu HIS keine signifikante p38-Phosphorylierung. Wenn C8D jedoch mit gereinigtem C8 rekonstituiert wurde, war eine Phosphorylierung von p38 offensichtlich, was darauf hindeutet, dass die Bildung von C5b-9 für die Aktivierung von p38 erforderlich ist (Abb. 1 .).C). Densitometrische Analyse zeigte, dass die relative p38-Phosphorylierung HIS: 1,0, C8D: 0,9, C8D + C8: 2,4 betrug (Mittelwert aus 2 Experimenten Abb. 1C).

Abb. 1.Komplement C5b-9 stimuliert p38 in glomerulären Epithelzellen (GEC) in Kultur. EIN: GEC-zytosolische Phospholipase A2 (cPLA2) (GEC, die cPLA . stabil überexprimieren2, siehe Materialien und Methoden ) wurden mit Anti-GEC-Antiserum (5% vol/vol, 22°C, 40 min) und normalem Humanserum (NS 2,5% vol/vol, um C5b-9 aufzubauen, 37°C, 40 .) inkubiert min) oder hitzeinaktiviertes Serum (HIS 2,5% vol/vol, Kontrolle). Als Positivkontrolle wurde Anisomycin (1 µM) verwendet. Oberteil: Immunblot. Unterseite: Densitometrie. *P < 0,01, **P < 0,001 vs. HIS n = 6 für jede Gruppe. B: GEC-cPLA2 wurden stimuliert wie in EIN, und p38 - Aktivität in Zelllysaten wurde wie in Materialien und Methoden bewertet . h2Ö2 (1 mM) wurde als Positivkontrolle verwendet. Oberteil: Immunblot. Unterseite: Densitometrie. +P < 0,01, ++P < 0,05 vs. HIS n = 3–4 für jede Gruppe. C: Antikörper-sensibilisiertes GEC-cPLA2 wurden mit HIS (2,5% vol/vol), humanem C8-defizientem Serum (C8DS 2,5% vol/vol) oder C8DS ergänzt mit rekombinantem humanem C8 (80 µg/ml in unverdünntem Serum) 40 min bei 37°C inkubiert. h2Ö2 (1 mM) wurde als Positivkontrolle verwendet. Oberteil: Immunblot. Unterseite: Densitometrie (Mittelwert aus 2 Experimenten).

Um zu beurteilen, ob eine Komplement-vermittelte p38-Aktivierung in vivo auftritt, untersuchten wir als nächstes die p38-Aktivierung in Glomeruli von Ratten mit PHN. PHN wurde durch eine einzelne Injektion von Anti-Fx1A-Antiserum (Materialien und Methoden) induziert und Glomeruli wurden 14 Tage später isoliert, als Ratten eine signifikante Proteinurie entwickelten (∼160 mg/Tag, Kontrollratte: <10 mg/Tag). p38 wurde in Glomeruli von Ratten mit PHN ungefähr sechsfach aktiviert, verglichen mit der Kontrolle (Kontrolle 13 ± 1, PHN 80 ± 22, P < 0,05, n = 3 und 6 Abb. 2EIN). Die Phosphorylierung von p38 war auch bei PHN höher (2,9 ± 0,2-fach) im Vergleich zur Kontrolle (Kontrolle 1 ± 0,1, PHN 2,9 ± 0,2, P < 0,01, n = 3 und 6 Abb. 2B). Diese Ergebnisse zeigen, dass p38 durch Komplement in GEC in vitro und in vivo aktiviert wird.

Abb. 2.p38 wird in Glomeruli von Ratten mit passiver Heymann-Nephritis (PHN) aktiviert. EIN: PHN wurde durch intravenöse Injektion von Schaf-Anti-Fx1A-Antiserum induziert. Auf Tag 14wurden Ratten getötet und Glomeruli durch Differentialsiebung hergestellt. Glomeruläre Lysate wurden auf p38-Aktivität analysiert (EIN) oder p38-Phosphorylierung (B) wie in Abb. 1. Oberteil: Immunblot. Unterseite: Densitometrie. *P < 0,05, **P < 0,01 vs. Kontrolle n = 3–6 Ratten für jede Gruppe.

Arachidonsäure trägt zur Komplement-induzierten p38-Aktivierung bei. Als nächstes befassten wir uns mit den Mechanismen der Komplement-induzierten p38-Aktivierung. Es wurde zuvor berichtet, dass Komplement cPLA . aktiviert2 in einem [Ca 2 + ]ich- und Proteinkinase C-abhängig, was zu einer Freisetzung von Arachidonsäure aus dem Membranphospholipidpool (16) führt. Wir berichteten auch, dass die komplementinduzierte JNK-Aktivierung zumindest teilweise durch die Freisetzung von Arachidonsäure vermittelt wurde (17). Wir untersuchten zunächst, ob die Freisetzung von Arachidonsäure zur Komplement-induzierten p38-Aktivierung beiträgt. GEC-cPLA2 wurden mit Antikörper und Komplement stimuliert, und die p38-Aktivierung wurde mit Kontroll-GEC verglichen, die nur mit Vektor (GEC-Neo) transfiziert waren. p38 wurde in GEC-Neo durch das Komplement 1,4 ± 0,1-mal aktiviert, während die Stimulation in GEC-cPLA . 2,0 ± 0,1-mal betrug2 (n = 3, P < 0,02), was darauf hindeutet, dass die Freisetzung von Arachidonsäure zumindest teilweise zur Komplement-induzierten p38-Aktivierung beiträgt (Abb. 3 .).EIN). Wenn GEC-Neo mit exogener Arachidonsäure (30 μM) stimuliert wurde, wurde p38 eindeutig aktiviert (2,8 ± 0,6-fache der Kontrolle, P < 0,05, n = 5), was die Rolle von Arachidonsäure bei der p38-Aktivierung unterstützt (Abb. 3B).

