Information

Wie identifiziere und isoliere ich ein Gen, das für einen bestimmten beobachtbaren Phänotyp kodiert?

Wie identifiziere und isoliere ich ein Gen, das für einen bestimmten beobachtbaren Phänotyp kodiert?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Wie identifiziere und isoliere ich ein Gen, das für einen bestimmten beobachtbaren Phänotyp kodiert? Es ist ein neuartiges Bakterium und ich kenne weder die Gensequenz noch das Protein, für das es kodiert.


Bücherregal

NCBI-Bücherregal. Ein Service der National Library of Medicine, National Institutes of Health.

Griffiths AJF, Gelbart WM, Miller JH et al. Moderne genetische Analyse. New York: W. H. Freeman 1999.

  • Nach Absprache mit dem Verlag ist dieses Buch über die Suchfunktion zugänglich, jedoch nicht durchsuchbar.


Zusammenfassung

Wir suchten nach Genen, die Mutator-Phänotypen erzeugen, wenn sie auf ein Multicopy-Plasmid in aufgetragen werden Escherichia coli. In vielen Fällen führt dies zu einer Überexpression des betreffenden Gens. Wir haben eine zufällige Schrotflintenbibliothek erstellt mit E coli genomische Fragmente zwischen 3 und 5 kbp Länge auf einem Multicopy-Plasmidvektor, der in . transformiert wurde E coli um nach Frameshift-Mutatoren zu suchen. Wir identifizierten insgesamt 115 unabhängige genomische Fragmente, die 17 Regionen auf der E coli Chromosom. Weitere Studien identifizierten 12 Gene, von denen bisher nicht bekannt war, dass sie bei Überproduktion Mutator-Phänotypen verursachen. Ein auffallender Befund ist, dass eine Überproduktion des Multidrug-Resistenz-Transkriptionsregulators EmrR zu einer starken Zunahme der Leserasterverschiebung und der Basensubstitutionsmutagenese führt. Dies deutet auf einen Zusammenhang zwischen Multidrug-Resistenz und Mutagenese hin. Andere identifizierte Gene umfassen diejenigen, die für DNA-Helikasen (UvrD, RecG, RecQ), verkürzte Formen des DNA-Mismatch-Repair-Proteins (MutS) und eine primosomale Komponente (DnaT), einen negativen Modulator der Replikationsinitiation/GATC-bindendes Protein (SeqA) kodieren. , ein stationärer Phasenregulator AppY, ein Transkriptionsregulator PaaX und drei mutmaßliche offene Leseraster, ycgW, yfjY und yjiD, die hypothetische Proteine ​​kodieren. Darüber hinaus fanden wir drei Gene, die für Proteine ​​kodieren, von denen zuvor bekannt war, dass sie unter Überexpressionsbedingungen Mutatoreffekte verursachen: fehleranfällige Polymerase IV (DinB), DNA-Methylase (Dam) und Sigma-S-Faktor (RpoS). Diese genomische Strategie bietet einen Ansatz zur Identifizierung neuer Mutatoreffekte, die aus der Multicopy-Klonierung (MCC) spezifischer Gene resultieren, und ergänzt daher den herkömmlichen Ansatz der Geninaktivierung zum Auffinden von Mutatoren.


Wie identifiziere und isoliere ich ein Gen, das für einen bestimmten beobachtbaren Phänotyp kodiert - Biologie

Die beiden grundlegenden Aspekte der Genetik sind Genaktivität und Vererbung. Die Gene sind natürlich die elementaren Einheiten der genetischen Information, ihre Aktionen oder Expression führen zu allen physiologischen Prozessen, die einen Organismus ausmachen. Obwohl die Gene auch als elementare Einheiten der Vererbung angesehen werden können, stimmt dies nicht genau. Die einzelnen Basenpaare der DNA sind gewissermaßen die elementaren Einheiten der genetischen Übertragung, und durch ausgeklügelte Techniken kann man die Vererbung von Teilen von Genen nachweisen. Aber für die grundlegenden Konzepte der Vererbung, die jeder verstehen sollte, ist das Gen das grundlegende Element. Wichtig ist die Identität der Funktionseinheit und der Vererbungseinheit.

