Information

Luciferase-Promotor-Vektor über p-AcGFP1-C1-Vektor

Luciferase-Promotor-Vektor über p-AcGFP1-C1-Vektor


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Der AcGFP1-Vektor kann selbst Licht emittieren, während im Fall des Luc-Vektors ein Substrat für die Reaktion benötigt wird. Trotzdem soll Luc spezifischer oder besser als AcGFP1 sein. Warum wird das so genannt? Was sind die Vorteile von Luc-Vektoren gegenüber AcGFP1?


Sie verwechseln Lumineszenz und Fluoreszenz. GFP emittiert kein Licht. Die Abkürzung steht für Green Fluorescent Protein. Sie müssen es mit einer blauen Lichtquelle anstrahlen und es wird grün fluoreszieren. Das Problem ist, dass viele Organismen Hintergrundfluoreszenz haben, eine Zelle ohne GFP kann oft selbst ein wenig Fluoreszenz haben oder Pigmente enthalten, die das Signal maskieren.

Luciferase-Assays beruhen auf einer chemischen Reaktion, bei der ein Molekül (Luciferin im Fall der Glühwürmchen-Luciferase) oxidiert und Photonen emittiert werden. Dies ist viel empfindlicher als Fluoreszenz, aber auch viel teurer und erfordert normalerweise (aber nicht immer) eine Zelllyse. Es ist sehr selten, dass eine Zelle selbst Licht emittiert, sodass der Hintergrund viel niedriger ist, sodass Sie kleinere Unterschiede sehen können.

Es gibt viele Gründe, sich für einen Assay zu entscheiden. Wenn Sie etwas mehr darüber sagen, wie Sie den Reporter verwenden möchten, erhalten Sie eine detailliertere Antwort.


Der zu verwendende Vektor hängt davon ab, was Sie tun möchten.

Die möglichen Probleme mit GFP sind:

  • Der Funktionsverlust des Fusionsproteins (du fügst deinem Protein 238 Aminosäuren hinzu, das ist eine ziemlich große Veränderung!). Es gibt Vektoren, die eine Fusion in C- oder N-ter Ihres Proteins ermöglichen, um dies zu vermeiden.

  • Das GFP kann sich von seinem Fusionsprotein trennen, was Beobachtungen oder Immunpräzipitationen nutzlos macht.

  • Bei einem Vektor mit hoher Expression haben Ihre Zellen möglicherweise eine Sättigung der Fluoreszenz, so dass eine Quantifizierung schwierig wäre.

Beim Luciferase-Assay fügen Sie das Substrat hinzu, damit Ihre Quantifizierungen durchgeführt werden können, sobald die Reaktion beginnt und die Luminometer empfindlich genug sind, um eine sehr geringe Luc-Aktivität zu erkennen oder sehr wenige Zellen zu verwenden.

ABER

Mit GFP-Vektoren können Sie In-vivo-Assays (Quantifizierung, intrazelluläre Lokalisierung, Zellsortierung…) durchführen, während Luc-Assays die Lyse Ihrer Zellen erfordern. Je nach Ziel ist es also besser, das eine oder andere System zu verwenden.


Entwicklung eines therapeutisch wichtigen strahleninduzierten Promotors

Die radiogenetische Therapie ist eine Kombination aus Strahlentherapie und Gentherapie, die einige der mit der konventionellen Strahlentherapie verbundenen Probleme lösen kann. Ein auf Strahlung ansprechender Promotor wurde aus einer Promotorbibliothek erhalten, die aus DNA-Fragmenten bestand, die durch Verknüpfen des TATA-Box-Signals mit zufällig kombinierten Bindungssequenzen von strahlungsreaktiven Transkriptionsfaktoren erzeugt wurden. Jeder mit dem Luciferase-Gen verbundene Promotor wurde durch Luciferase-Expressionsverstärkung in transfizierten Zellen nach Röntgenbestrahlung bewertet. Die Reaktivität des besten Promotors wurde durch die zufällige Einführung von Punktmutationen verbessert und der resultierende Promotor zeigte eine mehr als 20-fache Steigerung der Luciferase-Expression nach Röntgenbestrahlung mit 10 Gy. Die Expression nachgeschalteter Gene wurde auch in stabil transfizierten Zellen nicht nur durch Röntgenstrahlen, sondern auch durch Bestrahlung mit Protonenstrahlen verstärkt, und jede Verstärkung wurde abgeschwächt, wenn ein Antioxidans zugegeben wurde, was auf eine Beteiligung von oxidativem Stress an der Promotoraktivierung schließen lässt. Konstruierte Promotoren wurden auch in Tumoren aktiviert, die in Mäusen gezüchtet wurden. Außerdem nahm die Zelltötung mit dem fcy::fur-Gen (ein Suizidgen, das 5-Fluorocytosin in hochgiftiges 5-Fluorouracil umwandelt) dosisabhängig mit 5-Fluorocytosin nur nach Röntgenbestrahlung in vitro zu. Diese Ergebnisse legen nahe, dass durch dieses Verfahren erhaltene Promotoren für mögliche klinische Anwendungen verwendet werden könnten.


Genom-Engineering

Obwohl die Überexpression oder Deaktivierung eines Gens viel über seine Funktion aussagen und/oder die Zellaktivität auf eine aus angewandter Sicht interessante Weise verändern kann, ist es manchmal am besten, Gene aus dem Bakteriengenom selbst zu löschen oder neue Gene und Mutationen einzuführen. Die direkte Manipulation des Genoms kann Ihnen eine subtilere Kontrolle über die Proteinexpression und -aktivität geben, wodurch der Einsatz zellulärer Ressourcen, die für die Produktion großer Proteinmengen oder Plasmide mit hoher Kopienzahl erforderlich sind, eingeschränkt wird. Unabhängig davon, ob Sie die grundlegende Biologie eines bakteriellen Gens untersuchen oder Stoffwechselwege umleiten, um eine therapeutische Verbindung herzustellen, es gibt viele verschiedene Möglichkeiten, Bakteriengenome zu verändern. Von Rekombination bis CRISPR enthält diese Sammlung eine Vielzahl von Werkzeugen, die Ihnen helfen, bakterielle Genome für Ihre Forschung zu nutzen.

Plasmid ICH WÜRDE Technik PI Zweck
pCas9 42876 CRISPR Luciano Marraffini Bakterielle Expression von Cas9-Nuklease-gRNA. Eine umfassendere Liste unserer bakteriellen CRISPR-Plasmide finden Sie hier.
pwtCas9-Bakterien 44250 CRISPR Stanley Qi Anhydrotetracyclin-induzierbare Expression von Wildtyp-Cas9 aus S. pyogenes zum Induzieren von Doppelstrangbrüchen. Eine umfassendere Liste unserer bakteriellen CRISPR-Plasmide finden Sie hier.
pgRNA-Bakterien 44251 CRISPR Stanley Qi Expression von anpassbarer Leit-RNA (gRNA) für bakterielle Genunterbrechung oder Knockdown. Eine umfassendere Liste unserer bakteriellen CRISPR-Plasmide finden Sie hier.
pGRG-Serie Verschiedene Plasmide Tn7 Transposition Nancy Craig Ein in eines dieser Plasmide kloniertes interessierendes Gen kann in die attTn7-Anheftungsstelle transponiert werden, die in vielen enterobakteriellen Genomen gefunden wird. Die interessierenden Bakterien werden mit dem geeigneten Konstrukt transformiert, bei der permissiven Temperatur (32 °C) gezüchtet, um eine Transposition zu ermöglichen, und das Konstrukt wird dann durch Züchten bei der nicht permissiven Temperatur (42 °C) gehärtet. Die Transposition ist effizient genug, dass eine Auswahl nicht erforderlich ist.
pET-HIS-Sangamo 40786 TALEN Gang Bao Gateway-Klonierung und Expression eines N-terminal His-markierten TALEN, fusioniert mit an E coli Codon-optimierte FokI-Endonukleasedomäne.
pET-Sangamo-His 40787 TALEN Gang Bao Gateway-Klonierung und Expression eines C-terminal His-markierten TALEN, fusioniert mit an E coli Codon-optimierte FokI-Endonukleasedomäne.