Abb. 3.Arachidonsäure (AA) trägt zur Komplement-induzierten p38-Aktivierung bei. EIN: GEC-Neo (vektortransfizierte Zellen) und GEC-cPLA2 (GEC, die cPLA . stabil überexprimieren2) wurden mit Komplement für 40 min stimuliert und die p38-Phosphorylierung wurde durch Immunblotting untersucht. Oberteil: Immunblot. Unterseite: Densitometrie. *P < 0,05 vs. GEC-Neo n = je 3. B: GEC-Neo wurde mit AA (30 μM) oder Vehikel [Ethanol, Kontrolle (cntl)] für 20 min stimuliert, und die Phosphorylierung von p38 wurde durch Immunblotting untersucht. Oberteil: Immunblot. Unterseite: Densitometrie. **P < 0,05 vs. Kontrolle n = 5 pro Stück.

Nicht stimulierte kultivierte Ratten-GEC exprimieren COX-1, wohingegen die COX-2-Expression durch Komplement induziert wird. Durch cPLA . freigesetzte Arachidonsäure2 wird durch COX-1 und -2 weiter in biologisch aktive Eicosanoide wie PGE . umgewandelt2, PGF2α, und TXA2 (29). Diese Eicosanoide wirken autokrin über entsprechende spezifische Zelloberflächenrezeptoren und sind dafür bekannt, p38 in einigen Systemen zu aktivieren. Um zu untersuchen, ob Eicosanoide zur Komplement-induzierten p38-Aktivierung beitragen, haben wir GEC mit PGE . stimuliert2, PGF2α, und U-46619 (stabiles Analogon von TXA2). Im Einzeltest konnten diese drei Eicosanoide p38 nicht konsistent aktivieren. Nur wenn drei Eicosanoide gleichzeitig getestet wurden, gab es einen bescheidenen Anstieg der p38-Phosphorylierung (∼20%, nicht gezeigt). Darüber hinaus konnte ein nichtselektiver COX-Inhibitor, Indomethacin, die Komplement-induzierte p38-Aktivierung nicht hemmen (nicht gezeigt). Zusammengenommen zeigen diese Ergebnisse, dass Arachidonsäure zur Komplement-induzierten p38-Aktivierung beiträgt, jedoch nicht durch Umwandlung in COX-Metaboliten. Stattdessen werden Arachidonsäure selbst und/oder andere durch Arachidonsäure stimulierte Mediatoren wie reaktive Sauerstoffspezies (ROS) (siehe Rolle von ROS bei der Aktivierung von p38 durch Komplement), kann für die p38-Aktivierung verantwortlich sein.

Rolle von ROS bei der Aktivierung von p38 durch Komplement. Wir haben zuvor gezeigt, dass Komplement die ROS-Erzeugung in GEC auf eine NADPH-Oxidase-abhängige Weise stimuliert, was zur JNK-Aktivierung beiträgt (17). Wir zeigten auch, dass Arachidonsäure die ROS-Erzeugung in GEC stimuliert (17). Um zu testen, ob ROS zur Komplement-vermittelten p38-Aktivierung beitragen, untersuchten wir die Komplement-vermittelte p38-Aktivierung in GEC, die mit Antioxidantien, GSH und NAC behandelt wurden. Wie in 4 gezeigt, beseitigten GSH (10 mM) und NAC (10 mM) die komplementinduzierte p38-Phosphorylierung vollständig [Kontrolle 3,7 ± 0,3-fach von HIS, GSH 0,9 ± 0,03-fach von HIS (P < 0,01 vs. Kontrolle), NAC 1,0 ± 0,07-fach von HIS (P < 0,01 vs. Kontrolle), n = 3]. Somit sind ROS wahrscheinlich für die Komplement-induzierte p38-Aktivierung verantwortlich. Ein Mechanismus der ROS-Erzeugung könnte die von cPLA . freigesetzte Arachidonsäure sein2 (17).

Abb. 4.Komplement-vermittelte p38-Aktivierung ist abhängig von reaktiven Sauerstoffspezies. GEC-cPLA2 wurden mit Antikörper und Komplement (NS) stimuliert. Zellen wurden mit Glutathion (GSH 10 mM) vorinkubiert oder n-Acetylcystein (NAC 10 mM) für 30 Minuten vor der Stimulation. Die p38-Aktivierung wurde durch Immunblotting auf Phospho-p38 bewertet. Oberteil: Immunblot. Unterseite: Densitometrie. *P < 0,01 vs. Kontrolle n = je 3.

Einfluss der p38-Aktivierung auf die GEC-Funktion. Als nächstes untersuchten wir den Einfluss der p38-Aktivierung auf die Komplement-vermittelte GEC-Schädigung. Wir stellten zunächst die Hypothese auf, dass die p38-Aktivierung zur Komplement-vermittelten Zellschädigung beiträgt. Als GEC jedoch mit p38-Inhibitoren (PD-169316 und FR-167653, jeweils 10 μM) vorbehandelt wurden, war zu unserer Überraschung die durch die spezifische BCECF-Freisetzung quantifizierte Komplement-induzierte Zytotoxizität (siehe Materialien und Methoden ) signifikant erhöht im Vergleich zu Vehikel- behandelte Zellen [Abb. 5EIN: DMSO: NS 2,5 13 ± 3%, NS 2,75 24 ± 5%, NS 3 38 ± 5%, PD-169316: NS 2,5 20 ± 3% (P < 0,05 vs. DMSO), NS 2,75 29 ± 4 % (P < 0,05 vs. DMSO), NS 3 46 ± 4 % (P < 0,05 vs. DMSO), n = 3–4 Abb. 5B: DMSO: NS 2,5 18 ± 5%, NS 2,75 36 ± 7%, NS 3 49 ± 9%, FR-167653: NS 2,5 26 ± 7% (P < 0,05 vs. DMSO), NS 2,75 45 ± 7%, NS 3 58 ± 8% (P < 0,05 vs. DMSO), n = 3–4]. Die verwendete Konzentration von FR-167653 (10 &mgr;M) hemmte die Komplement-induzierte p38-Aktivität um 90% in GEC (Daten nicht gezeigt). Ähnliche Ergebnisse wurden erhalten, wenn die LDH-Freisetzung zur Quantifizierung der Zytotoxizität verwendet wurde [DMSO: NS 5 25 ± 9%, NS 7,5 36 ± 10%, FR-167653: NS 5 29 ± 11%, NS 7,5 52 ± 10% (P < 0,05 vs. DMSO), n = 6]. Diese Ergebnisse legen nahe, dass die p38-Aktivierung Zellen vor Komplement-vermittelter Schädigung schützen kann.

