Information

SNP-Genotypisierung mittels PCR

SNP-Genotypisierung mittels PCR



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ich habe diesen Wikipedia-Artikel über die SNP-Genotypisierung gelesen und konnte diesen Teil nicht verstehen:

Wenn bei der Untersuchung der Ergebnisse eine genomische Probe homozygot ist, stammen die resultierenden PCR-Produkte von dem Primer, der die SNP-Position mit dem übereinstimmt äußerer, gegenüberliegender Strang Primer auch von den beiden gegenüberliegenden, äußeren Primern. Wenn die genomische Probe heterozygot ist, ergeben sich Produkte aus dem Primer jedes Allels zu ihren jeweiligen äußeren Primer-Gegenstücken sowie aus den beiden gegenüberliegenden äußeren Primern.

Kann das jemand erklären?


Gültiges XHTML http://nar.oxfordjournals.org/content/29/17/e88/F1.large.jpg">http://nar.oxfordjournals.org/content/29/17/e88/F1.expansion)


Erkennung von SARS-CoV-2-Varianten mit SNP-Genotypisierung

¶ https://www.cogconsortium.uk . Eine vollständige Liste der Namen und Zugehörigkeiten des Konsortiums ist in der S1-Datei verfügbar.

Rollen Konzeption, Förderakquise, Recherche, Methodik, Supervision, Schreiben – Review & Editing

Affiliation School of Biological Sciences, University of Bristol, Bristol, Vereinigtes Königreich

Rollen Konzeptualisierung, Datenkuration, Formale Analyse, Finanzierungsakquise, Untersuchung, Methodik, Ressourcen, Software, Supervision, Schreiben – Originalentwurf, Schreiben – Überprüfung und Bearbeitung

Affiliation School of Biological Sciences, University of Bristol, Bristol, Vereinigtes Königreich


SNP-Erkennung

Es gibt viele Methoden zum Nachweis neuer und bekannter SNPs. Dazu gehören DNA-Sequenzierung, Massenspektrometrie, Molecular Beacons, SNP-Microarrays und PCR-basierte Methoden.

Die SNP-Erkennung kann in zwei Untergruppen unterteilt werden: SNP-Erkennung und SNP-Screening. Die SNP-Erkennung umfasst SNPs, die noch nicht bekannt sind. Forscher suchen in gezielten Bereichen und genomweit nach neuen SNPs. Das SNP-Screening bezieht sich auf bekannte SNPs und Forscher suchen typischerweise nach Genotypisierungen von Individuen oder stellen fest, ob ein bestimmter SNP an der Erzeugung eines bestimmten Merkmals beteiligt ist. Es gibt viele Verfahren zur Durchführung sowohl der Entdeckung als auch des Screenings. Für einen historischen Bericht siehe das Papier von Kwok und Chen (1).


Materialen und Methoden

Herstellung genomischer DNA

Genomische DNA wurde aus frischem Blut unter Verwendung des Wizard Genomic DNA PuriWcation Kit (Promega Corp., Madison, WI) gemäß dem Protokoll des Herstellers isoliert. Kurz gesagt wurden 300 ul Vollblut in das Röhrchen überführt, das 900 ul Zelllyselösung enthielt, um die roten Blutkörperchen zu lysieren. Dann wurde nach dem Zentrifugieren das sichtbare weiße Pellet gesammelt und mit 100 &mgr;l Nuklei-Lyse-Lösung lysiert. Die Probe wurde erneut zentrifugiert und der Überstand in ein sauberes 1,5 ml Mikrozentrifugenröhrchen mit 300 µl Isopropanol überführt. Die weißen fadenförmigen DNA-Stränge könnten durch vorsichtiges Mischen der Lösung eine sichtbare Masse bilden. Dann wurde genomische DNA zweimal mit 70 % Ethanol gewaschen und schließlich in 50 &mgr;l DNA-Rehydrationslösung rehydratisiert. Die Qualität und Quantität der DNA wurden durch Gelelektrophorese und unter Verwendung von NANODROP 1000 (Thermo Scientific, Rockford, IL) bestimmt.

PCR-Primer-Design

Die Studenten wurden eingeladen, eine Gendatenbank vom National Center Biotechnology Institute abzurufen und Primer mit dem Primer Premier 5-Programm zu entwerfen. Durch die Suche nach dem Begriff „human prdx6“ in der Gendatenbank konnten die Schüler den Datensatz leicht finden (http://www.ncbi.nlm.nih.gov/gene/9588). Durch Klicken auf „SNP“ auf dieser Seite können die Schüler alle SNPs dieses Gens anzeigen. Dann wurden sie gebeten herauszufinden, welcher SNP aufgrund seiner flankierenden Sequenz eine Restriktionsstelle bilden könnte. Nach der Analyse aller SNPs in der Datenbank wurde ein SNP (rs4382766) ausgewählt, da eine SspI-Restriktionsstelle gefunden wurde, die diese SNP-Stelle überspannt. Eine Sequenz bestehend aus 500 bp stromaufwärts und stromabwärts von diesem SNP wurde für die Suche nach Primern eingegeben. Die Suchparameter umfassten Primerlänge, Suchregion und Produktlänge. Schließlich wurde ein Satz von Primern für die PCR ausgewählt, mit Vorwärtsprimer CCAAACTACTCTTCTTTCCCAACT und Rückwärtsprimer GACACTGTGCCAGGCCATAC. Die volle Länge des PCR-Produkts betrug 449 bp, was nach SspI-Verdau für das T-Allel in 186 und 263 bp aufgeteilt würde.