Messung der Luciferase-Expression mit dem SpectraMax Glo Steady-Luc Reporter Assay Kit

Die Verwendung von Genreportern wie Luciferase ermöglicht eine hochempfindliche und zerstörungsfreie Überwachung der Genexpression. Glühwürmchen-Luciferase, ein monomeres Protein mit 61 kD, ist für viele Forscher wegen seiner hohen Empfindlichkeit, seines breiten linearen Nachweisbereichs und des extrem niedrigen Hintergrunds aufgrund des Fehlens endogener Lumineszenzaktivität in Säugerzellen besonders attraktiv. Für den immer beliebter werdenden Assay mit Lumineszenz-Mikroplatten-Readern wird der mit dem Hochdurchsatz kompatible „Glow“-Assay häufig für die Stapelverarbeitung mehrerer Platten bevorzugt. In dieser Application Note demonstrieren wir die Messung der Luciferase-Expression in CHO-K1-Zellen mit dem SpectraMax ® Glo Steady-Luc™ Reporter Assay Kit, das lang anhaltende Lumineszenzsignale liefert. Dieses Assay-Kit ist für den SpectraMax ® i3x Multimode-Mikroplatten-Reader mit einem vorkonfigurierten Protokoll in der SoftMax ® Pro-Software für eine schnelle Datenanalyse optimiert.

Materialien

  • SpectraMax Glo Steady-Luc Reporter Assay-Kit, Molekulare Geräte (Explorer-Kit #R8352 oder Bulk-Kit #R8353)
  • Mitbewerber-Kit: Steady-Glo-Luciferase-Assay-System, Promega (Kat.-Nr. E2510)
  • SpectraMax i3x Mikroplatten-Reader, Molekulare Geräte (Kat.# i3X)
  • 96-Well-Platten mit weißen Wänden, klarem Boden, Costar (Kat.-Nr. 3903)
  • Gereinigte Luciferase, Promega (Kat# E1701)
  • 384-Well feste weiße Platten, Greiner (Kat.-Nr. 655075)
  • CHO-K1-Zellen, ATCC (Cat# CCL-61)
  • Komplette Wachstumsmedien
    • Hams F12 Medium, Life Technologies (Kat.-Nr. 11765-54)
    • Fötales Rinderserum, Zwillinge (Kat.-Nr. 100-106)
    • Penicillin/Streptomycin, Life Technologies (Kat.-Nr. 15070-063)

    Methoden

    Der SpectraMax Glo Steady-Luc Reporter Assay verfügt über einen vereinfachten Arbeitsablauf. Die Arbeitslösung wird im Verhältnis 1:1 mit dem Medium in jeder Vertiefung der Mikrotiterplatte gemischt, wo Luciferase-exprimierende Zellen ausplattiert werden. Die Platte wird dann abgedeckt und gemischt, um eine vollständige Zelllyse zu ermöglichen, bevor die Lumineszenzsignale auf dem SpectraMax i3x Multimode Microplate Reader gelesen werden (Abbildung 1). Die Datenerfassung und -analyse wird durch die Verwendung des vorkonfigurierten Protokolls in der Softmax Pro Software einfach optimiert.

    Abbildung 1. Arbeitsablauf des SpectraMax Glo Steady-Luc Reporter Assay Kits.

    Luciferase-Standardkurve

    Um den linearen Nachweisbereich dieses Assays zu identifizieren, wurde eine Standardkurve erstellt, um die RLU als Funktion der Luciferasekonzentration zu messen. Alle Komponenten des SpectraMax Glo Steady-Luc Reporter Assay Kits wurden zuerst auf Raumtemperatur äquilibrieren gelassen. Die SpectraMax Glo Steady-Luc Arbeitslösung wurde durch Zugabe von D-Luciferin zum Steady-Luc Assay-Puffer in einem Verhältnis von 1 mg zu 4 ml hergestellt. Eine zehnfache Reihenverdünnung von gereinigter Luciferase in PBS mit 0,01% BSA, beginnend mit einer Konzentration von 1 × 10 6 fg/Vertiefung, wurde hergestellt, und 25 μl jeder Konzentration wurden in dreifacher Ausfertigung auf eine feste weiße Platte mit 384 Vertiefungen gegeben. Anschließend wurden 25 µl SpectraMax Glo Steady-Luc Arbeitslösung in die Vertiefungen mit Luciferase und Kontrollen gegeben. Die Platte wurde geschüttelt und 10 Minuten im Dunkeln inkubiert. Unter Verwendung des SpectraMax i3x-Readers wurde das vorkonfigurierte SpectraMax Glo Steady-Luc Reporter-Assayprotokoll in der SoftMax Pro Software zur Lumineszenzmessung verwendet. Nach der Erkennung erstellt das Protokoll automatisch eine Kurve der Daten.

    Transfektions- und Zellverdünnungsassay

    Ein Teil der Assay-Entwicklung für einen Reportergen-Assay besteht darin, die Zellzahl und die Plasmidmenge zu optimieren, die notwendig sind, um ein robustes Signal für das Screening zu liefern. Ein Zellverdünnungsassay wurde mit zwei unterschiedlichen Mengen von pGL4.13-Glühwürmchen-Luciferase ausgehend von 6-Well-Platten durchgeführt. CHO-K1-Zellen wurden vorübergehend mit 1,7 μg oder 0,8 μg pro Vertiefung des Vektors pGL4.13[luc2/SV40] transfiziert, der das Luciferase-Gen luc2 unter der Kontrolle des frühen SV40-Enhancers/-Promotors oder pGL3-Basic (Kontrolle) kodiert , denen Promotor- und Enhancer-Sequenzen fehlten. Nach 24 Stunden wurden die Zellen trypsiniert und mit 100 &mgr;l/Well in eine 96-Well-Platte, beginnend bei 30.000 Zellen/Well mit anschließenden 2-fachen Verdünnungen, ausgesät. 100 µl/Well Steady-Luc-Arbeitslösung wurde in die Wells gegeben. Die Platte wurde abgedeckt, um die Reagenzien vor Licht zu schützen, und unter Verwendung eines Orbitalschüttlers gemischt. Nach 10 Minuten wurde die Lumineszenz gemessen und auf dem SpectraMax i3x-Lesegerät unter Verwendung des vorkonfigurierten SpectraMax Glo Steady-Luc Reporter-Testprotokolls aufgezeichnet. Das vorkonfigurierte Protokoll finden Sie im Abschnitt Reporter Assays unter der Registerkarte Protocol Library oder auf der Protokollfreigabe-Website der SoftMax Pro Software (www.softmaxpro.org).

    Screening-Anwendungen

    Ein Reportergen-Assay-Screen wurde simuliert, indem mehrere Ablesungen einer Platte mit pGl4-Glühwürmchen-Luciferase-transfizierten Zellen unter Verwendung des SpectraMax Glo Steady-Luc Reporter-Assay-Kits durchgeführt wurden. Die Zellen wurden wie zuvor beschrieben transfiziert und mit 30.000 Zellen pro Vertiefung in einer 96-Well-Platte ausplattiert und über Nacht gezüchtet. Am Tag des Assays wurde die Platte auf Raumtemperatur äquilibriert, und dann wurden 100 μl rekonstituierte Steady-Luc-Arbeitslösung, die D-Luciferin enthielt, in jede Vertiefung gegeben. Die Platte wurde abgedeckt und auf einem Orbitalschüttler für fünf Minuten gemischt und dann in einen SpectraMax i3x-Reader gegeben und gemischt. Die Lumineszenz wurde alle fünf Minuten für insgesamt fünf Stunden mit drei Sekunden orbitalem Schütteln vor jedem Ablesen gemessen.

    Ergebnisse

    Luciferase-Standardkurve

    Zum Vergleich wurde die Standardkurve zur Ermittlung des Nachweisbereichs des Assays auch mit einem Glow-Luciferase-Assay eines Mitbewerbers durchgeführt. In beiden Fällen identifizierten die Assays eine lineare Beziehung zwischen Lumineszenz und Luciferasekonzentration (Abbildung 2). Das R2 die Luciferase-Werte betrugen 0,998 bei Verwendung des SpectraMax Glo Steady-Luc Reporter Assay Kits und 0,999 bei Verwendung des Konkurrenz-Assay-Kits. Ein gepaarter t-Test von normalisierten Daten zeigt äquivalente Ergebnisse bei jeder Konzentration an (P < 0,05). Die Berechnungen wurden mit GraphPad Prism durchgeführt. Unter Verwendung beider Kits betrug die untere Nachweisgrenze (LLD) von Luciferase 5 Femtogramm/Well im 384-Well-Format.