Definitionen

Die Genetik ist einzigartig unter den Wissenschaften, denn in keinem anderen Fall ist die wissenschaftliche Methode so integraler Bestandteil der Art und Weise, wie Wissenschaft gelehrt wird. Normalerweise lehren wir nur die Ergebnisse oder Erkenntnisse der Wissenschaft, weil wir nicht lehren können, wie diese Ergebnisse erzielt wurden. In anderen wissenschaftlichen Disziplinen sind die experimentellen Methoden so komplex, die Datenlage so umfangreich und ihre Reduktion und Analyse so mühsam, dass ihre Vermittlung in der Real- und Sekundarstufe weder praktikabel noch wünschenswert ist. Genetik ist anders. Das Studium der Genetik ist das Studium, wie Wissenschaftler – Genetiker – wissen, was sie wissen. Wenn wir Genetik lehren, können wir wirklich wissenschaftliche Methoden lehren. In der Genetik müssen die Ergebnisse und die Art und Weise, wie die Ergebnisse erzielt werden, nicht getrennt werden.

Der Schlüssel besteht darin, zu erkennen, dass grundlegende genetische Konzepte operative Definitionen sind, was bedeutet, dass genetische Fakten durch die Operationen definiert werden, mit denen wir sie beobachten und demonstrieren. Die in diesem Buch beschriebenen Experimente sollen es den Schülern ermöglichen, diese Vorgänge selbst zu beobachten und dadurch genetische Konzepte aus erster Hand zu entwickeln.

Wie definieren wir also "das Gen" operativ? Tatsächlich tun wir das nicht. Wir definieren spezifische, individuelle Gene operativ durch ihre Genotypen (Vererbung) und phänotypischen Merkmale (physiologische Expression). Der Genotyp ist die in der DNA kodierte Information, während sich der Phänotyp auf die beschreibbaren, vererbbaren Eigenschaften eines Organismus bezieht, wie zum Beispiel die Farbe eines Teils davon. Wir könnten praktisch jedes beschreibbare Merkmal verwenden, aber einige sind nützlicher als andere. Wir definieren das Gen oder die Gene, die ein phänotypisches Merkmal bestimmen, durch kontrollierte Experimente.

Die Hauptstütze der Genetik ist das kontrollierte Experiment, bei dem wir jeweils nur eine Variable ändern, damit wir die Veränderung des Ergebnisses mit einer Veränderung einer Variablen identifizieren können. Aber in der Genetik kann man oft mehrere kontrollierte Experimente gleichzeitig parallel durchführen, was viel mehr Spaß macht, als sie einzeln durchzuführen. Wir verwenden experimentelle Organismen, die sich durch eine kleine Anzahl gut definierter Einzelgenmerkmale unterscheiden. Durch die Verwendung von Mutanten erzeugen wir Stämme, die die eine oder andere von zwei alternativen Formen oder Allele eines Gens aufweisen. Zum Beispiel verwenden wir zwei mutierte Gene (ade1 und ade2), die unter bestimmten Bedingungen dazu führen, dass die Zellen rot werden (Roman 1956). Die alternativen Allele dieser Gene sind die nicht mutierten Formen (ADE1 und ADE2), die zu cremefarbenen Zellen führen. Das Auftreten der roten Farbe definiert das Vorhandensein des mutierten Allels in einem bestimmten Stamm, und das Fehlen der roten Farbe definiert normalerweise das Fehlen des mutierten Allels und daher das Vorhandensein des nicht mutierten Allels.