Abb. 5.p38-Inhibitoren verstärken die Komplement-induzierte GEC-Schädigung. GEC wurden mit p38-Inhibitoren PD-169316 (EIN10 μM) oder FR-167653 (B 10 μM) für 30 min bei 37 °C vor der Stimulation mit Antikörper und Komplement. Vehikel (DMSO) wurde als Kontrolle verwendet. In Inkubationen mit Anti-GEC-Antiserum und HIS/NS wurden auch Inhibitoren eingeschlossen. Nach 40-minütiger Inkubation mit HIS/NS wurde die Zytotoxizität durch 2',7'-Bis(carboxyethyl)-5(6)-carboxyfluorescein (BCECF)-Freisetzungsassay wie in Materialien und Methoden quantifiziert. Zahlen neben NS zeigen die Konzentration des verwendeten NS (Vol/Vol) an. *P < 0,05 vs. Fahrzeug n = 3–4 für jede Gruppe.

Wir und andere haben zuvor berichtet, dass das Komplement C5b-9 Aktin-Mikrofilamente in kultivierten GEC zerstört (30, 33). Ein möglicher Mechanismus für die p38-vermittelte Zytoprotektion könnte die Modulation des Aktinzytoskeletts sein. Daher untersuchten wir als nächstes den Einfluss von FR-167653 auf die Komplement-induzierte Aktin-Depolymerisation. Wenn GEC-cPLA2 wurden mit Antikörper und Komplement für 3 h inkubiert, der F-Aktin-Gehalt nahm um 9 ± 3% ab. FR-167653 (10 μM) steigerte die Reduktion signifikant auf 18 ± 4 % (P < 0,05, n = 5 pro Stück). Somit verhindert die p38-Aktivierung zumindest teilweise die Komplement-induzierte Aktin-Depolymerisation.

Um diese Ergebnisse weiter zu validieren, erzeugten wir als nächstes Subklone von GEC, die induzierbar eine konstitutiv aktive Mutante von TAK1 exprimieren, eine Kinase stromaufwärts von p38 (Materialien und Methoden). Wenn ein solcher Klon (Abb. 6EIN, #1) wurde mit einem Insektenhormon, Ponasteron A, stimuliert, die Expression von TAK1 wurde nach 2 h induziert und erreichte nach 6 h den Höhepunkt. Eine Phosphorylierung von p38 wurde ebenfalls beobachtet und erreichte nach 6 h ihren Höhepunkt (Abb. 6 .).EIN). Ponasteron A hat keine bekannten Auswirkungen auf Säugerzellen. Wenn dieser induzierbare Klon 6 h lang mit Ponasteron A stimuliert und Antikörpern und steigenden Komplementkonzentrationen (NS) ausgesetzt wurde, wurde die komplementvermittelte Zytotoxizität im Vergleich zu Kontrollen (inkubiert mit Ethanol anstelle von Ponasteron A) abgeschwächt. Umgekehrt, wenn Zellen mit dem p38-Inhibitor FR-167653 (10 μM, ohne Stimulation mit Ponasteron A) vorinkubiert wurden, wurde die Zytotoxizität im Vergleich zur Kontrolle erhöht, in Übereinstimmung mit den vorherigen Ergebnissen (Abb. 6 .).B). Von Interesse, wenn Zellen mit Ponasteron A in Gegenwart von FR-167653 stimuliert wurden, wurde die Wirkung von Ponasteron A (TAK1-Induktion) neutralisiert, aber die Zytotoxizität erreichte nicht das Niveau der FR-167653-Behandlung allein [Kontrolle 47 ± 1%, Ponasteron A 33 ± 3% (P < 0,02 vs. Kontrolle), Ponasteron A plus FR-167653 43 ± 3%, FR-167653 allein 57 ± 2% (P < 0,05 vs. Kontrolle) Abb. 6C]. Diese Ergebnisse zeigen, dass die zytoprotektive Wirkung der TAK1-Induktion zumindest teilweise durch die p38-Aktivierung vermittelt wird. Es könnte jedoch stromabwärts von TAK1 zusätzliche Wege geben, die zur Zytoprotektion beitragen.

Abb. 6.Die Induktion der konstitutiv aktiven transformierenden Wachstumsfaktor-β-aktivierten Kinase 1 (TAK1) verbessert die Komplement-induzierte GEC-Schädigung. Ein Subklon von GEC, der TAK1 (konstitutiv aktive Mutante) induzierbar überexprimiert, wurde wie in Materialien und Methoden etabliert. EIN: Zeitverlauf der TAK1-Induktion. GEC wurden mit Ponasteron A (Pona 4 &mgr;M) für die angegebenen Zeiten inkubiert und Zelllysate wurden auf Expression von TAK1 und Phosphorylierung von p38 durch Immunblotting unter Verwendung von Antikörpern für HA (TAK1) bzw. Phospho-p38 analysiert. In Klon #1, die Induktion von TAK1 erreichte nach 6 h ihren Höhepunkt, als auch eine Phosphorylierung von p38 beobachtet wurde. In Klon #3, war die Induktion von TAK1 schwach und eine Phosphorylierung von p38 wurde nicht nachgewiesen. B: Klon #1 wurde mit Vehikel (Kontrolle), Ponasteron A (4 μM) oder FR-167653 (10 μM) für 6 h inkubiert und mit Anti-GEC-Antiserum und NS (oder HIS) stimuliert. Die komplementvermittelte Zytotoxizität wurde wie in Materialien und Verfahren unter Verwendung von BCECF-Freisetzung in das Medium quantifiziert. *P < 0,05, **P = 0.07, ***P = 0,06 vs. Kontrolle n = je 3. C: Klon #1 wurde mit Vehikel (Kontrolle), Ponasteron A (4 μM), Ponasteron A (4 μM) + FR-167653 (10 μM) oder FR-167653 (10 μM) für 6 h inkubiert und mit Anti-GEC-Antiserum und NS . stimuliert (oder HIS 3,5% vol/vol). Die Zytotoxizität wurde wie in Materialien und Methoden quantifiziert. +P < 0,02, ++P < 0,05 vs. Kontrolle n = je 3. (B und C: unabhängige Experimente.)