    Abbildung 2. Luciferase-Standardkurve im 384-Well-Format. Lineare Ergebnisse aus einer 10-fachen Verdünnung von gereinigter Luciferase im SpectraMax Glo Steady-Luc Reporter Assay (Grün) (R2 = 0,999) oder ein Kompetitor-Assay (Rot) (R 2 = 0,998). In beiden Assays ist die LLD = 5 Femtogramm/Vertiefung.

    Messung von Luciferase in transfizierten Zellen

    Die Titration von vorübergehend mit Luciferase transfizierten CHO-K1-Zellen, beginnend bei 30.000 Zellen/Vertiefung, wurde in die Vertiefungen pipettiert, gefolgt von Steady-Luc Reporter-Arbeitslösung. Wie in Abbildung 3 gezeigt, zeigten sowohl der SpectraMax Glo Steady-Luc Reporter Assay als auch der Konkurrenz-Glow-Luciferase-Assay eine lineare Beziehung zwischen Zellzahl und Lumineszenz. Für Zellen, die 0,8 μg Luciferase-Vektor pGL4.13 erhielten, R 2 = 0,995 unter Verwendung des SpectraMax Glo Steady-Luc Reporter-Assay-Kits und R 2 > 0,999 unter Verwendung des Konkurrenz-Assay-Kits. Beide Kits wiesen die niedrigste Verdünnung der im Assay getesteten Zellen nach, 468 Zellen/Vertiefung.

    Abbildung 3. Messung von Luciferase in transfizierten Zellen. 90% konfluente CHO-K1-Zellen wurden entweder mit 1,7 &mgr;g pGL4 (Firefly) (Rot), 0,8 pGL4 (Firefly) (Grün) oder pGL3 (Kontrolle) Luciferase-Plasmiden (Blau) transfiziert. (EIN) SpectraMax Glo Steady-Luc Reporter Assay (R 2 >0,995 bei 0,8 μg Plasmid) und (B) Konkurrenztest (R2 = 0,999 bei 0,8 µg Plasmid). Beide Kits erkannten die niedrigste Anzahl von Zellen/Well im Assay (468 Zellen/Well).

    Screening-Anwendungen

    Der SpectraMax Glo Steady-Luc Reporter Assay ist ein Lumineszenzassay auf Glutbasis, der ein erweitertes Signalzeitfenster bietet (Abbildung 4). Eine Platte mit Luciferase-exprimierenden CHO-K1-Zellen mit 30.000 Zellen/Vertiefung wird alle fünf Minuten abgelesen, um die Stapelverarbeitung von Screening-Platten zu simulieren. Nach fünf Stunden liegt das Signal innerhalb von 20 % des Anfangswertes. Auf jeder einzelnen Platte in einem Reporter-Assay-Screen ist eine Kontrolle zur Normalisierung der Daten auf den Hintergrund enthalten, so dass die Daten über viele Platten hinweg verglichen werden können. Wie in Abbildung 5 gezeigt, bleibt das Signal über 20 Platten innerhalb von 15 %, was darauf hindeutet, dass mit diesem Assay 20 Platten in einem Zeitraum von 90 Minuten durchgeführt werden können.

    Abbildung 4. Luciferase-Signal in CHO-K1-Zellen im Zeitverlauf. CHO-K1-Zellen wurden mit Luciferase transfiziert. Am Tag des Assays wurde die Platte auf Raumtemperatur äquilibriert, und dann wurden 100 &mgr;l rekonstituierte Steady-Luc-Arbeitslösung, die D-Luciferin enthielt, in jede Vertiefung gegeben. Die Platte wurde abgedeckt und auf einem Orbitalschüttler für fünf Minuten gemischt und dann in einen SpectraMax i3x-Reader gegeben und gemischt. Die Lumineszenz wurde alle fünf Minuten fünf Stunden lang mit drei Sekunden orbitalem Schütteln vor jedem Ablesen gemessen.

    Abbildung 5. Screening-Anwendungen. Rohdaten von Luciferase-transfizierten CHO-K1-Zellen im SpectraMax Glo Steady-Luc Assay. Das durchschnittliche Signal der Luciferase-transfizierten Zellen ist als Beispiel für die Stapelverarbeitung während eines Screening-Assays aufgetragen, bei dem alle fünf Minuten eine Platte gelesen wird. Auf Screening-Platten werden Hintergrundkontrollen verwendet, um die Daten zu normalisieren, sodass Vergleiche über viele Platten hinweg verglichen werden können.

    Abschluss

    Luciferase-basierte Reporter-Assays mit Lumineszenz-Mikroplatten-Readern werden immer beliebter für Hochdurchsatzanalysen in der chemischen Biologie und in der Wirkstoffforschung. Das SpectraMax Glo Steady-Luc Reporter Assay-Kit ermöglicht eine sensitive Quantifizierung der Glühwürmchen-Luciferase-Expression in Säugerzellen. Durch die Anwendung eines homogenen experimentellen Protokolls verlängert das speziell formulierte Substanzgemisch in diesem Kit das Zeitfenster mit stetigem Signal erheblich und ermöglicht so die Stapelverarbeitung von Platten in Screening-Assays. Dieses Assay-Kit ist für SpectraMax-Mikroplatten-Reader von Molecular Devices optimiert, mit einem vorkonfigurierten Protokoll für Kunden, die die SoftMax Pro-Software von Molecular Devices für ihre Datenerfassung und -analyse verwenden.


    Reportergenvektoren

    Vektoren sind Plasmide, extrachromosomale Elemente, die Reportergensequenzen zur Abgabe in kultivierte Zellen tragen. Vektoren stellen nicht nur das Reportergen bereit, sondern können auch mehrere Klonierungsstellen, Promotoren, Response-Elemente, Polyadenylierungssequenzen, Säuger-selektierbare Marker oder andere Sequenzelemente aufweisen, die bei der Expression und Selektion helfen. Reportervektoren sind entscheidend für den Erfolg in Reporterassays.

    PGL4-Luciferase-Reporter-Vektoren, die Firefly und . kodieren Renilla Luziferase

    Da Vektoren verwendet werden, um das Reportergen an Wirtszellen zu liefern, können regulatorische Sequenzen wie Transkriptionsfaktor-Bindungsstellen und Promotormodule innerhalb des Vektorrückgrats zu starkem Hintergrund und anomalen Reaktionen führen. Dies ist ein häufiges Problem bei Säugetier-Reportervektoren, einschließlich der pGL3-Luciferase-Reportervektoren. Unsere Wissenschaftler wandten die für Reportergene beschriebene erfolgreiche "Cleaning"-Strategie auf das gesamte pGL3-Vektor-Rückgrat an und entfernten kryptische regulatorische Sequenzen wo immer möglich, während die Reporter-Funktionalität erhalten blieb. Darüber hinaus wurde die multiple Klonierungsregion mit einer einzigartigen SfiI-Schnittstelle für den einfachen Transfer des interessierenden DNA-Elements neu gestaltet, der f1-Replikationsursprung entfernt und ein Intron deletiert. Darüber hinaus wurde eine synthetische Poly(A)-Signal-/Transkriptionspausenstelle entweder der multiplen Klonierungsregion (in promotorlosen Vektoren) oder dem HSV-TK-, CMV- oder SV40-Promotor (in promotorhaltigen Vektoren) stromaufwärts platziert. Diese umfangreichen Bemühungen führten zum völlig neu gestalteten und einzigartigen Vektorrückgrat der pGL4-Vektoren. Es gibt auch eine Reihe von pGL4-Vektoren mit partiellen Deletionen des CMV-Promotors zur nuancierten Verwendung des starken Promotors.

    Die Luciferase-Vektoren der pGL4-Familie enthalten eine Vielzahl von Funktionen, wie z Renilla Luciferase-Gene, Rapid Response™-Versionen für eine verbesserte zeitliche Reaktion, Säuger-selektierbare Marker, Basisvektoren ohne Promotoren, Promotor-enthaltende Kontrollvektoren und vorgefertigte Vektoren mit Ihrer Wahl aus mehreren Reaktionselementen (Abbildung 6).

    Abbildung 6. Die Familie der pGL4-Luciferase-Reportervektoren umfasst eine Vielzahl zusätzlicher Merkmale, wie eine Auswahl an Luciferase-Genen, Rapid Response&Trade-Versionen, eine Vielzahl von Säugetier-selektierbaren Markern und Vektoren mit oder ohne Promotoren und Response-Elementen.