Amplifikation des Prdx6-Gens durch PCR

Das spezifische DNA-Fragment, das rs4382766 umfasst, wurde unter Verwendung einer regulären PCR amplifiziert, die in einem Gesamtvolumen von 20 μl mit 0,5 μg genomischer DNA, 1,0 pmol jedes Primers und 10 μl 2× Master Mixture (Tiangen, China) durchgeführt wurde. Die PCR-Zyklusparameter waren 94 °C für 5 Minuten, gefolgt von 35 Zyklen bei 94 °C für 30 Sekunden, 58 °C für 1 Minute und 72 °C für 1 Minute und eine zusätzliche Verlängerung bei 72 °C für 5 Minuten . Anschließend wurden 5 µl des PCR-Produkts auf einem 2% Agarosegel analysiert.

Reinigung von PCR-Produkten

Das PCR-Rohprodukt wurde mit dem SanPrep PCR Purification Kit (Sangon Co. Shanghai, China) gereinigt. Nach Zugabe von drei Volumen Puffer B3 zum Rohprodukt wurde das Röhrchen mehrmals umgedreht. Dann wurde die Mischung auf die Mitte einer Bindungssäule in einem Waschröhrchen geladen. Nach 1 Minute Zentrifugieren wurde die Bindungssäule weiter zweimal mit Waschpuffer gewaschen. Schließlich wurden 25 ul Elutionspuffer in die Mitte der Säule gegeben und zentrifugiert, um die gereinigte DNA zu eluieren.

Restriktionsenzymverdauung

Nach Verifizierung des PCR-Produkts durch Elektrophorese wurde das gereinigte PCR-Produkt mit SspI-Enzym (New England Biolabs Inc.) mit einem Gesamtvolumen von 20 µL mit 2 µL 10x Puffer, 17 µL des Produkts und 1 µL (10U .) verdaut ) von SspI. Um einen unvollständigen Verdau zu vermeiden, wurde das Gemisch 2 Stunden bei 37 °C inkubiert und dann auf einem 2% Agarosegel analysiert.

Vorsichtsmaßnahmen und Sicherheit

Aus Vorsichts- und Zeitgründen wurden die meisten Reagenzien/Lösungen mit den handelsüblichen Kits bereitgestellt oder vom Ausbilder in Chargen vor dem Experiment vorbereitet. Das größte Gefahrgut waren die Blutproben. Obwohl diese Proben gesunden Probanden entnommen wurden, wurden die Schüler über die Gefahren aufgeklärt und aufgefordert, die Richtlinien der Sicherheitsvorschriften zu befolgen. Sie wurden auch über andere gefährliche Chemikalien informiert, die bei allen Experimenten verwendet wurden, und sie mussten während aller Verfahren Handschuhe tragen. Um die Kontinuität dieses Praktikums zu gewährleisten, wurden genomische DNA und ihre PCR-Produkte vom Dozenten für diejenigen vorbereitet, die kein Produkt erhalten haben, um sicherzustellen, dass alle Studenten den letzten Schritt erreichen.


Sequenzierung

Sequenzierungstechnologien der nächsten Generation wie die Pyrosequenzierung sequenzieren weniger als 250 Basen in einem Read, was ihre Fähigkeit zur Sequenzierung ganzer Genome einschränkt. Ihre Fähigkeit, Ergebnisse in Echtzeit zu generieren, und ihr Potenzial zur massiven Skalierung machen sie jedoch zu einer praktikablen Option für die Sequenzierung kleiner Regionen zur Durchführung der SNP-Genotypisierung. Im Vergleich zu anderen SNP-Genotypisierungsmethoden eignet sich die Sequenzierung insbesondere zur Identifizierung mehrerer SNPs in einer kleinen Region, wie der hochpolymorphen Region des Major Histocompatibility Complex des Genoms.


Genotypisierung - qPCR


Genotypisierung bezieht sich auf den Prozess der Bestimmung genetischer Variationen zwischen Individuen in einer Population. Einzelnukleotidpolymorphismen (SNPs) sind die häufigste Art der genetischen Variation und sind definitionsgemäß Einzelbasenunterschiede an einem bestimmten Locus, die bei mehr als 1% der Bevölkerung vorkommen. SNPs können sowohl in kodierenden als auch in nicht-kodierenden Regionen des Genoms gefunden werden und können zu phänotypischen Variationen führen, wenn sie in kodierenden Regionen gefunden werden. Diese Veränderungen des Genotyps können zu positiven oder negativen phänotypischen Ergebnissen führen, wie z. B. einer robusteren Stresstoleranz bei Pflanzen oder erhöhen die Anfälligkeit für Krankheiten beim Menschen. Daher sind SNPs oft nützliche Marker für das Verständnis der Biologie von Organismen.