Die Hemmung der p38-Aktivierung verstärkt die Proteinurie bei PHN. Die obigen Ergebnisse legen nahe, dass die p38-Aktivierung für GEC gegen Komplement-vermittelte Zellschädigung in vitro zytoprotektiv ist. Als nächstes untersuchten wir, ob die p38-Aktivierung in vivo unter Verwendung des PHN-Rattenmodells der membranösen Nephropathie auch zytoprotektiv ist. Bei PHN ist bekannt, dass das Komplement C5b-9 GEC-Schäden verursacht, die zu Proteinurie führen (21, 32). Wie in 2 gezeigt, wurde p38 in Glomeruli von Ratten mit PHN im Vergleich zu Kontrollratten signifikant aktiviert. Wir erwarteten, dass, wenn p38 für GEC zytoprotektiv ist, die Hemmung von p38 zu einer erhöhten Proteinurie bei PHN führen würde. Daher untersuchten wir den Einfluss eines spezifischen p38-Inhibitors, FR-167653, auf Proteinurie. Um die Wirkung von FR-167653 zu bestätigen, wurden Ratten zunächst mit FR-167653 von . behandelt Tag 7 zu 14 ( Materialien und Methoden ) und p38-Aktivität in Glomeruli wurde untersucht an Tag 14. Bei mit FR-167653 behandelten Ratten wurde die p38-Aktivität in Glomeruli deutlich auf ein Niveau gehemmt, das mit dem von Kontrollratten vergleichbar war [Kontrolle 13 ± 1, PHN 80 ± 22 (P < 0,05 vs. Kontrolle), PHN-FR-167653 12 ± 5 (nicht signifikant von der Kontrolle), n = 3–6 Abb. 7EIN]. Die Phosphorylierung von p38 wurde durch diesen Inhibitor in Übereinstimmung mit einem früheren Bericht (27) nicht konsistent beeinflusst (Abb. 7 .).EIN). Bei Ratten, die mit Vehikel behandelt wurden, wurde die Proteinausscheidung im Urin auf Tag 14 betrug 161 ± 33 mg/Tag (n = 7), signifikant höher als bei normalen Ratten (∼10 mg/Tag). In Übereinstimmung mit der zytoprotektiven In-vitro-Wirkung der p38-Aktivierung zeigten mit FR-167653 behandelte Ratten eine erhöhte Proteinurie (288 ± 54 mg/Tag, P < 0,05 vs. Fahrzeug, n = 9 Abb. 7B). Um zu überprüfen, ob die Komplementaktivierung durch FR-167653 beeinflusst wurde, quantifizierten wir die C3-Ablagerung in Glomeruli (siehe Materialien und Methoden). Die glomeruläre C3-Ablagerung betrug 91 ± 4 bei Ratten mit PHN und 93 ± 3 bei Ratten mit PHN, die mit FR-167653 behandelt wurden. Somit beeinflusste FR-167653 die Komplementaktivierung in Glomeruli nicht. Diese Ergebnisse unterstützen eine zytoprotektive Rolle von p38 bei der Komplement-vermittelten GEC-Schädigung in vivo.

Abb. 7.p38-Inhibitor, FR-167653, verstärkt die Proteinurie bei PHN. PHN wurde durch eine einzelne Injektion von Anti-Fx1A-Antiserum induziert, und Ratten wurden mit Vehikel oder FR-167653 wie in Materialien und Verfahren behandelt. EIN: An Tag 14glomeruläre p38 - Aktivität wurde wie in Materialien und Methoden gemessen . Oberteil: Immunblot. Unterseite: densitometrische Analyse. *P < 0,05 vs. Kontrolle n = 3–6 Ratten in jeder Gruppe. Daten aus der densitometrischen Analyse für Kontrolle und PHN werden mit Abb. 2 geteilt. B: An Tag 14, wurde 24-h-Urin in Stoffwechselkäfigen gesammelt und das Urinprotein quantifiziert. **P < 0,05 vs. Fahrzeug n = 7 (Fahrzeug), 9 (FR-167653).

Die Überexpression von HSP27 schützt GEC vor Verletzungen. Die obigen Ergebnisse zeigen zytoprotektive Wirkungen des p38-MAPK-Wegs in GEC. HSP27 ist eines der Moleküle stromabwärts von p38 MAPK. Es ist bekannt, dass, wenn der p38-MAPK-Weg aktiviert wird, MAPKAPK-2 phosphoryliert/aktiviert wird und seinerseits HSP27 phosphoryliert (5). Es wurde zuvor berichtet, dass im Ratten-Puromycin-Aminonukleosid (PAN)-Nephrose-Modell die glomeruläre Expression und Phosphorylierung von HSP27 erhöht waren (24). Darüber hinaus bot die Überexpression von HSP27 in Maus-Podozyten Schutz gegen PAN (25). Wir zeigten auch, dass die glomeruläre Expression von HSP27 bei Ratten mit PHN im Vergleich zu Kontrollratten um das 1,6-fache erhöht ist, ähnlich der Zunahme, die bei PAN-Nephrose beobachtet wurde (24) (Abb. 8 .).EIN). Bei Behandlung mit FR-167653 zeigte die glomeruläre Expression von HSP27 einen Aufwärtstrend, obwohl der Unterschied statistisch nicht signifikant war [Kontrolle 52 ± 2, PHN 84 ± 10 (P < 0,01 vs. Kontrolle), FR-167653 117 ± 11 (P < 0,01 vs. Kontrolle), n = 5–8 Ratten Abb. 8EIN]. Wir untersuchten auch die Phosphorylierung von HSP27 unter Verwendung von Phospho-HSP27-spezifischen Antikörpern. Die Phosphorylierung von HSP27 in Glomeruli war bei PHN signifikant erhöht (Abb. 8B). Im Gegensatz zur Proteinexpression wurde die Phosphorylierung von HSP27 durch FR-167653 deutlich gehemmt [Kontrolle 15 ± 2, PHN 64 ± 11 (P < 0,01 vs. Kontrolle), FR-167653 34 ± 11, n = je 6 Ratten Abb. 8B]. Diese Ergebnisse legen nahe, dass die glomeruläre Phosphorylierung von HSP27 in PHN zumindest teilweise durch p38 MAPK vermittelt wird.