    PNL-Vektoren, die NanoLuc® Luciferase kodieren

    NanoLuc®-Luciferase ist in einer Vielzahl von Vektoren zur Verwendung in Reportergen-Assays der Transkriptionskontrolle erhältlich. Diese pNL-Vektoren basieren auf dem pGL4-Vektorrückgrat und bieten somit viele der gleichen Vorteile: Entfernung von Transkriptionsfaktor-Bindungsstellen und anderen potentiellen regulatorischen Elementen, um das Risiko anomaler Ergebnisse zu reduzieren, einfacher Sequenztransfer von bestehenden Plasmiden und eine Auswahl von mehreren Promotorsequenzen, einschließlich No-Promotor, Minimalpromotor und viraler Promotoren. Die Vektorfamilie bietet eine Auswahl an NanoLuc®-Genen (unfusioniert Nluc, PEST-destabilisiert NlucP und abgesondert secNluc). Diese NanoLuc®-Genvariationen sind codon-optimiert und es wurden viele potenzielle regulatorische Elemente oder andere unerwünschte Merkmale, wie z. B. übliche Restriktionsenzymstellen, entfernt.

    Darüber hinaus gibt es Koinzidenz-Reportervektoren, die sowohl NanoLuc®- als auch Glühwürmchen-Luciferasen auf einem einzigen Transkript kodieren. Diese Vektoren werden ohne Promotor, einen Minimalpromotor oder CMV-Promotor zur Verwendung beim Hochdurchsatz-Screening geliefert. Untersuchen Sie die Rate des Proteinumsatzes von zwei wichtigen Signalproteinen, die an der Reaktion auf zellulären Stress beteiligt sind, unter Verwendung von Reportervektoren.

    Reporter-Vektoren

    Unser umfangreiches Sortiment an hochmodernen biolumineszenten Reportervektoren umfasst die pGL4-Vektoren —die neueste Generation von Glühwürmchen und Renilla Luciferase-Reportervektoren und die pNL-Vektoren, die das NanoLuc®-Luciferase-Reportergen enthalten.


    Abstrakt

    Wiederholte Anfälle von Ischämie im Herzen führen zu Fibrose und schließlich zu Herzversagen. Obwohl bestimmte Gene wie SOD oder Hämoxygenase und Antisense zu AT1R, ACE und (β1-AR kann das Herz kurzfristig vor Ischämie schützen, es gibt keinen bekannten Mechanismus, um konstant auf wiederholte Ischämievorfälle zu reagieren. Wir stellten die Hypothese auf, dass ein „wachsamer Vektor“, der speziell im Herzen exprimiert wird und nur während einer Hypoxie therapeutische Gene einschaltet, Kardioprotektion bieten würde. Um eine kardiale Spezifität zu erreichen, haben wir einen MLC2v-Promotor in ein adeno-assoziiertes Virus (AAV) eingefügt, das entwickelt wurde, um AS an AT . zu liefern1R und gfp. In In-vitro-Experimenten in Kardiomyozyten (H9C2-Zellen) trieb das MLC2v-AAV-gfp die Genexpression in allen Zellen auf Niveaus an, die mit einem Cytomegalovirus (CMV)-Promotor vergleichbar sind. In In-vivo-Experimenten wurde rAAV-MLC2v-gfp Mäusen oder Ratten intravenös injiziert. Grünes Fluoreszenzprotein (GFP) DNA wurde in Niere, Herz (rechter und linker Ventrikel), Lunge, Nebenniere und Milz lokalisiert. GFP-mRNA wurde jedoch nur im Herzen exprimiert und fehlte in anderen Geweben. Um das rAAV-Transgen während einer Ischämie einzuschalten, haben wir ein Hypoxie-Response-Element (HRE) eingefügt. Dadurch wird die Transkription hochreguliert, wenn O2 Niveaus sind niedrig. So gibt es 4 Komponenten zum wachsamen Vektor einen Genschalter (HRE), einen herzspezifischen Promotor (MLC2v), ein therapeutisches Gen (AS-AT1R) und ein Reportergen (gfp). Um das Basisniveau der Expression unter Beibehaltung der Spezifität zum Schweigen zu bringen oder zu senken, haben wir die Länge des MLC2v-Promotors von 3 kb auf 1775 bp oder 281 bp reduziert. Der verkürzte Promotor ist bei der herzspezifischen Expression gleichermaßen wirksam. Vorläufige Studien mit dem rAAV-HRE-gfp in vitro zeigen eine erhöhte Expression in 1% O2 in 4 bis 6 Stunden. Durch Zugabe von zusätzlichem Hypoxie-induzierbaren Faktor (HIFα) (5 µg) wird die MLC2v-gfp-Expression in 1% O . um das 4-fache gesteigert2. Weitere Amplifikation des Gens auf das 400-fache in 1% O2 kann mit einem Doppelplasmid erreicht werden. Das Konstrukt könnte als prototypischer „wachsamer Vektor“ dienen, um therapeutische Gene in bestimmten Geweben mit physiologischen Signalen anzuschalten.

    Das menschliche Herz kann wiederholten Anfällen von Hypoxie ausgesetzt sein, die zu einer stillen oder offensichtlichen Schädigung des Myokardgewebes führen. 1 Kumulativ kann dies zu Herzversagen führen. Um dies gentherapeutisch zu bekämpfen, schlagen wir vor, einen bis zum Einschalten durch Hypoxie inaktiven „wachsamen Vektor“ zu entwickeln, der das Herz bei Ischämie mit therapeutischen Genen schützen soll. Dieses Konzept erfordert die Entwicklung eines stabilen Vektors, der 4 Elemente enthält (Abbildung 1): (1) ein sicherer Vektor, der durch systemische Injektion das Herz erreichen und eine stabile Expression des Gens im Herzen zeigen könnte (2) ein therapeutisches Gen für Kardioprotektion gegen Ischämie (3) ein gewebespezifischer Promotor, der das Transgen dazu bringt, mRNA nur im Herzen zu exprimieren, und (4) ein Genschalter, der den gewebespezifischen Promotor als Reaktion auf Hypoxie ein- und als Reaktion auf Normoxie.

    Abbildung 1. Allgemeines Design für einen „wachsamen Vektor“, der zum ständigen Schutz gegen Herzischämie, Diabetes Typ 1, Schlaganfall, Herzinfarkt, Krebs oder sogar Bioterrorismus eingesetzt werden könnte. Die Hauptelemente sind (1) ein sicherer, stabiler Vektor (2) ein Genschalter (3) ein gewebespezifischer Promotor und (4) therapeutische Gene (mit einem Reportergen zur Überwachung seiner Aktivität).

    Für den Vektor erweist sich das adeno-assoziierte Virus (AAV) als stabiler, nicht pathologischer Vektor. 2,3 Es gibt mehrere Gene, die für den Schutz des Herzens während einer Ischämie in Betracht gezogen werden könnten. In einer früheren Studie 4 hatten wir festgestellt, dass der Angiotensin-II-Typ-1-Rezeptor (AT1-R) Antisense (AS) schützte Rattenherzen vor Ischämie-Reperfusion. Dzau et al. 5 haben kürzlich gezeigt, dass transgene Mäuse mit Hämoxygenase vor kardialer Ischämie geschützt sind. Superoxiddismutase schützt vor Superoxidradikalen, die während einer Ischämie oder Reperfusion erzeugt werden. 6 Somit sind diese Gene eine gute Wahl für kardioprotektive Transgene im Vektor. Für die gewebespezifische Expression von AAV im Herzen haben wir die ventrikuläre Form der leichten Myosinkette (MLC-2v) untersucht. 7,8 Die MLC-2v-Expression ist wichtig für die Entwicklung des Herzens während der Embryogenese, und Veränderungen der MLC-2v-Expression führen zu Herzfehlern. 8 Beim Menschen ist die Kardiomyopathie mit Punktmutationen in MLC-2v assoziiert. 9 MLC-2v scheint hochspezifisch für das Herz zu sein, sowohl während der Embryonalentwicklung als auch in der postnatalen Entwicklung und Reife. Der MLC-2v-Promotor ist 3,0 kb groß, aber die Sequenzen, die ihm die Eigenschaft der Herzspezifität verleihen, liegen innerhalb von 250 bp, nahe der TATA-Box. 8,9–13 Wir testeten die Spezifität eines 1700 kb und eines 281 bp MLC-2v-Promotors in AAV, das in vitro und in vivo verabreicht wurde. Um den Vektor anzuschalten, testeten wir ein Hypoxie-Regulatorisches Element (HRE), das durch Transaktivierung des Hypoxie-induzierbaren Faktors (HIF-1) als Reaktion auf eine Sauerstoffreduktion aktiviert wird. 14,15 Unter normoxischen Bedingungen ist die HIF-1α-Untereinheit nicht nachweisbar, da sie durch Proteosomen abgebaut wird. 18 Obwohl wir nicht alle Komponenten eines vigilanten Vektors fertiggestellt und getestet haben, präsentieren wir die Ergebnisse einer Studie zur Herzspezifität von MLC-2v und seiner Interaktion mit HRE und HIF-1α.