Wenn SNPs in nicht-kodierenden Regionen gefunden werden, dienen sie als Marker für evolutionäre Genomikstudien. Mit SNPs verwandt sind &ldquoInDels&rdquo, kurz für inSertionen und delNukleotide unterschiedlicher Länge. Wie bei SNPs können InDels in kodierenden Regionen die Aminosäuresequenz eines Proteins ändern, entweder durch Hinzufügen oder Subtrahieren einer Aminosäure zu der Sequenz, wenn das Indel ein Vielfaches von 3 ist, oder indem eine Rasterverschiebungsmutation erzeugt wird, wenn das Indel nicht in . ist ein Vielfaches von 3.

Eine dritte Art der genetischen Variation ist die Kopienzahlvariation (CNV), die aus unterschiedlichen Kopienzahlen eines DNA-Segments in verschiedenen Genomen resultiert. In Fällen, in denen die Variation der Kopienzahl für ein kodiertes Gen gilt, kann die Variation zu einer Anfälligkeit oder Resistenz gegenüber Krankheiten führen. Einige Phänotypen sind auch dosissensitiv, und die Kopienzahl ist verantwortlich für die Variationsschattierungen zwischen den Mitgliedern einer Art.

Sowohl für die SNP-Genotypisierung gibt es viele Verfahren, um den Genotyp unter Individuen zu bestimmen. Das gewählte Verfahren hängt im Allgemeinen von den Durchsatzanforderungen ab, die eine Funktion sowohl der Anzahl der Individuen, die genotypisiert werden, als auch der Anzahl der Genotypen, die für jedes Individuum getestet werden, ist. Die gewählte Methode hängt auch von der Menge an Probenmaterial ab, die von jedem Individuum oder jeder Probe zur Verfügung steht, was die erforderliche Sensitivität des Assays bestimmt.


Arthrose: Genetische Studien monogener und komplexer Formen

3.2.2 Genomweite Assoziationsstudien

Mit den Fortschritten der Hochdurchsatz-SNP-Genotypisierungstechnologie wurden im letzten Jahrzehnt genomweite Assoziationsstudien (GWAS) möglich. 17 GWAS machte sich das Kopplungsungleichgewicht (LD) zunutze, d. h. die Tatsache, dass sich in jeder gegebenen chromosomalen Region des Genoms Allele an physisch nahegelegenen Loci in der Population segregieren. Die analysierten Marker müssen nicht funktionell sein, sondern können sich einfach in LD mit der funktionellen Variante befinden. 65 Die groß angelegte Natur von GWAS führt jedoch zu einem mehrfachen Testproblem, das die Replikation jeglicher positiver Assoziationen erfordert. Dennoch sind GWAS ein leistungsfähiger Ansatz, um die genetischen Grundlagen komplexer Krankheiten wie OA zu erschließen. Einzelne Studien können durch Beschränkungen der Stichprobengröße behindert werden, die zu einem Mangel an statistischer Aussagekraft führen, und Metaanalysen auf der Grundlage von Konsortiumsbemühungen können dazu beitragen, einige dieser Beschränkungen zu überwinden.

Bisher wurden mehrere GWAS in OA veröffentlicht und eine Zusammenfassung der Ergebnisse ist in Tabelle 24.2 dargestellt. Obwohl sie klar zeigen, dass es kein definitives und häufiges Allel mit hoher Penetration gibt, das OA verursacht, sind einige interessante Gene aufgetaucht. Die Ergebnisse beschreiben die Arten von Genen und genetischen Varianten, die an OA beteiligt sind, besser und bieten wesentliche Erkenntnisse für die zukünftige Forschung.

Die erste veröffentlichte GWAS mit über 100.000 Markern stammt aus dem Vereinigten Königreich und verwendet gepoolte DNAs von 357 Knie-OA-Patienten und 285 Kontrollen. 66 Es identifizierte ein Signal (rs4140564) zwischen PTGS2 und PLA2G4A. 66 Eine zweite GWAS von Knie-OA wurde von einer japanischen Gruppe veröffentlicht. 54 Nach dem Screening von Patienten und 658 Kontrollen auf <.80.000 SNPs wurde eine Untergruppe von 2.153 SNPs in einer zweiten Gruppe von 646 Knie-OA-Fällen und 631 Kontrollen getestet. Zwei Varianten in dieser Region wurden als die am stärksten assoziiert identifiziert. Der Locus wurde doppelter von Willebrand-Faktor A (DWVA) und zwei Kodierungsvarianten, rs11718863 und rs7639618, wurden zusätzlich zu chinesischen und japanischen Fällen und Kontrollproben als stark mit dem Risiko einer Kniearthrose assoziiert. Es wurde festgestellt, dass die beiden SNPs die Bindung der DVWA Protein zu β-Tubulin, und die Autoren stellten die Hypothese auf, dass Tubuline und Mikrotubuli schützende Faktoren bei der Pathogenese von OA sein könnten. 54 Später wurde jedoch festgestellt, dass die beiden SNPs bei kaukasischen Patienten keine Assoziation bei Knie- oder Hüft-OA zeigten. 67 Andererseits wurde später bioinformatisch gezeigt, dass DVWA ist ein Teil des menschlichen Gens, das für die Kollagen VI alpha4-Kette kodiert (COL6A4) 68 ( Tabelle 24.2 ).