Abb. 8.Die glomeruläre Expression des Hitzeschockproteins (HSP27) ist bei Ratten mit PHN erhöht. PHN wurde durch eine einzelne Injektion von Anti-Fx1A-Antiserum induziert und Ratten wurden mit Vehikel oder FR-167653 wie in Materialien und Verfahren behandelt. Auf Tag 14wurden glomeruläre Lysate hergestellt und durch Immunoblotting auf HSP27 analysiert (EIN) und Phospho-HSP27 (B). Oberteil: Immunblot. Unterseite: densitometrische Analyse. *P < 0,01 vs. Kontrolle n = jeweils 5–8 Ratten.

Daher untersuchten wir als nächstes, ob die zytoprotektive Wirkung des p38-MAPK-Wegs über MAPKAPK-2 und HSP27 in Ratten-GEC in Kultur vermittelt wird. Um diese Hypothese zu testen, haben wir zuerst untersucht, ob MAPKAPK-2 durch Komplement in GEC phosphoryliert wird. Wenn GEC Antikörper und Komplement ausgesetzt wurden, wurde eine Phosphorylierung von p38 für 20–60 min beobachtet (Abb. 9 .).EIN). Phosphorylierung von MAPKAPK-2 wurde in einem ähnlichen Zeitverlauf beobachtet (Abb. 9EIN). Als nächstes untersuchten wir den Einfluss der Überexpression von HSP27 auf die Komplement-vermittelte GEC-Schädigung. Das für Wildtyp HSP27 kodierende Plasmid wurde stabil in GEC transfiziert und seine Expression wurde durch Immunblotting verifiziert. Zwei Subklone (HSP27WT1 und 2), die das Wildtyp-HSP27 überexprimierten, wurden für weitere Untersuchungen ausgewählt (Abb. 9).B). Steuerung 1 ist ein Subklon von GEC, der nur mit Vektor transfiziert wurde und Steuerung 2 wurde mit dem Wildtyp HSP27 transfiziert, aber das Expressionsniveau war minimal. Es sollte beachtet werden, dass Kontrollzellen auch HSP27 exprimierten, wenn der Film länger belichtet wurde (Abb. 9 .).B). Bei Simulation von HSP27WT1 und 2 mit Antikörper und Komplement war die spezifische LDH-Freisetzung im Vergleich zu den beiden Kontrollzellen deutlich abgeschwächt [NS 2,5: Steuerung 1 30 ± 4%, Steuerung 2 24 ± 3%, HSP27WT1 6 ± 1% (P < 0,001 vs. beide Kontrollen), HSP27WT2 7 ± 1 % (P < 0,001 vs. beide Kontrollen), NS 5: Steuerung 1 56 ± 8%, Steuerung 2 48 ± 5%, HSP27WT1 10 ± 1% (P < 0,001 gegenüber beiden Kontrollen), HSP27WT2 16 ± 1 % (P < 0,001 vs. beide Kontrollen), NS 10: Steuerung 1 73 ± 6%, Steuerung 2 66 ± 2%, HSP27WT1 25 ± 1% (P < 0,001 gegenüber beiden Kontrollen), HSP27WT2 30 ± 1% (P < 0,001 gegenüber beiden Kontrollen), n = 6–12 Abb. 9C]. Um zu untersuchen, ob die Phosphorylierung von HSP27 bei der Zytoprotektion wichtig ist, etablierten wir als nächstes Subklone von GEC, die eine nicht phosphorylierbare Mutante von HSP27 überexprimieren. In dieser Mutante sind zwei Ser-Reste, von denen bekannt ist, dass sie durch MAPKAPK-2 phosphoryliert werden, zu Ala mutiert (10). Für weitere Studien wurden zwei Subklone (HSP27mut1 und 2) ausgewählt (Abb. 9 .).B). Steuerung 3 ein Subklon von GEC ist, der nur mit Vektor transfiziert wurde, und Steuerung 4 wurde mit HSP27mut transfiziert, aber das Expressionsniveau war minimal. Wenn HSP27mut1 und 2 mit Komplement stimuliert wurden, war die spezifische LDH-Freisetzung im Vergleich zu Kontrollzellen leicht abgeschwächt, aber die Abschwächung war viel geringer als bei Zellen, die das Wildtyp-HSP27 überexprimierten [NS 2,5: Steuerung 3 25 ± 4%, Steuerung 4 29 ± 2%, HSP27mut1 19 ± 2%, HSP27mut2 31 ± 5%, NS 5: Steuerung 3 60 ± 3%, Steuerung 4 48 ± 2%, HSP27mut1 41 ± 2% (P < 0,05 vs. Steuerung 3), HSP27mut2 48 ± 2%, NS 10: Steuerung 3 66 ± 2%, Steuerung 4 62 ± 1%, HSP27mut1 53 ± 1% (P < 0,05 gegenüber beiden Kontrollen), HSP27mut2 50 ± 3% (P < 0,05 vs. Steuerung 3), n = 4–12 Abb. 9D]. Diese Ergebnisse zeigen, dass die Überexpression von HSP27 eine Zytoprotektion in GEC induziert und legen nahe, dass die MAPKAPK-2-vermittelte Phosphorylierung von HSP27 bei dieser Zytoprotektion wichtig ist.