    Methoden

    Konstruktion von Plasmid und rekombinantem AAV

    Der lineare, einzelsträngige, von AAV abgeleitete Vektor kann für mehrere Gene und Promotoren zwischen den invertierten terminalen Wiederholungen (ITRs) an jedem Ende angepasst werden (Abbildung 1). Wir fügten ein Reportergen, ein grün fluoreszierendes Protein (GFP) und einen 1,7 kb MLC-2v-Promotor der Ratte (pMLC-2v-GFP) ein. Verfahren zur Herstellung von rekombinantem AAV (rAAV) wurden zuvor beschrieben. 19 Das pMLC-2v-GFP wurde in AAV-2 (rAAV-MLC-2v-GFP) verpackt.

    Ein 281 bp (–264 bis +17, Genbank: U26708) Fragment des MLC-2v-Promotors wurde durch eine Polymerase-Kettenreaktion (PCR) aus pMLC-2v-GFP amplifiziert, wobei das Primerpaar mit 5′ XhoI- oder 3′ HindIII-Stellen designed entworfen wurde an den Enden. Das MLC-2v-Fragment wurde durch XhoI und HindIII verdaut und mit XhoI/HindIII-verdautem Plasmidgen Luciferase (pGL)-SV40 (Promega) ligiert, um pGL-MLC zu erzeugen.

    Basierend auf Semenza et al. wurde 14 eine 68bp humane Enolase (ENO) 1 HRE-Sequenz (-416 bis -349, Genebank: X16287) in die 5'-Flanke des MLC-2v-Promotors in pGL-MLC inseriert, um pGL-HRE . zu erzeugen /MLC.

    pCEP4/HIF-1α, das eine humane HIF-1α-cDNA-Sequenz stromabwärts eines Cytomegalovirus-Promotors enthält, war ein freundliches Geschenk von Dr. Semenza (Johns Hopkins University).

    In-vitro-Transfektion

    Die embryonale Herzmyoblastenzelllinie der Ratte, 20 H9c2 (ATCC: CRL1446), oder Gliomzellen C6 (ATCC: CCL-107) wurden in DMEM, ergänzt mit Natriumpyruvat, 10 % fötalem Rinderserum (FBS) oder 5 % FBS in an Inkubator (Quene Systems, Inc) mit einer befeuchteten Atmosphäre von 5 % CO2 und 95 % Luft bei 37 °C. Hypoxiebedingungen wurden unter Verwendung von Hypoxiekammern (Sauerstoffsensoren) durch Evakuieren und Begasen mit 1% O . erreicht2/5% CO2/94 % N2 wiederholt, die Kammern dicht verschließen und dann bei 37 °C inkubieren.

    Um die MLC-2v-Promotorspezifität in Zellen zu untersuchen, wurden sowohl H9c2- als auch C6-Zellen mit pGL-MLC (1 μg/Well) und dem internen Kontrollplasmid pRL-TK (50 ng/Well, Promega) unter Verwendung von Lipofectamin (Invitrogen) in . transfiziert 6-Well-Platten. 24 Stunden nach der Transfektion wurden Zelllysate hergestellt. Luciferase-Assays wurden mit dem dualen Luciferase-Assay-System (Promega) durchgeführt und mit einem Monolight 3010 Luminometer (Pharmingen) quantifiziert. Die Ergebnisse werden als Verhältnis der Glühwürmchen-Luciferase-Aktivität zu Renilla Luciferase-Aktivität.

    Für Co-Transfektionsexperimente mit pCEP4/HIF-1α wurde H9c2 mit 2 µg/Well pGL-HRE/MLC, 100 ng/Well Kontrollplasmid pRL-TK, verschiedenen Mengen pCEP4/HIF-1alpha und leerem Vektor transfiziert, so dass alle Zellen erhielten insgesamt 6 µg Plasmid in 60 mm Schalen. 24 Stunden nach der Transfektion wurde das Medium gewechselt und Duplikatplatten wurden bei 1% oder 20% O . inkubiert2 24 Stunden vor der Lysatzubereitung.

    Expression von AAV in Vivo

    Alle Tiere wurden in einem temperaturkontrollierten Raum in einem 12-Stunden-Tag/Nacht-Zyklus mit freiem Zugang zu Futter und Wasser gehalten. Das Institutional Animal Care and Use Committee der University of Florida genehmigte alle experimentellen Verfahren.

    AAV-Expression bei erwachsenen Tieren

    Erwachsene männliche BALB/c-Mäuse (n = 6) wurden von Harlan (Indianapolis, Ind) erhalten und mit Pentobarbital (80 mg/kg) anästhesiert. 10 10 infektiöse Partikel von rAAV-MLC-2v-GFP (100 μL) wurden intravenös injiziert. Nach 2 bis 8 Wochen wurden die Tiere mit Pentobarbital (120 mg/kg) tief anästhesiert. Proben von Milz, Leber, Lunge, Niere, linkem Ventrikel, Hoden und Gehirn wurden seziert und auf Trockeneis eingefroren.

    AAV-Expression bei Jungtieren

    Fünf Tage alte männliche Sprague-Dawley-Ratten (n=3) wurden in Begleitung ihrer Mutter von Harlan bezogen. Sie wurden bis zum Alter von 21 Tagen bei ihrer Mutter gehalten. Im Alter von 6 Tagen wurden die Welpen mit Metofane anästhesiert, das intrakardial mit 10 10 infektiösen Partikeln von rAAV-MLC-2v-GFP (25 &mgr;l) oder dem gleichen Volumen Kochsalzlösung als Kontrolle injiziert wurde. Vier Wochen später wurden die Ratten mit Ketamin, Xylazin und Acepromazin (30, 6 bzw. 1 mg/kg subkutan) tief betäubt und mit eiskalter Kochsalzlösung über den linken Ventrikel perfundiert. Proben von Milz, Leber, Lunge, Niere, linkem Ventrikel, Hoden, Herz und Gehirn wurden seziert und auf Trockeneis für DNA-, RNA- und GFP-Proteinmessungen eingefroren.

    Nachweis von GFP

    Gesamt-RNA und DNA wurden unter Verwendung von TRIZOL-Reagenz isoliert. Die Expression von grün fluoreszierendem Protein (GFP) wurde durch Nested-PCR analysiert. Die bei der ersten Amplifikation verwendeten GFP-spezifischen Primer waren 5'-CAGCGGAGAGGGTGAAGGTG-3' (Sense) und 5'-CAGGGCAGACTGGGTGGACA-3' (Antisense). Die bei der zweiten Amplifikation verwendeten GFP-spezifischen Primer waren 5'-GCCA-CATACGGAAAGCTCAC-3' (Sense) und 5'-ATGGTTGTCTG-G GAGGAGCA-3' (Antisense).

    RT-PCR

    20 µg Gesamt-RNA wurden durch DNase I in einem 40 µl Reaktionsgemisch bestehend aus 40 U DNase I und 33 U RNase-Inhibitor verdaut. Die reverse Transkription (RT) und die erste Amplifikation wurden in einem einzigen Röhrchen durchgeführt. 4 µl der mit DNase I vorbehandelten RNA (2 µmg) wurden zu 20 µml Endvolumen der PCR-Reaktion gegeben. Die erste Amplifikation wurde unter folgenden Bedingungen durchgeführt: 60 Minuten bei 37 °C (RT) 4 Minuten bei 94 °C 35 Zyklen von 1 Minute bei 94 °C 1 Minute bei 58 °C (Annealing) 1 Minute bei 72 °C und eine letzte Verlängerungsperiode von 7 Minuten bei 72 °C in PE DNA Thermal Cycles 480. Ein ul Produkt aus der ersten Amplifikation wurde zu 25 ul Endvolumen der PCR-Reaktion gegeben. Die Bedingungen der zweiten Amplifikation waren die gleichen wie bei der ersten, mit Ausnahme der Zugabe von 30 Zyklen mit Annealing bei 60°C.