Eine weitere japanische Studie identifizierte zwei SNPs innerhalb einer kleinen Region des HLA-Locus auf Chromosom 6p, die mit Knie-OA assoziiert sind, mit P < 7 × 10 –8 . 56 In europäischen Kohorten und einer Population von Han-Chinesen gelang jedoch keine Replikation. 69,70

GWAS in europäischen Kohorten aus den Niederlanden (Rotterdam-Studie) 71 identifizierte ein Signal (P < 8 × 10 –8 , OR 1,14 in einer Region auf Chromosom 7q22, die einen großen LD-Block umfasste, der sich über 500 kb erstreckte und mit Knie- und Hand-OA assoziiert war. Das Hinzufügen mehrerer weiterer Kohorten zur ursprünglichen Studie erhöhte die Glaubwürdigkeit dieses Signals. Der LD-Block enthielt jedoch sechs bekannte Gene, die alle gleich gute Kandidaten für eine Assoziation mit OA sind. Diese beinhalten PRKAR2B (kodierend für Proteinkinase-cAMP-abhängiger-regulatorischer Typ II-β), GPR22 (kodierend für den G-Protein-gekoppelten Rezeptor 22) und COG5 (kodierende Komponente des oligomeren Golgi-Komplexes 5). Eine anschließende Metaanalyse, an der 6.709 Patienten mit Knie-OA und 44.439 Kontrollen teilnahmen, zeigte schlüssig, dass dieses Signal mit einer genomweiten Signifikanz in Proben europäischer Abstammung mit OR = 1,17 (95% CI 1,11–1,24) und a P-Wert von 9,2 × 10 –9 , jedoch nicht in asiatischen Populationen, wo die OR 1,03 (95%-KI 0,85–1,25 n.s.) betrug 58 (Tabelle 24.2).

Die arcOGEN-Studie ist ein britisches Konsortium mit Sitz in sieben Sammelzentren, das über eine Entdeckungskohorte von 3177 Patienten und 4894 (nicht phänotypisch charakterisierten) Kontrollen der Population berichtete. 72 Die Replikation der Signale umfasste zusätzliche europäische Kohorten sowie kaukasische Nordamerikaner, was zu einer Gesamtmetaanalysestichprobe von 13.768 Hüft- und Knie-OA-Patienten und 53.286 Kontrollen führte. Obwohl es sich um die bisher größte Stichprobengröße handelte, war es nicht in der Lage, ein Signal von genomweiter Bedeutung zu identifizieren. Das stärkste Signal war rs2277831 (P = 2,3 × 10 −5 ), innerhalb von MICAL3. 72

Später generierte dieselbe Gruppe eine projektbasierte Imputation von 1000 Genomen 73 auf den gleichen Daten des arcoGEN-Konsortiums wie oben erwähnt (3177 Knie- und Hüft-OA-Patienten und 4894 Populationskontrollen). Imputationsmethoden nutzen Informationen über Muster der Multimarker-Korrelation (Kopplungsungleichgewicht) aus öffentlich zugänglichen Datenbanken, wie dem International HapMap-Projekt oder den SeattleSNPs-Resequenzierungsstudien und neuerdings dem 1000-Genom-Projekt 73, um einzelne Patienten- oder Kontrollgenotypen zu schätzen oder zu „imputieren“. bei untypisierten SNPs und bewerten die geschätzten Genotypen auf Assoziation mit Phänotyp. Die imputierten Daten wurden dann verwendet, um zuvor nicht identifizierte Risikoorte zu erkennen. Durch groß angelegte Replikation war es möglich, eine robuste Assoziation mit SNPs in der von der MCF.2-Zelllinie abgeleiteten transformierenden Sequenz-ähnlichen (MCF2L). 59 Das Spitzensignal rs11842874 erreichte einen kombinierten OR1,17 (95% CI 1,11–1,23), P = 2,1 × 10 -8 über insgesamt 19.041 OA-Fälle und 24.504 Kontrollen europäischer Abstammung (Tabelle 24.2). MCF2L kodiert für einen rho-spezifischen Guanin-Nukleotid-Austauschfaktor, und seine Rolle bei OA bleibt unklar.