Abb. 9.Die Überexpression des Wildtyp-HSP27, jedoch keine nicht phosphorylierbare Mutante, schützt GEC vor Komplement-vermittelter Zellschädigung. EIN: GEC-cPLA2 wurden mit Antikörper und Komplement für die angegebenen Zeiten stimuliert. Zelllysate wurden durch Immunblotting auf Phosphorylierung von MAPKAPK-2 und p38 analysiert. B: Subklone von GEC, die den Wildtyp-Hamster HSP27 (HSP27WT) oder eine nicht phosphorylierbare Mutante (HSP27mut) stabil überexprimieren, wurden wie in Materialien und Methoden etabliert. Die Expression von HSP27 wurde durch Immunblotting verifiziert. Beachten Sie, dass Kontroll-GEC auch HSP27 exprimieren, wenn sie länger ausgesetzt sind. C: GEC-Klone, die HSP27 nicht überexprimieren (Strg 1 und 2) und GEC-Klone, die das Wildtyp-HSP27 (HSP27WT1 und 2) überexprimieren, wurden mit Anti-GEC-Antiserum sensibilisiert und mit steigenden Konzentrationen von NS (oder HIS) für 40 min stimuliert. Die spezifische Laktatdehydrogenase (LDH)-Freisetzung wurde wie in Materialien und Methoden als Marker für komplementvermittelte Zytotoxizität quantifiziert. *P < 0,001 vs. Strg 1 und 2 n = 6–12 pro Gruppe. D: GEC-Klone, die HSP27 nicht überexprimieren (Strg 1 und 2) und GEC-Klone, die eine nicht phosphorylierbare Mutante von HSP27 (HSP27mut1 und 2) überexprimieren, wurden mit Komplement stimuliert und die LDH-Freisetzung quantifiziert. +P < 0,05 vs. Strg 3. ++P < 0,05 vs. Strg 4 n = 4–12 pro Gruppe.


DISKUSSION

Diese Studie klärt die Mechanismen der C5b-9-vermittelten Aktivierung der ERK-Kaskade auf. Die ERK-Aktivierung verlief über Ras und war vom Zytoskelett-Remodelling abhängig. Aktivierte ERK phosphorylierte zwei verschiedene Substrate, und die chronische konstitutive Aktivierung des ERK-Signalwegs verschlimmerte die komplementabhängige Zytotoxizität. In Übereinstimmung mit früheren Ergebnissen zeigen wir, dass C5b-9 in kultivierten GEC die ERK-Threonin 202 /Tyrosin 204-Phosphorylierung induzierte ( 1 ), was mit der Aktivierung korreliert (10). Darüber hinaus zeigen wir, dass ERK in Glomeruli von Ratten mit PHN phosphoryliert wird (d. h. C5b-9-abhängige GEC-Schädigung in vivo), und die Lokalisation von Phospho-ERK stimmt mit GEC überein (Abb. 1 und 2). In früheren Studien haben wir gezeigt, dass die Montage von C5b-9 in der GEC-Plasmamembran (in Kultur und in vivo) die Transaktivierung von Rezeptortyrosinkinasen, einschließlich EGF-R, induzierte (13). Die EGF-R-Transaktivierung führte zur Aktivierung von Phospholipase C-γ1 und PKC sowie zur Bindung des Adapterproteins Grb2, das Rezeptortyrosinkinasen mit Ras verbindet (11, 13). Um die Rolle von Ras und PKC bei der Komplement-vermittelten ERK-Aktivierung zu bestimmen, überwachten wir die ERK-Phosphorylierung in GEC, die stabil mit einer dominant-inhibitorischen Mutante von Ras transfiziert worden waren, und in GEC, denen PKC entzogen wurde. Diese Experimente zeigten, dass der ERK-Weg überwiegend über Ras aktiviert wurde (Abb. 3). Unsere Ergebnisse unterscheiden sich von denen in K562- und COS-7-Zellen, bei denen eine Komplement-induzierte ERK-Aktivierung über PKC auftrat (21).

Das in der vorliegenden Studie verwendete Protokoll führte nicht zu quantitativen Veränderungen von F-Aktin nach Inkubation mit Komplement, aber in einer anderen Studie (44) war eine GEC-Schädigung durch Komplement mit dem Verlust von Aktin-Stressfasern und fokalen Kontakten verbunden. In vivo enthalten GEC F-Aktin als Schicht an der Basis der Fußfortsätze, und das Aktin-Zytoskelett ist wichtig für die Aufrechterhaltung der Zellarchitektur. Zuvor haben wir gezeigt, dass Medikamente, die das Aktin-Zytoskelett zerlegen (Cytochalasin D und Latrunculin B), die komplementvermittelte Aktivierung von EGF-R nicht beeinflussen, aber die Aktivierung der Phospholipase C-γ1 und die nachgeschaltete Signalübertragung, einschließlich der Aktivierung von PKC und cPLA ., hemmen2 (11). Die vorliegende Studie zeigt, dass die komplementinduzierte ERK-Aktivierung durch Cytochalasin D und Latrunculin B gehemmt wurde (Abb. 7, EIN und B). Beide Medikamente hemmten auch die ERK-Aktivierung durch EGF (die über Ras und Raf auftritt) und PKC (die über Raf, aber nicht über Ras auftritt) (Abb. 3 und 7 .).D). Somit ist ein intaktes Aktin-Zytoskelett für die sequentielle Aktivierung von Raf, MEK und ERK erforderlich. Darüber hinaus blockierten Cytochalasin D und Latrunculin B auch die ERK-Phosphorylierung in GEC, die R4F-MEK stabil überexprimieren (Abb. 7 .).F). Dieses Ergebnis impliziert, dass eine effiziente Phosphorylierung von ERK durch MEK von einem intakten Aktin-Zytoskelett abhängt. Die Wirkungen von Cytochalasin D und Latrunculin B auf die ERK-Phosphorylierung waren ähnlich, obwohl Cytochalasin D und Latrunculine die Depolymerisation des Aktin-Zytoskeletts durch unterschiedliche Mechanismen induzieren. Cytochalasin D bindet an das mit Widerhaken versehene (wachsende Ende) von Aktinfilamenten und verhindert die Aktinfilamentbildung oder führt zu einer Unterbrechung des aktiven Umdrehens von Aktin-Stressfasern. Latrunculine sequestrieren G-Aktin-Monomere, verhindern die Aktin-Polymerisation und zerstören effektiv sowohl Aktin-Stressfasern als auch kortikale Aktinfilamente, die resistenter gegen Cytochalasin D sind (23).