    PCR

    Ein µg DNA wurde durch Nested-PCR amplifiziert, um die GFP-Expression nachzuweisen. Die Verfahren waren beim GFP-Nachweis in RNA (RT-PCR) gleich, außer dass der DNase-I-Verdau und die reverse Transkription (RT) weggelassen wurden.

    Elektrophorese

    Amplifikationsprodukte wurden auf mit Ethidiumbromid gefärbter 1% Agarose analysiert. Die erwartete Produktgröße betrug 489 bp.

    Immunfluoreszenzfärbung

    Die Gewebe wurden über Nacht in Zamboni-Lösung inkubiert und bei einer Dicke von 20 µm kryoseziert. The sections were blocked with blocking buffer (10 mmol/L TBS, 1.5% normal goat serum and 1% BSA) for 1 hour and incubated in primary antibody (0.1% anti-GFP, rabbit IgG) overnight at 4°C. After washing with TBS, the sections were incubated with 0.5% anti-rabbit IgG FITC in the dark at room temperature for 1 hour. The sections were washed and put on slides. The slides were covered by slips with fluoromount G when dry. GFP was detected within 3 hours by confocal microscopy.

    Ergebnisse

    In Vitro

    The pGL-MLC was specifically expressed in cardiomyocytes. Figure 2 shows the luciferase activity of pGL-MLC-2v in cardiomyocytes (H9c2) and a lack of expression in a nonmyocardial cell line (C6). The relative luciferase activity ratio of H9c2 cells to C6 cells was 29.38±13.11. The uptake efficiency in both cell types was 90%.

    Figur 2. The expression of luciferase activity (relative to control) in cardiac (H9c2 cells) versus glioma (C6) cells after treatment with pGL-MLC. Myocardial cells specifically expressed the transgene. Cells were transfected with control pRL-TK (50 ng/well) and pGL-MLC (1 μg/well) plasmids. Duplicate plates were incubated at 20% O2 for 24 hours (mean±SD, n=3 independent experiments).

    In vivo

    PCR of DNA showed the transduction of rAAV-MLC-2v-GFP in many tissues at 4 weeks after a systemic injection. The tissue-specific expression of GFP under MLC-2v promoter was examined by RT-PCR of RNA in the adult mouse tissues and young rats (Figure 3). GFP DNA was detected in the spleen, liver, lung, kidney, and heart. However, GFP mRNA was detected only in the heart.

    Figur 3. Top, Expression of GFP DNA in various tissues of the young rat detected by PCR. Bottom, Expression of GFP mRNA in the same tissues, detected by RT-PCR. Analysis was made of DNA and RNA extracted from the tissues 4 weeks after a single systemic injection of rAAV-MLC-2v-GFP.

    Four weeks after intracardiac injection of rAAV-MLC-2v-GFP, the presence of GFP in various tissues of rats was further examined by immunofluorescence staining (Figure 4). The green epifluorescence of the protein was clearly apparent in the heart and absent in the control (no GFP). GFP was undetectable in the kidney and liver of the same animals and undetectable in controls.

    Figur 4. Expression of rAAV-MLC-2v-GFP was present in the heart, but absent in the liver and kidney at 4 weeks after transduction in young rat. Control: rAAV without GFP. The immunofluorescence staining with an antibody to green fluorescent protein reveals intense expression in heart only, which matches the expression of mRNA from the same animal in Figure 3.

    Hypoxia did not induce an increase in transgene expression of the pGL-HRE/MLC (Figure 5). However, hypoxia induces a 3 to 4-fold increase in transgene expression when the HRE-MLC-2v enhancer/promoter complex is in the presence of 0.5 to 4 μg of HIF-1α in H9c2 cells (Figure 5).

    Abbildung 5. Hypoxia induces a 3- to 4-fold increase in transgene expression when the HRE/MLC enhancer/promoter complex is in the presence of rHIF-1alpha. H9c2 cells were cotransfected with 2 μg/well pGL-HRE/MLC (281 bp) and 100 ng/well pRL-TK, in the absence of rHIF-1α or in the presence of various amount of rHIF-1α plasmid, respectively. Twenty-four hours after transfection, duplicates were exposed to 1% or 20% O2 for another 24 hours. The ratio of firefly luciferase/Renilla luciferase activity was normalized to the result obtained for cells transfected with pGL-HRE/MLC (281 bp) and exposed to 20% O2 (X-Fold). Expression at 1% relative to 20% O2 was calculated to determine the hypoxia induction ratio. (mean±SD, n=3 independent experiments).

    Diskussion

    The results demonstrate that the MLC-2v promoter incorporated into a rAAV vector can drive a reporter gene specifically in the heart. rAAV-MLC-2v-GFP was injected systemically, either through direct injection into the heart or via the jugular vein. Measurements of DNA showed that the vector was taken up into multiple tissues, including liver, lung, kidney, heart, and spleen. Although the rAAV-MLC-2v-GFP was taken up into many tissues after a single injection, the transgene (gfp) was only expressed in heart tissue. This was found in both mice and in rats. In two animals we found low-level expression in the liver but not in the kidney or other tissues. As AAV has limited loading capacity, we tested two truncated forms of MLC-2v. We used the 1700 bp length for the promoter in vivo and 250 bp in vitro to attempt to reduce basal levels without losing specificity. Both lengths contain the heart-specific cis regulatory elements 8 that endow the MLC-2v with its heart-specific responsiveness. 9,10 In glioma cells (C6) there was no expression of luciferase, although there was comparable uptake efficiency with or without the MLC-2v promoter.

    Attaching HRE to the MLC-2v with luciferase (Luc), as the transgene, did not alter basal expression in vitro at 20% O2. However, the HRE plus MLC-2v did not respond to 1% O2. With an HRE-SV40 promoter-Luc plasmid in heart cells, we have shown elsewhere that HRE will drive the promoter up to 7-fold under hypoxia within 4 to 6 hours. 21 We considered that the HRE/MLC-2v complex may have reduced the accessibility of the HIF-1α binding. To test this, we used an additional plasmid expressing the hypoxia inducible factor-1α (HIF-1α). 14–17 When we cotransfected a plasmid containing HIF-1α cDNA with pGL-HRE/MLC and exposed the cells to 1% oxygen we noted a 4-fold increase in Luc expression. Thus, the results indicate that MLC-2v can be used as a specific promoter for heart tissue, and HIF-1α plus HRE (but not HRE alone) will cause the MLC-2v to increase transgene expression in vitro by at least 4-fold in response to hypoxia. This is not a major limitation because dual vectors overcome the vector size limitation 22 and increase gene expression. 23 We are not yet satisfied that a 4-fold increase is sufficient to provide a cardioprotective effect with a therapeutic gene. A double plasmid approach that produces a powerful chimeric transcription factor consisting of the yeast transactivator factor GAL4 DNA binding domain and the p65 transactivation domain 24,25 is being tested. 21 Incorporating the HRE in this double plasmid system with SV40 promoter increased Luc gene expression by 400-fold when activated by hypoxia. 21

    The concept of a vigilant vector for cardioprotection can be applied generally to a number of other disease states. For example, in diabetes type 1, glucose would be the gene switch and insulin and its necessary enzymes would be the transgenes. The tissue specificity could be limited to the pancreas or to muscle. In cancer, tumor markers could be the gene switch, and the transgenes could be tumor suppressors. In heart attacks the switch would again be hypoxia or a protein marker and the transgene tPA. Similarly in stroke, hypoxia could be the switch and GFAP the tissue-specific promoter with hemoxygenase or superoxide dismutase or AT1-R-antisense as the therapeutic genes. For the vector, the rAAV seems to have the most desirable qualities of being safe and stable for a very long time. 2,3 Obviously each vigilant vector has to be designed and thoroughly tested, both in vivo and in vitro. Basal levels times of response, tissue specificity and amplification of signals are all challenges to be met. The present results represent promising new data for the development of a vigilant vector for long-term protection of cardiac performance during exposure to hypoxia.


    Tol2in frog

    Xenopus laevis has been a useful model animal in developmental biology. Vor kurzem, Xenopus tropicalis, a relative of X. laevis, is becoming an important model frog. It is amenable for use in genetic studies because of its unique features in comparison with X. laevis, specifically its diploid genome, smaller body size, and shorter generation time. Transgenic X. Tropicalis have been constructed based on the restriction enzyme-mediated integration technique, which requires careful treatments of eggs and sperm [24].