Eine GWAS-Metaanalyse an 78.000 Personen identifizierte eine genomweite signifikante Variante (rs6094710) in der NCOA3 Gen (OR = 1,28 95 % KI 1,18–1,39 P = 7,9 × 10 –9 ). 65 Dies P-Wert wurde nach kombinierter Analyse der Entdeckung verbessert (P = 5,6 × 10 -8 ) und Folgestudien (P = 7,3 × 10 –4 ). Zwei Loci blieben suggestiv assoziiert: rs5009270 bei 7q31 (OR = 1,10 P = 9,9 × 10 -7 ) und rs3757837 (OR = 1,27 P = 2,2 × 10 –6 in einer männlichen spezifischen Analyse) 62 (Tabelle 24.2).

Ein GWAS zu Hüft-OA, das Daten aus der Osteoporotic Fractures in Men Study und der Studie zu osteoporotischen Frakturen verwendet, wurde in fünf unabhängigen Studien repliziert. Der rs788748 SNP befindet sich in der Nähe des IGFBP3 Gen war in dieser Analyse genomweit signifikant und mit einem geringeren Risiko für Hüft-OA assoziiert (OR = 0,71 P = 2,0 × 10 –8 ). Obwohl sich die Assoziation in allen fünf Studien replizierte, war das Signal nach der Replikation abgeschwächt, was auf ein mögliches falsch positives Ergebnis hindeutet (OR = 0,92 P = 0,020). Trotzdem legen die Ergebnisse von funktionellen Validierungsstudien eine Rolle dieser Variante und dieses Gens bei OA nahe. 63 Weitere Replikation ist notwendig, idealerweise mit größeren Stichprobengrößen, um die Rolle dieser Variante in OA sicherer zu behaupten 63 ( Tab. 24.2 ).

Eine GWAS zur Knorpeldicke an der Hüfte wurde mit Daten aus der Rotterdamer Studie durchgeführt. Ein SNP im DOT1L-Gen war stark mit mJSW an der Hüfte verbunden 74 . Nach Replikation in unabhängigen britischen Kohorten wurde eine genetische Gesamteffektstärke (ausgedrückt als Regressionskoeffizient Beta) von 0,09 mm/Allel erreicht (P = 1,1 × 10 –11 nach Metaanalyse). 74 Das Risikoallel für niedrigeres mJSW bei diesem SNP wurde später mit einem um 10 % erhöhten Risiko für Hüft-OA assoziiert (P = 8,8 × 10 –8 ). Dieser Effekt erreichte bei Männern genomweite Signifikanz (OR = 1,17 95% CI 1,11–1,23 P = 7,8 × 10 –9 ), war jedoch bei Frauen mit einer kleinen Effektstärke (OR = 1,05) nur nominell signifikant, was mit dem bei einigen Formen der Hüft-OA beobachteten Sexualdimorphismus übereinstimmt 66 (Tabelle 24.2).

Das erste GWAS, das genomweite signifikante Ergebnisse für Hand-OA berichtete, ergab einen SNP (rs3204689) in der ALDH1A2 Gen signifikant mit einem erhöhten Risiko für Hand-OA in einer isländischen Entdeckungskohorte (OR = 1,51, P = 3,99 × 10 –10 ). Dieser Befund wurde in Kohorten aus dem Vereinigten Königreich und den Niederlanden repliziert und zeigte eine verbesserte Assoziation und ein signifikant erhöhtes Risiko für Hand-OA (OR = 1,46, P = 1,10 × 10 -11 ). In-silico-Replikation fand eine signifikante Assoziation mit dieser Variante für Knie-OA, jedoch nicht für Hüft-OA. Interessanterweise war dies ein protektiver Effekt (OR = 0,95, P = 0,044), das Gegenteil des Effekts wird bei Hand-OA beobachtet. Die Autoren waren von diesem Befund überrascht, da in der Literatur zuvor ein enger Zusammenhang zwischen Hand- und Knie-OA 67 vorgeschlagen wurde (Tab. 24.2).


Kostengünstigere und effektivere nichtinvasive SNP-Genotypisierung mit Hochdurchsatz-Amplikon-Sequenzierung