Ähnlich wie bei den Aktin-depolymerisierenden Arzneimitteln hemmte die Kondensation und Stabilisierung von Aktinfilamenten an der Zellperipherie nahe der Plasmamembran durch Calyculin A den komplementinduzierten Anstieg der ERK-Phosphorylierung (Abb. 7 .).C). Eine stabile Expression von L 63 RhoA schwächte auch die ERK-Phosphorylierung durch Komplement ab ( 9 ), und dieser Effekt ist mit einer verstärkten Stressfaserbildung verbunden (11). L 63 RhoA kann über einen zu Calyculin A analogen Mechanismus gewirkt haben, da berichtet wurde, dass konstitutiv aktives RhoA die Phosphorylierung von Ezrin-Radixin-Moesin-Proteinen induziert (4). Ähnlich wie bei der RhoA-Aktivierung reduzierte die Hemmung der Rho-assoziierten Kinase (einem nachgeschalteten Effektor von RhoA) die ERK-Aktivierung (Fig. 9).Zusammengenommen legen die Ergebnisse nahe, dass sowohl die Demontage als auch die Stabilisierung des Aktin-Zytoskeletts die ERK-Phosphorylierung reduzieren können, was impliziert, dass die ERK-Aktivierung von der Umgestaltung des Zytoskeletts abhängt. Schließlich hatten die Zytoskelett-verändernden Medikamente unterschiedliche Wirkungen auf die Aktivierung des JNK-Signalwegs in GEC ( 8 ). Somit gibt es große Unterschiede in der Rolle des Zytoskeletts bei der Erleichterung der Aktivierung von Signalwegen durch Komplement, und der pharmakologische Abbau des Aktinfilament-Netzwerks übt keine allgemeine hemmende Wirkung auf alle Signalwege aus.

Unsere Studie, die eine wichtige Rolle des Aktin-Zytoskeletts bei der Komplement-Signalübertragung zeigte, steht im Einklang mit Studien in anderen Systemen. Als Reaktion auf eine Insulinbehandlung blockierte beispielsweise die Zerlegung der Aktinfilamente die Aktivierung von ERK und p38-Kinase, aber nicht die Insulinrezeptor-Autophosphorylierung, Phoshatidylinositol-3-Kinase oder S6-Kinase (42, 45). Darüber hinaus wurde die Bindung von Shc an den Insulinrezeptor nicht beeinflusst, aber die Bindung von Grb2 an Shc wurde unterbrochen (45). Cytochalasin D hatte jedoch keinen Einfluss auf die ERK-Aktivierung durch Lysophosphatidsäure, Bombesin oder den von Blutplättchen stammenden Wachstumsfaktor (39). Darüber hinaus kann das Aktin-Zytoskelett für die Zellzyklusprogression, die Transkription von Serum-induzierbaren Genen und die Induktion der Stickoxid-Synthase wichtig sein (51). Es mag ungewöhnlich erscheinen, dass die Expression von Calyculin A und L 63 RhoA (die die Aktinpolymerisation erleichtern) ähnliche Wirkungen wie Cytochalasin D oder Latrunculin B (die das Zytoskelett depolymerisieren) und die Hemmung der Rho-assoziierten Kinase hervorrufen. Alle diese Behandlungen hemmten die ERK-Aktivierung in der vorliegenden Studie, und parallele Effekte einer zunehmenden Aktin-Polymerisation und -Depolymerisation wurden in anderen Systemen berichtet. Beispielsweise hemmten die F-Aktin-Polymerisation mit dem Wirkstoff Jasplakinolid und die Depolymerisation mit Latrunculin B oder Cytochalasin D beide die insulinstimulierte Glukoseaufnahme in Adipozyten (20), die Lipopolysaccharid-vermittelte Produktion reaktiver Sauerstoffspezies in Monozyten (36), die Akkumulation von Phosphatidylinositol 3 ,4,5-Trisphosphat als Reaktion auf einen chemotaktischen Stimulus in Neutrophilen (48) und Apoptose in Atemwegsepithelzellen (49).

Um die funktionelle Rolle der komplementvermittelten ERK-Aktivierung in GEC zu untersuchen, untersuchten wir Substrate von ERK, die auf eine potenzielle Beteiligung an zellulären Funktionen hinweisen könnten (31). Das Komplement induzierte keine Serin-383-Phosphorylierung des Transkriptionsfaktors Elk-1, einem potentiellen nuklearen Ziel von ERK (Fig. 4). Wie erwartet, induzierte EGF, ein bekannter Aktivator von ERK, tatsächlich die Elk-1-Phosphorylierung. Vielleicht war EGF in der Lage, zusätzliche Faktoren zu aktivieren/rekrutieren, die für ERK erforderlich sind, um nukleäre Transkriptionsfaktoren zu phosphorylieren, während Komplement nicht wirksam war. Jedoch induzierte Komplement die Phosphorylierung von MAPKAPK-2, die teilweise vom ERK-Weg abhängig war (sowie von der p38-Kinase Fig. 6). MAPKAPK-2 ist typischerweise ein Substrat der p38-Kinase, aber in Analogie zu GEC wurde eine ERK-abhängige Aktivierung von MAPKAPK-2 in Neutrophilen berichtet (7). Unter basalen Bedingungen wird angenommen, dass MAPKAPK-2 im Kern lokalisiert ist, während MAPKAPK-2 bei Aktivierung nukleäre Transkriptionsfaktoren phosphorylieren oder in das Zytoplasma exportiert werden kann, wo es andere Substrate, einschließlich Hsp27, aktivieren kann (27). Unser Ergebnis unterstützt eine Rolle für die Komplement-vermittelte ERK-Aktivierung in der Transkription sowie in zytoplasmatischen Signalwegen. Darüber hinaus stimulierte Komplement die Phosphorylierung von cPLA2, ein cytoplasmatisches ERK-Ziel auf Serin 505 ( 5 ), eine gut definierte ERK-Phosphorylierungsstelle (18, 22). Interessanterweise, obwohl cPLA2 ist ein Substrat für ERK in GEC, dem komplementinduzierten Anstieg von cPLA2 Die katalytische Aktivität in diesen Zellen erforderte keine ERK-Aktivierung (10), sondern war von der PKC abhängig. Phosphorylierung der cPLA2 Serin 505-Stelle trägt zur EGF-vermittelten Freisetzung von Arachidonsäure in GEC (10) bei und korreliert mit Agonist-stimuliertem cPLA2 Aktivität in anderen Zellen (22). Weitere Untersuchungen sind erforderlich, um weitere ERK-Substrate aufzuklären.