    To develop an alternative and simpler method for creating transgenic X. Tropicalis, the activity of the Tol2 transposon system was tested in Xenopus. First, both a Tol2 transposon-donor plasmid and the transposase mRNA were introduced into two-cell stage X. Tropicalis und X. laevis embryos by microinjection. The transposon construct was excised from the donor plasmid, indicating that the Tol2 transoposon system is active in these Xenopus spp. [25]. Second, a donor plasmid that harbored a Tol2 construct containing the GFP expression cassette was co-injected with the transposase mRNA into one-cell stage X. Tropicalis embryos, and GFP- positive F0 frogs (30% to 40% of the injected embryos) were raised to adulthood. GFP-positive F1 progeny were produced by 30% to 40% of such F0 adults, indicating that the Tol2 transposon system can be used for transgenesis in Xenopus (Figure 4) [26]. However, the germline transmission frequency is still lower than frequencies in zebrafish transgenesis, in which more than 50% of injected F0 fish constantly transmit transposon insertions to the F1 generation, even without pre-screening of the F0 injected fish for GFP positives. Therefore, in Xenopus improvement in transgenic frequency will be important in making the Tol2 transposon system a more powerful genetic tool.

    Transgenesis in Xenopus tropicalis. The synthetic transposase mRNA and a transposon donor plasmid containing a Tol2 construct with a ubiquitous promoter and the gene encoding green fluorescent protein (GFP) are co-injected into X. Tropicalis fertilized eggs. Die Tol2 construct is excised from the donor plasmid [25] and integrated into the genome. In the study conducted by Hamlet and coworkers [26], injected GFP-positive tadpoles were raised to adulthood. Tol2 insertions created in germ cells are transmitted to the F1 Generation. Germ cells of the injected frogs are mosaic, and, by crossing theinjected frog (founder) with wild-type frog, nontransgenic tadpoles and transgenic tadpoles heterozygous for the Tol2 insertion are obtained [26].


    PTK-GLuc Vector

    The pTK-GLuc Vector is a mammalian expression vector that encodes the secreted luciferase from the copepod Gaussia princeps as a reporter, under the control of the constitutive Herpes Simplex Virus thymidine kinase promoter. Gaussia Luciferase (GLuc) is a 20 kDa protein encoded by a "humanized" sequence, and it contains a native signal peptide at the N-terminus that allows it to be secreted from mammalian cells into the cell culture medium (1,2). pTK-GLuc has a multiple cloning site (MCS) between the GLuc stop codon and the polyadenylation site. A neomycin resistance gene under the control of an SV40 promoter allows selection for stable integration of the plasmid into the mammalian cell genome using G418. Figure 1: pTK-GLuc multiple cloning site (MCS)
    The Gaussia Luciferase sequence is shown with a blue background. Only unique restriction sites are shown.

    DNASU and Addgene are central repositories for plasmid clones and collections that may also be helpful.

    Höhepunkte

    • TK promoter: 18&ndash771
    • GLuc coding: 802&ndash1359
    • Start codon: 802&ndash804
    • Stop codon: 1357&ndash1359
    • Signal peptide: 802&ndash852
    • Multiple cloning site (MCS) downstream of GLuc: 1360&ndash1391 (NotI, AgeI, XhoI, XbaI)
    • SV40 late polyadenylation signal: 1392&ndash1622
    • Neo promoter (SV40): 2215&ndash2550
    • Neomycin resistance gene 2602&ndash3396
    • Neo R poly-A(SV40 early): 3570&ndash3700
    • Bacterial replication ori (pMB1) 4730&ndash4142
    • Amp resistance 5761&ndash4901

    Product Source

    Merkmale

    • Multiple samples can be obtained from the same transfected cells (i.e., before and after experimental treatments or at multiple time points).
    • 90&ndash95% of GLuc activity is found in the cell culture medium, with the remaining 5&ndash10% detectable in cell lysates. This allows flexibility when assaying GLuc along with other cotransfected reporters.
    • The activity of GLuc is high and the GLuc assay is sensitive enough to detect very small amounts of GLuc enzyme activity.
    • GLuc is very stable in the cell culture medium so the GLuc activity detected reflects the amount of GLuc secreted by the transfected cells over a period of several days. GLuc can also be stored at 4°C for several days without any loss in activity.
    • GLuc does not use the same substrate as Cypridina Luciferase. Therefore, it is possible to assay both GLuc and CLuc independently in cell culture medium from cells expressing both reporters (3,4).
    • The pTK-GLuc Vector can be transfected into cells using any standard transfection protocol and stable cell lines can be established using Neomycin (G418) selection.

    GLuc 3´ end Forward Primer (20-mer)
    GCCAGCAAGATCCAGGGCCA (1310&ndash1325)

    GLuc 5´ End Reverse Primer (24-mer)
    TCAGGGCAAACAGAACTTTGACTC (829&ndash806)

    Application Features

    • The pTK-GLuc Vector can be used as a control for assessing the efficiency of transfection in mammalian cells. Plasmids containing other constitutive promoter elements are also available (see Companion products Sold Separately).
    • pTK-GLuc Vector has a multiple cloning site (MCS) between the GLuc stop codon and the polyadenylation signal. This allows the cloning of sequences that will be part of the GLuc mRNA, such as 3´ UTR sequences, that can be used for RNA stability, RNAi or miRNA target evaluation.
    • GLuc can be used as a stand alone reporter or in conjunction with other compatible reporters such as Cypridina Luciferase (CLuc) (3). GLuc and CLuc are ideally suited for co-expression as both are secreted and highly active enzymes providing ease of use and sensitivity (3,4).

    Storage Buffer

    10 mM Tris-HCl
    1 mM EDTA
    pH 7.5 @ 25°C

    1. Verhaegen, M. and Christopoulos, T.K. (2002). Anal. Chem . 74, 4378-4385.
    2. Tannous, B.A. et al. (2005). Mol.-Nr. Ther. 11, 435–443.
    3. Otsuji, et al. (2004). Anal. Biochemie. 329, 230-237.
    4. Wu, et al. (2007). Biotechniken. 42, 290-292.

    Dieses Produkt ist durch ein oder mehrere Patente, Warenzeichen und/oder Urheberrechte geschützt, die sich im Besitz von New England Biolabs, Inc (NEB) befinden oder von ihr kontrolliert werden.

    Während NEB seine Produkte für verschiedene Anwendungen entwickelt und validiert, kann die Verwendung dieses Produkts erfordern, dass der Käufer für bestimmte Anwendungen zusätzliche geistige Eigentumsrechte Dritter erwerben muss.

    Für weitere Informationen zu kommerziellen Rechten wenden Sie sich bitte an das Global Business Development Team von NEB unter [email protected]

    Dieses Produkt ist nur für Forschungszwecke bestimmt. Dieses Produkt ist nicht für therapeutische oder diagnostische Zwecke bei Mensch oder Tier bestimmt.

    New England Biolabs (NEB) is committed to practicing ethical science &ndash we believe it is our job as researchers to ask the important questions that when answered will help preserve our quality of life and the world that we live in. However, this research should always be done in safe and ethical manner. Mehr erfahren.

    Licenses

    Dieses Produkt ist nur für Forschungszwecke bestimmt. Dieses Produkt ist nicht für therapeutische oder diagnostische Zwecke bei Mensch oder Tier bestimmt.

    By opening this package or by using the materials enclosed within Recipient is legally bound and accepts the following terms and conditions:

    Non-Commercial Entities: This product is covered by U.S. Patent No. 6,232,107 and other patents that are the legal property as assigned to Prolume Ltd./Nanolight Technologies. This product is licensed only to the purchasing laboratory-research group. Recipient agrees not to transfer this plasmid or derivatives of this vector to any other laboratory, person or research group, even if within the same institution. Recipient agrees not to alter or make any changes to the nucleotide coding sequence or secretory coding sequence of the luciferase(s) contained within without prior written permission from Prolume Ltd./Nanolight Technologies (www.nanolight.com). Recipient agrees not to file for any patent rights or inventions claiming any portion of the Luciferase(s) within the material without prior written permission from Prolume Ltd./Nanolight Technologies.

    Commercial For-Profit Entities & Non-Profit Foundations (herein referred to as Commercial Recipients): Commercial Recipients wishing to derive products, engage in the sale or license of any products, discover drugs, or make inventions by use of the materials enclosed, fully agree to the terms mentioned above for Non-Commercial entities AND ADDITIONALLY agrees to and are hereby bound to use the materials FOR EVALUATION PURPOSES ONLY. Commercial Recipient hereby agrees to destroy and cease use of any materials or derivatives containing any portion of these materials within 180 days from receipt. Commercial Recipient agrees not to use the materials for any use, other than the 180-day suitability evaluation without prior written permission or obtaining a valid license from Prolume Ltd./Nanolight Technologies.