Wenn es uns gelungen ist, durch kontrollierte Experimente eine Vererbungseinheit mit einem Phänotyp zu identifizieren, haben wir das Gen für dieses Merkmal operativ definiert. Der Genotyp erscheint abstrakter und daher vage als der Phänotyp. Experimentell war es immer schwieriger, den Genotyp direkt zu beobachten. Da aber Molekularbiologen nun Gene isolieren und ihre genauen Nukleotidsequenzen bestimmen können, ist der Genotyp konkreter geworden. Diese Methoden sind zu kompliziert, um es den Schülern zu ermöglichen, den Genotyp aus erster Hand zu beobachten, sodass wir an dieser Stelle gezwungen sind, die Ergebnisse zu lehren oder Modelle und Simulationen zu verwenden. Aus Experimenten zur Vererbung, bei denen wir Muster der Übertragung von Merkmalen von einer Generation zur anderen beobachten, können wir operative Definitionen von Organisationseinheiten genetischer Information entwickeln, die wir Gene und Chromosomen nennen. Auch diese können dann mit physikalischen Strukturen identifiziert werden.

Wir markieren einzelne interessierende Gene mit Mutationen, um sie von den Tausenden von Genen zu unterscheiden, aus denen das Genom eines Organismus besteht. Obwohl Hunderte von Genen durch Mutationen in Hefe definiert wurden, benötigen wir nur wenige von ihnen, um die Grundlagen der Genetik zu lehren, daher haben wir einige ausgewählt, die besonders lehrreich und einfach zu handhaben sind.

Die Gene, die den Paarungstyp kontrollieren

Wenn Haploide sich paaren, produzieren sie ein Diploid, das für den Paarungstyp heterozygot ist. Dieses A/Diploid kann sich mit keinem der Paarungstypen paaren, aber es kann sporulieren, was Haploide nicht können. Wenn ein Diploid sporuliert, produziert es zwei Sporen jedes Paarungstyps, was zeigt, dass a und tatsächlich durch zwei alternative Allele eines einzigen genetischen Locus bestimmt werden.

Die Allele vom Paarungstyp sind insofern einzigartig, als keines einfach eine mutierte Form des anderen ist. Jedes ist ein funktionelles Gen, aber normalerweise exprimiert jede haploide Zelle nur eines von beiden. Auf diese Weise verhalten sie sich wie Allele. Der Phänotyp des heterozygoten Diploids unterscheidet sich von jedem der beiden Haploiden. Aus umfangreichen genetischen, physiologischen und biochemischen Studien wissen wir, dass die Allele des Paarungstyps Kontrollgene sind, die bestimmen, ob andere Gene exprimiert werden oder nicht. Ein weiterer Vorteil von Hefe ist die Leichtigkeit, mit der diese regulatorischen Gene untersucht werden können.

Gene für die Biosynthese kleiner Moleküle

Viele dieser kleinen Moleküle sind für das Wachstum essentiell, müssen aber nicht von der Zelle selbst hergestellt werden. Wenn sie im Wachstumsmedium vorhanden sind, nimmt die Zelle sie auf und verwendet sie, anstatt sie selbst herzustellen. Tritt eine Mutation in einem der Gene auf, die für ein Enzym kodieren, das an der Biosynthese eines bestimmten kleinen Moleküls beteiligt ist, dann ist dieses Enzym möglicherweise inaktiv und die Zelle kann dieses Produkt nicht herstellen. Diese mutierte Zelle und alle ihre Nachkommen können nur auf einem Medium wachsen, das das erforderliche Produkt als Nährstoff enthält. Ein mutierter Stamm, der einen neuen Nährstoff für das Wachstum benötigt, wird als Auxotroph bezeichnet, der Stamm, der diesen Nährstoff nicht benötigt, ist ein Prototroph. In der Praxis nennen wir einen bestimmten Stamm auxotropher oder prototroph für eine bestimmte Verbindung, um zu sagen, dass er eine bestimmte Wachstumsanforderung hat oder nicht hat. Sobald eine auxotrophe Mutante isoliert und charakterisiert wurde, kann die Anwesenheit oder Abwesenheit des mutierten Gens dadurch definiert werden, ob die Zelle diesen Nährstoff im Wachstumsmedium benötigt oder nicht. Ein Bedarf an einem bestimmten Nährstoff definiert jedoch nicht notwendigerweise ein bestimmtes Gen, da viele Gene an der Biosynthese jeder Verbindung beteiligt sind. Mutationen in einem der Gene im gleichen Signalweg führen eindeutig zu den gleichen Anforderungen. In diesem Fall sind zusätzliche Tests erforderlich, um Mutationen in einem Gen von einem anderen zu unterscheiden. Darüber hinaus sind einige Gene an der Biosynthese vieler verschiedener Verbindungen beteiligt, während andere nur für eine spezifisch sind. Die letztgenannte Art ist offensichtlich am einfachsten zu handhaben, da jede Mutation zu einer einzigen neuen Wachstumsanforderung führt.