In früheren Studien haben wir gezeigt, dass die komplementinduzierte Aktivierung von JNK- und p38-Mitogen-aktivierten Proteinkinasen in GEC zytoprotektiv war, d. h. dass JNK und p38 die Zytotoxizität des Komplements einschränkten oder einschränkten (1, 32). Der Schutzmechanismus durch p38 war zumindest teilweise von Hsp27 abhängig, einem Substrat von MAPKAPK-2 (1). Diese Studie legt nahe, dass die Rolle von ERK bei GEC-Verletzungen komplexer sein könnte. Die Hemmung der Komplement-induzierten Aktivierung der ERK-Kaskade in GEC beeinflusste die Zytotoxizität des Komplements nicht signifikant ( 11 ). Eine zytoprotektive Rolle für ERK über MAPKAPK-2 und Hsp27 kann jedoch nicht ausgeschlossen werden, da die MAPKAP-2-Aktivierung nur teilweise von ERK abhängig war (Abb. 6). Chronische (aber nicht kurze) Inkubation mit Komplement in Gegenwart von Cytochalasin D oder Latrunculin B erhöhte die Komplement-Lyse (Abb. 10), aber die Kombination von ERK-Hemmung und Zerlegung des Zytoskeletts erhöhte die Komplement-Lyse nicht über das hinaus, das bei alleiniger Zerlegung des Zytoskeletts beobachtet wurde (Daten nicht gezeigt). Im Gegensatz dazu wurde die Zytotoxizität des Komplements in GEC verstärkt, die konstitutiv aktive MEK stabil exprimieren ( 11 ). Die Kinetik der ERK-Aktivierung ist wahrscheinlich zwischen den beiden Bedingungen unterschiedlich. Zuvor haben wir gezeigt, dass die ERK-Phosphorylierung während der chronischen Inkubation mit Komplement innerhalb von 20 Minuten verstärkt wurde und nach ∼ 5 Stunden wieder auf das Grundniveau zurückkehrte (13). Im Gegensatz dazu bleibt ERK in den GEC, die R4F-MEK stabil exprimieren, kontinuierlich aktiviert (25). Somit wurde die komplementabhängige Zytotoxizität durch chronische, konstitutive ERK-Aktivierung verschlimmert. In einer anderen Studie verstärkte die ERK-Hemmung in K562- und COS-7-Zellen die Komplement-Lyse (gemessen als Trypanblau-Aufnahme) (21). Eine kürzlich in GEC (33) durchgeführte Studie zeigte, dass Komplement DNA-Schäden und eine erhöhte Expression der Zellzyklus-regulierenden Gene p21 und GADD45 (Growth-Arrest-DNA-Schaden-45) induzierte. In dieser Studie verschlimmerte die Hemmung von MEK die DNA-Schädigung und reduzierte die Spiegel von p21 und GADD45. Die Autoren kamen zu dem Schluss, dass die ERK-Aktivierung GEC über die Regulierung der p21- und GADD45-Gene vor DNA-Schäden schützt. Obwohl diese Autoren zeigten, dass Komplement keine Apoptose induziert, wurde jedoch eine zytolytische Schädigung (z. B. LDH-Freisetzung) nicht untersucht. Darüber hinaus zeigten dieselben Forscher früher, dass C5b-9 die DNA-Synthese (aber nicht die Proliferation) in GEC induzieren kann (40). Somit erfordert die Wirkung von C5b-9 und ERK auf die DNA-Regulierung und Zellschädigung zusätzliche Studien. Mit dem Aufkommen von Medikamenten, die Proteinkinase-Signalwege modulieren, wird ein besseres Verständnis der Aktivierung von Proteinkinasen durch C5b-9 Einblicke in neue Angriffspunkte für die Therapie glomerulärer Erkrankungen liefern.


Schau das Video: Proteinkinasen - Biochemie - AMBOSS Video (Juni 2022).


Bemerkungen:

  1. Vihn

    Ich kann empfehlen, auf die Website zu kommen, auf der es viele Artikel zu dieser Ausgabe gibt.

  2. Mohamet

    Es tut mir leid, aber ich denke, Sie machen einen Fehler. Lass uns diskutieren. Senden Sie mir eine E -Mail an PM.

  3. Lache

    Vielen Dank! Ich habe so lange in guter Qualität gesucht.

  4. Yozshuramar

    Ich bestätige. Und ich bin darauf getroffen. Wir können über dieses Thema kommunizieren.

  5. Domingart

    Bravo, welche Worte ..., brillanter Gedanke

  6. Abdul- Matin

    Ich kann vorschlagen, auf die Website zu gehen, die viele Informationen zu diesem Thema enthält.

  7. Eban

    Kein Unglück!

  8. Azrael

    Es wurde speziell in einem Forum registriert, um Ihnen zu sagen, dass die Informationen für die Informationen, ich kann Ihnen auch etwas helfen?



Eine Nachricht schreiben