Nicht-invasive Genotypisierungsmethoden sind in den letzten zwei Jahrzehnten zu Schlüsselelementen der Wildtierforschung geworden, aber ihre weit verbreitete Anwendung wird durch hohe Kosten, geringe Erfolgsraten und hohe Fehlerquoten begrenzt. Der Informationsverlust, wenn der Erfolg der Genotypisierung gering ist, kann zu einer verringerten Genauigkeit der Tierpopulationsdichten führen, was zu falschen Schutz- und Managementmaßnahmen führen könnte. Single-Nukleotid-Polymorphismen (SNPs) stellen eine vielversprechende Alternative zu herkömmlich verwendeten Mikrosatelliten dar, da SNPs die Amplifikation kürzerer DNA-Fragmente ermöglichen, weniger anfällig für Genotypisierungsfehler sind und Ergebnisse liefern, die leicht zwischen Labors geteilt werden können. Hier skizzieren wir ein detailliertes Protokoll für eine kostengünstige und genaue nichtinvasive SNP-Genotypisierung mit hoch gemultiplexter Amplikon-Sequenzierung, die für degradierte DNA optimiert ist. Wir validierten diese Methode zur individuellen Identifizierung durch Genotypisierung von 216 Kot, 18 Haaren und 15 Geweben von Kojoten (Canis latrans). Unsere Genotypisierungs-Erfolgsrate für Kotproben betrug 93 % und 100 % für Haare und Gewebe, was einen erheblichen Anstieg im Vergleich zu früheren Mikrosatelliten-basierten Studien mit Kosten von weniger als 5 USD pro PCR-Replikat (ohne Arbeit) darstellt. Die Genauigkeit der Genotypen wurde weiter dadurch bestätigt, dass Genotypen von Kojoten, die mit bekannten, GPS-halsierten Kojoten übereinstimmten, sich immer im Territorium des bekannten Individuums befanden. Wir zeigen auch, dass verschiedene Multiplexing-Stufen ähnliche Ergebnisse lieferten, dass Strategien zur Reinigung von PCR-Produkten jedoch erhebliche Auswirkungen auf den Erfolg der Genotypisierung haben können. Indem die nichtinvasive Genotypisierung erschwinglicher, genauer und effizienter gemacht wird, kann diese Forschung eine deutliche Zunahme des Einsatzes nichtinvasiver Methoden zur Überwachung und Erhaltung freilebender Wildtierpopulationen ermöglichen.


Eine alternative Methode für die menschliche Geschlechtstypisierung

Zitationszusammenfassung: Die Identifizierung des Geschlechts einer biologischen Probe wird konventionell über die PCR-Amplifikation von Amelogenin Gene. In dieser Studie untersuchen Maxeiner et al. die Gültigkeit der Geschlechtsbestimmung anhand von Neuroligin-4, ein mit Autismus assoziiertes Gen, und präsentieren eine alternative Methode unter Verwendung des rhAmp SNP Genotyping Systems.

Hintergrund

Die Bestimmung der Geschlechtsidentifikation einer Stichprobe ist ein wichtiger Teil eines breiten Forschungsspektrums. Humanforensische Analysen, tiergenetische Forschung mit Schwerpunkt auf strategischer Viehzucht und Labore, die Mausmodelle für alle Arten der biologischen Forschung verwenden, profitieren alle von der Geschlechtsidentifikation basierend auf DNA. Jahrzehntelang basierte die Geschlechtsidentifikation auf der Anwesenheit der SRY Gen, das mittels PCR auf dem Y-Chromosom gefunden wurde. Leider ist das Fehlen der SRY Gen garantiert nicht, dass die Probe weiblich ist, und diese Experimente verwenden SRY fehlt eine interne Kontrolle. Nutzung der Amelogenin Gene (AMELX/Y) zur Geschlechtsdifferenzierung schien dieses Problem zu lösen, da sie sowohl auf dem X- als auch auf dem Y-Chromosom lokalisiert sind. Neuroligin-4 (NLGN4X/Y) hat ähnliche Eigenschaften und kommt auf beiden Geschlechtschromosomen vor, was das Potenzial dieses Gens für die Verwendung bei der Geschlechtsidentifikation unterstreicht.

Die PCR ist die konventionelle Methode der Wahl zur Geschlechtsidentifikation. Wenn Gene mögen NLGN4X/Y mehrere Mutationen enthalten, reicht die Standard-PCR möglicherweise nicht aus, um zwischen den 2 Genkopien zu unterscheiden. Das rhAmp&trade SNP Genotyping System überwindet die Herausforderung vieler Polymorphismen, indem es blockierte Primer verwendet, um unspezifische Amplifikationen zu minimieren. Das 3'-Ende von rhAmp-Primern enthält eine Blockierungsgruppe, die eine Verlängerung verhindert, es sei denn, es erfolgt eine Spaltung und Deblockierung durch das RNase H2-Enzym. Das RNase H2-Enzym erkennt diese RNA-Base nur, wenn sie an ihr perfektes Komplement hybridisiert, wodurch die Primerspaltung und Aktivierung eingeleitet wird (siehe Abbildung).

Methode

Gensequenzinformationen wurden aus der NCBI-Datenbank heruntergeladen. DNA wurde aus 6 bukkalen Zellproben und 105 menschlichen Blutproben extrahiert. PCR-Primer wurden verwendet, um eine Insertions-/Deletions-(Indel)-Region zu identifizieren. Die SNP-Genotypisierung wurde mit dem rhAmp SNP Genotyping System durchgeführt, beginnend mit der Identifizierung von Primern mit dem rhAmp Genotyping Design Tool

Ergebnisse

Damit herkömmliche PCR zwischen den Geschlechtern unterscheiden kann, darf die Sequenz keine mehrdeutigen Basen enthalten, die das Primer-Annealing hemmen könnten, und die 2 Allele, X und Y, müssen auf einem Agarosegel mittels Elektrophorese unterscheidbar sein. Im Gegensatz zu konventioneller PCR erlaubt das rhAmp SNP Genotyping System Variationen in der Sequenz.