In unseren Experimenten werden wir zwei Arten von auxotrophen Mutanten verwenden: Mutanten, die Adenin benötigen, und Mutanten, die Tryptophan benötigen.

Mutanten, die Adenin benötigen

Dominanz, Rezessivität und Epistase

Einige Allele sind weder dominant noch rezessiv. Wenn der Phänotyp eines heterozygoten Diploiden – eines, das verschiedene Allele eines Gens trägt – zwischen den jeweiligen homozygoten Phänotypen liegt, nennen wir sie kodominant. In einigen Fällen jedoch, beispielsweise beim Paarungstyp, unterscheidet sich der Phänotyp des heterozygoten Diploids vollständig von jedem der homozygoten Phänotypen. Der Begriff der Dominanz trifft hier überhaupt nicht zu. Wir nennen diese Art der Interaktion komplementär, um anzuzeigen, dass jedes Gen ein anderes funktionelles Produkt produziert und der Phänotyp aus der Interaktion der beiden Produkte resultiert. Dies ist analog zu dem bereits besprochenen Fall, bei dem ein Stamm mit einer Mutation in einem der roten Adenin-Gene (z. ADE1 ade2) wurde mit einem mit einer Mutation im anderen roten Adenin-Gen (ade1 ADE2). Das Diploid hat den normalen cremefarbenen, Adenin-unabhängigen Phänotyp, da die beiden Mutanten komplementäre Genotypen haben. In diesem Fall erfolgt die Komplementation zwischen verschiedenen Genen. Viele Formen der komplementären Genexpression treten in Zellen auf. Der Begriff Komplementation bezeichnet eine Art von Interaktion, die operativ definiert ist, und nicht einen bestimmten molekularen Mechanismus.

Nomenklatur und Gensymbole

Bei der Ableitung von operationalen Definitionen der von uns untersuchten Gene geben wir ihnen nützliche Namen (Sherman 1981 Mortimer & Schild 1981a Mortimer & Schild 1981b). Die Form des Namens eines Gens verrät uns einige seiner Eigenschaften. Jeder Name beginnt mit einem Drei-Buchstaben-Symbol, das seinen Phänotyp beschreibt. Die dominanten Allele werden immer in Großbuchstaben und rezessive Allele in Kleinbuchstaben geschrieben. Verschiedene Gene mit dem gleichen Phänotyp werden durch eine Zahl unterschieden, die ohne Leerzeichen auf das Drei-Buchstaben-Symbol folgt. Wenn wir zwischen verschiedenen rezessiven Allelen unterscheiden müssen, verwenden wir noch eine weitere Zahl, die durch einen Bindestrich getrennt ist. Alle Gene, die für Enzyme im AMP-Biosyntheseweg kodieren, tragen das Symbol ade oder ADE, die den rezessiven und dominanten Allelen entsprechen. Wir nennen mutierte Allele der beiden "roten" Gene ade1 und ade2, und ihre Wildtyp-Formen ADE1 und ADE2. Die alternativen Allele vom Paarungstyp heißen MATTEein und MATTE , aber sie werden normalerweise einfach mit a und abgekürzt. Beim Drucken oder bei Textverarbeitungsprogrammen ist es üblich, Gensymbole kursiv zu setzen, um sie von Phänotypbeschreibungen zu unterscheiden. Bei der Typisierung werden Gensymbole unterstrichen.