    Any Recipient that does not accept the license terms mentioned above, shall return the unopened package and materials to NEB for a full refund.

    Warenzeichen

    BIOLUX® is a registered trademark of New England Biolabs, Inc.
    QIAGEN® is a registered trademark of Qiagen.


    The Pacific White Shrimp β-actin Promoter: Functional Properties and the Potential Application for Transduction System Using Recombinant Baculovirus

    A newly isolated Pacific white shrimp (Litopenaeus vannamei) beta-actin promoter SbaP and its derivative compact construct SbaP (ENX) have recently been demonstrated to promote ectopic gene expression in vitro and in vivo. To further explore the potential transduction application, this newly isolated shrimp promoter SbaP was comparatively tested with cytomegalovirus (CMV), simian virus 40 (SV40), polyhedrin (Polh), and white spot syndrome virus immediate early gene 1 (WSSV ie1) four constitutive promoters and a beta-actin promoter (TbaP) from tilapia fish to characterize its promoting function in eight different cell lines. Luciferase quantitation assays revealed that SbaP can drive luciferase gene expression in all eight cell lines including sf21 (insect), PAC2 (zebrafish), EPC (carp), CHSE-214 (chinook salmon), GSTEF (green sea turtle), MS-1 (monk seal), 293T (human), and HeLa (human), but at different levels. Comparative analysis revealed that the promoting activity of SbaP was lower (≤10-fold) than CMV but higher (2-20 folds) than Polh in most of these cell lines tested. Whereas, SbaP mediated luciferase expression in sf21 cells was over 20-fold higher than CMV, SV40, Polh, and TbaP promoter. Compared to the SbaP, SbaP (ENX), which was constructed on the basis of SbaP by deletion of two "negative" regulatory elements, exhibited no significant change of promoting activity in EPC and PAC2 cells, but a 5 and 16 % lower promoting effect in 293T and HeLa cells, respectively. Additionally, a recombinant baculovirus was constructed under the control of SbaP (ENX), and efficient promoter activity of newly generated baculoviral vector was detected both in vitro of infected sf21 cells and in vivo of injected indicator shrimp. These results warrant the potential application of SbaP, particularly SbaP (ENX) in ectopic gene expression in future.

    Schlüsselwörter: Promoter activity Recombinant baculovirus SbaP Shrimp beta-actin promoter The Pacific white shrimp.


    Luciferase promoter vector over p-AcGFP1-C1 vector - Biology

    Our promise to you:
    Guaranteed product quality, expert customer support.

    Reporter Stable Cell Lines

    As useful tools for scientific research, reporter stable cell lines are those cells involved in expression of reporter protein(s) which are engineered through integrating the reporter expression cassettes into cell genomes mediated by plasmid or lentivirus vectors. In the studies of life science and biotechnology, the commonly used reporter genes are visually identifiable including green fluorescent protein (GFP), red fluorescent protein (RFP), luciferase, secreted alkaline phosphatase (SEAP) etc.

    According to the upstream regulator of the reporter gene, reporter cell lines can be further divided into two groups: 1) Constitutive Reporter Cell Lines in which reporters are constitutively expressed under the control of a constitutive, strong promoter such as CMV promoter and 2) Inducible Reporter Cell Lines in which reporters are inducibly expressed under the control of a minimal promoter fused to multiple inducer response elements.

    Based on years of experience and in-depth investigation, scientists at Creative Biogene have established a large number of stable reporter cells in many popular cell lines suitable for multiple applications.

    Constitutive Reporter Cell Lines

    Inducible Reporter Cell Lines

    Table 1. Frequently Requested - Constitutive Reporter Cell Lines

    KategorieReporterHost Cell
    Fluorescent ReporterGFP143 B, 324, 4T1, 9L, A375, A498, A549, AGS, Anip 973, ASPC -1, B16F0, B16 F10, Boy, BT 474, BV2, Bx Pc3, Ca761, CAOV3, Capan-1, Capan-2, CHO-K1, CNE2Z, colo205, Colon 38, COS-7, CT-26, DAOY, DU145, EKVX, FaDu, FEMX I, Flo-1, H460, H69, HCC70, HCT-116, HCT-15, HCT-8, HEK293, HEK293T, HeLa, Hep2, Hep 3B, HEP-G2, HGC27, HOP-62, HT 1080, HT-29, HTB 9, Huh-7, JURKAT, K562, KM-12, KM 28 BM, KU-7, LL/2, LnCap, LOXMIVI, LS 174, Ls180, L-SLM, MCF7, MDA-MB-231, MDA-MB-435, MDA-MB-435 2C5, MDA-MB-435 4A4, MDA-MB-453, MDA-MB-468, MDCK, Mel526, MIA-Paca 2, MMT 060562, MOLM13, MSTO-211H, MV3, N87, NALM6, NCI-H1299, NCIH1437, NCI-H1975, NCI-H661, NCI-N87, NIH3T3, NUGC 4, OPM2, OST, OVCAR-3, OVCAR-8, PaCa28, Panc-1, Pan02, PC-3, PC-12, R40LN, RGMI#186, RPMI8226, SH-SY5Y, SK-BR-3, SK-Hep-1, SK-LU-1, Sk-mel-5, SK-OV-3, SL4, SN12C, SNB-19, SOSN2, SW1116, SW480, SW620, SCC-25, T24T, T47D, TOV21, U2OS, U87 MG, U937, UACC257, UM-UC-3, UM-UC 14, Vcap, WiDr, XPAI
    RFP143 B, 4T1, A375, A549, ASPC-1, B16F0, B16-F10, Bx Pc3, BV2, CEM, CHO-K1, CNE2Z, Colon 38, Colo26, CT26.WT, Dunning3327, DAOY, FEMX I, FaDu, FG A-12, H9C2(2-1), HCT-116, HCT-8, HEK293, HEK293T, Hep2, Hep 3B, Hep G2, HGC27, HMMG/HOS, HT 1080, HT29, Huh-7, KAK-1, LnCap, LOXMIVI, LL/2 H460, MDA-MB-231, MDA-MB-435 4A4, MDA-MB-435 2C5, MDA-MB-468, Mel526, MGC803, MIA-Paca 2, MMT 060562, MSTO-211H, MV3, MX-1, NCI-H1299, NCIH1568, NCIH1975, NIH3T3, NPA, NUGC 4, OVCAR-3, OVCAR-5, OVCAR-8, OST, Pan02, PC-3, R40LN, R90L, R90P, SK-BR-3, SW1116, SW480, SL4, SN12C, SOSN2, SH-SY5Y, SK-Hep-1, Sk-mel-5, T24T, T47D, TOV21, U14, U2OS, U87 MG, UM-UC 14, XPAI
    GFP + RFP143 B, B16 F10, DU145, H460, HCT-116, HT 1080, Lewis Lung, MDA-MB-435, MDA-MB-231, MIA-Paca 2, MMT 060562, MV3, PC3, U87 MG, XPAI
    Luciferase ReporterLuciferase4T1, A375, A549, B16F10, CT26.WT, HCT116, HT1080, LL/2, MCF-7, MDA-MB-231, SKOV-3
    Dual ReporterGFP + LuciferaseAGS, HCC70, HT-29, MCF7, NCI-H1299, NCI-H1975, NCI-H661, NCI-N87
    RFP + LuciferaseA549, CNE2Z, GBC-SD, H9C2(2-1), HCT-8, HEK293T, Hep3B, HepG2, HOS, Huh7, Li-7, MDA-MB-231, NCI-H1299, PLC/PRF/5, RBE, SK-HEP-1

    Table 2. Frequently Requested - Inducible Reporter Cell Lines


    Schau das Video: Лечение десен аппаратом Vector. Безболезненное лечение десен аппаратом Vector. 12+ (Juni 2022).


Bemerkungen:

  1. Wythe

    Wacker, eine großartige Phrase und ist rechtzeitig

  2. Unai

    Ich finde das ist der Fehler.

  3. Voodooshura

    Müll von Gott))))) Der Anfang betrachtete mehr war nicht genug))))))

  4. Griffyth

    Es tut mir sehr leid, dass ich Ihnen bei nichts helfen kann. Aber ich bin sicher, dass Sie die richtige Lösung finden.

  5. Narmer

    Wunderbares, sehr wertvolles Stück

  6. Macmaureadhaigh

    Can't the fault be here?



Eine Nachricht schreiben