Um zu testen, ob NLGN4 zur Geschlechtsidentifizierung unter Verwendung herkömmlicher PCR verwendet werden konnten, zielten Maxeiner et al. auf eine Indel-Region unmittelbar stromaufwärts des Startcodons. Schon seit NLGN4X (381 bp) ist fast doppelt so lang wie NLGN4Y (187 bp) kann konventionelle PCR verwendet werden, um unter Verwendung von Agarosegelelektrophorese zwischen den 2 Allelen zu unterscheiden.

Die Forscher konzentrierten sich beim Testen auf Einzelnukleotidpolymorphismen (SNPs). NLGN4 unter Verwendung des rhAmp SNP Genotyping Systems. Alle 3 vom rhAmp Genotyping Design Tool entworfenen Assays wurden erfolgreich identifiziert NLGN4X. Ein Assay war in der Lage, Proben in Cluster zu trennen, um zwischen beiden Geschlechtsallelen zu unterscheiden.

Diese Studie ist die erste, die die rhAmp-Genotypisierung als Methode zur Geschlechtsidentifikation untersucht. Das rhAmp SNP Genotyping System war in der Lage, das Geschlecht der Proben mit der gleichen Geschwindigkeit wie der herkömmliche PCR-Assay zu identifizieren, bietet jedoch den Vorteil der Skalierung. Das rhAmp SNP Genotyping System kann auf Multiplexing skaliert werden und ermöglicht ein Hochdurchsatz-Screening. Die Polymorphismen in NLGN4X/Y waren gültige Marker zur Unterscheidung der Geschlechtsallele. Diese Gene könnten in Verbindung mit oder als Alternative zu anderen geschlechtsspezifischen Genpaaren verwendet werden, wie z AMELX/Y. Die rhAmp-SNP-Strategie könnte auch auf diese anderen geschlechtsspezifischen Genpaare angewendet werden.


Ist die Erfassung der Rohdaten und deren Interpretation kompliziert?

Die Antwort ist Nein. Sobald das SpectroCHIP-Array in den MassARRAY-Analysator geladen ist, werden die Analytkristalle bestrahlt und ionisiert, damit die geladenen Moleküle in einen Detektor beschleunigt werden. Die Trennung erfolgt nach der Flugzeit, d. h proportional auf die Masse der einzelnen Moleküle.

Der gesamte Prozess dauert weniger als 50 Minuten 384 Proben zu analysieren. In diesem Bild können wir Ihnen zeigen, wie ein komplettes Spektrum für ein Experiment des 36-Plex-Assays aussieht. Die hervorgehobenen Peaks zeigen eine 24-Da-Trennung in heterozygoten Allelen (B) des fraglichen SNP im Vergleich zum homozygoten Single-Peak-Genotyp (C).

Typer Die Software generiert automatisch Berichte, die die SNP-Allele (homozygot oder heterozygot) in jeder Probe identifizieren.


Bioline Scholar – Menschliche Gene, Genetik, Genome (Special ASHG 2012 Edition)

Jahrestagung der American Society of Human Genetics 2012

Bioline war erneut Aussteller (#Stand 1324-1326) auf der Jahrestagung der American Society of Human Genetics (ASHG) im November in San Francisco. Die ASHG 2012, das größte Humangenetik-Meeting der Welt, zog über 7000 Delegierte an, um die neuesten Fortschritte in der Grundlagen- und klinischen Forschung zu diskutieren.

Die Sitzungen umfassten Themen wie vergleichende Epigenomik, frühe Exom-Sequenzierung in komplexen Merkmalen, groß angelegte Identifizierung von Regulatoren der Translation und integrierte genetische und funktionelle Studien von krankheitsverursachenden Varianten.

Bioline stellte auf der Konferenz seinen neuen Messestand vor, auf dem sich unsere Vertreter mit Wissenschaftlern trafen und Lösungen für ihre molekularbiologischen Herausforderungen diskutierten. Bioline PCR Specialist Dr. Sven Bocklandt hielt eine Reihe von gut aufgenommenen und zum Nachdenken anregenden Vorträgen über einige unserer neuesten Produkte, darunter SensiFAST™, MyFi™ und MyTaq™ DNA-Polymerasen. Es wurden spannende Ergebnisse sowohl aus veröffentlichten Artikeln als auch aus einigen unveröffentlichten Experimenten der wissenschaftlichen Gemeinschaft von Bioline präsentiert, einschließlich der Ergebnisse der Bioline PCR Challenge.

In Übereinstimmung mit ASHG 2012 widmet sich der Bioline-Stipendiat dieses Monats der Humangenetik. Wir freuen uns, Ihnen eine Auswahl aktueller Veröffentlichungen zu Bioline-Produkten vorstellen zu können, die sich perfekt für kleine und große genetische und genomische Studien am Menschen eignen.

BIO-X-ACT™ Lange DNA-Polymerase

Mutationen in MTM1 (Myotubularin 1) verursachen eine X-chromosomale myotubuläre Myopathie, die 1 von 50.000 Männern betrifft. Bei Neugeborenen oder Säuglingen sind Bewegung und Atmung stark beeinträchtigt. Die Autoren entwickelten eine MTM1-spezifische Datenbank genetischer Varianten mit 474 identifizierten Mutationen von 472 Patienten. Next-Gen-Sequenzierung (Illumina HiSeq) und cDNA-Analyse ergaben in einem Fall das Vorhandensein eines neuen MTM1/MAMLD1-Fusionstranskripts.

CDNA-Synthese-Kit

Kinder mit X-chromosomaler Retinitis pigmentosa (XLRP) erblinden oft im zweiten Lebensjahrzehnt. Eine schwere Form von XLRP, RP23, wurde zuvor einem 10,71-Mb-Intervall auf Xp22.31-22.13 zugeordnet, das 62 Gene enthält. Mit gezieltem NGS (Illumina) identifizierten die Autoren eine tiefe intronische Mutation in OFD1 als wahrscheinlichste Ursache von RP23. Die Insertion eines kryptischen Exons erzeugt ein abweichendes Transkript und reduzierte Mengen an korrekt gespleißtem Transkript. Es wird vorhergesagt, dass dies zu einem stark verkürzten Protein und verringerten Spiegeln von normalem Protein führt.

BIOTAQ™ DNA-Polymerase

Die genetische Grundlage für die Anfälligkeit für Malaria in einer vietnamesischen Bevölkerung wurde durch SNP-Genotypisierung von Forschern der Universität Oxford und des MalariaGen-Konsortiums untersucht. Es wurden Daten von 65 SNPs in 42 Malaria-Kandidatengenen in 956 schweren Malariafällen und 2350 Kontrollen aus Vietnam gemeldet. Varianten in sechs Genen (ICAM1, IL1A, IL17RC, IL13, LTA und TNF), die für Adhäsion und proinflammatorische Moleküle kodieren, wurden mit schwerer Malaria in Verbindung gebracht.

BioMix™ Rot

Fazioskapulohumerale Muskeldystrophie (FSHD), gekennzeichnet durch Muskelschwäche und Muskelschwund, ist mit einer verkürzten Telomer-Chr 4q35 aufgrund von Deletionen des D4Z4-Tandem-Repeats (FSHD1) oder DNA-Methylierungsänderungen von D4Z4 (FSHD2) verbunden. Mittels Exom-Sequenzierung (Illumina NGS) identifizierten die Autoren zwei bekannte pathogene Mutationen in CAPN3, was auf einen Fall von Gliedergürtel-Muskeldystrophie Typ 2A (LGMD2A) statt FSHD2 hinweist. Die Autoren kommen zu dem Schluss, dass die „Diagnose durch Sequenzierung“ von FSHD in klinischen Genetiklabors auf der ganzen Welt häufiger angewendet werden könnte.

Eine geordnete humane Genombibliothek mit 115.000 PAC-Klonen wurde konstruiert. Funktionelle Studien mit einem p53-enthaltenden PAC-Klon in p53-null menschlichen Osteosarkomzellen zeigten die Nützlichkeit einzelner Bibliotheksmitglieder in menschlichen Zellkulturmodellen. Die Bibliothek kann zur Validierung von durch GWAS identifizierten Kandidatengenen und für die Gentherapie bei verschiedenen rezessiven Erkrankungen verwendet werden.

Immomix™

Die Charcot-Marie-Tooth-Krankheit (CMT) ist eine erbliche Funktionsstörung der peripheren Nerven, die zu Taubheit und Schwäche führt. Mutationen in vier Genen, die für eine Aminoacyl-tRNA-Synthetase (ARS) kodieren, wurden mit CMT in Verbindung gebracht. Diese Studie der University of Michigan ergab, dass die p.Arg329-AARS-Mutation eine wiederkehrende Mutation mit Funktionsverlust ist, die aufgrund einer methylierungsvermittelten Desaminierung eines CpG-Dinukleotids entsteht.

Einführung in die Bioline Scholar Publications Database

Bioline-Stipendiat – von Bioline: The PCR Company

Wenn Sie mehr über die Bereiche und Forschungsbereiche wissen möchten, in denen Bioline-Produkte zur Vertiefung des Wissens verwendet wurden, haben wir unserer Website eine Bioline Scholar-Seite hinzugefügt, auf der die Artikel und Veröffentlichungen aufgeführt sind, in denen unsere molekularbiologischen Reagenzien enthalten sind vorgestellt.

Sie können nach Veröffentlichungen nach Autor, Titel, Thema und Produkt suchen und das Archiv enthält Aufsätze von 1994 bis heute. Derzeit listet die Bioline Scholar-Datenbank und bietet Links zu Publikationen, in denen die Forschung mit den folgenden Bioline-Produkten durchgeführt wurde:

Das war's für den Bioline-Blog 2012 – Saisongrüße an alle unsere Kunden und Leser, von allen bei Bioline – bis 2013!


Schau das Video: rhAmp SNP Genotyping: A novel approach for improving PCR-based SNP genotyping (August 2022).