Gene als Vererbungseinheiten

Eine der grundlegendsten Eigenschaften lebender Organismen ist ihre Fortpflanzungsfähigkeit. Da der Phänotyp durch den Genotyp bestimmt wird, erfordert die Reproduktion des Organismus die Reproduktion aller Gene, die den Phänotyp bestimmen. Diese Gesamtheit von Genen wird Genom genannt. Das Genom jeder Zelle wird vor jeder Zellteilung dupliziert und die beiden Kopien werden dann auf die Nachkommenzellen aufgeteilt. Dies geschieht sowohl bei mitotischen als auch bei meiotischen Zellteilungen, aber in beiden Fällen ist das Ergebnis unterschiedlich, da die Funktion der Zellteilung unterschiedlich ist.

Vererbung bei Mitose und bei Meiose

Während die Mitose nahezu identische Nachkommenzellen hervorbringt, führt die Meiose garantiert zu Nachkommen, die sich von der Elternzelle unterscheiden und sich normalerweise auch voneinander unterscheiden. Während die Mitose der Modus der asexuellen Teilung sowohl in haploiden als auch in diploiden Zellen ist, tritt die Meiose nur in diploiden Zellen auf und bringt haploide Nachkommen hervor. Beide Prozesse beginnen mit einer Chromosomenreplikationsrunde, in der die DNA repliziert und auf zwei Replikate jedes Chromosoms verteilt wird. Da sich diese Replikatkopien nicht sofort voneinander trennen, ist es sinnvoll, ihnen einen Namen zu geben. Sie werden Chromatiden oder einfach Stränge genannt. Sie sind separate Strukturen, bleiben jedoch an einer kurzen Region, dem Zentromer, verbunden. (Beachten Sie, dass jedes Chromatid – oder jeder Strang – aus einer DNA-Doppelhelix besteht, die wiederum aus zwei Polynukleotidsträngen besteht. Mit anderen Worten, was wir auf zytologischer Ebene einen Strang nennen, besteht auf molekularer Ebene aus zwei Strängen .) Vor der Replikation besteht also im Einzelstrangstadium jedes Chromosom aus einem einzigen Chromatid. Nach der Replikation, aber bevor sich die Chromatiden trennen (am Zentromer trennen), befinden sie sich im doppelsträngigen (zwei Chromatiden) Stadium. Sowohl Mitose als auch Meiose sind in ihren detaillierten Ereignissen äußerst kompliziert, aber einfach in Bezug auf den Informationsfluss – die Art und Weise, wie verschiedene Gene von den Eltern auf die Nachkommen übertragen werden. Wir werden uns auf diese Informationsebene des Prozesses konzentrieren.

Informationsfluss bei Mitose:

Die übliche mitotische Teilung garantiert, dass jede Nachkommenzelle einen Chromosomensatz – Genom – erhält, der mit der Elternzelle identisch ist (gelegentliche Mutationen nicht mitgezählt, die normalerweise zum Zeitpunkt der DNA-Replikation auftreten). Abbildung 4 zeigt, wie eine diploide heterozygote für ADE2/ade2 produziert zwei identische heterozygote Nachkommen. Zu Beginn der Zellteilung wird jede Zelle durch eine Struktur namens Spindel polarisiert. Die Chromosomen im zweisträngigen Stadium versammeln sich im Zentrum dieser Struktur, trennen sich in zwei unabhängige einzelsträngige Chromatiden und bewegen sich entlang der Fasern der Spindel zu ihren Polen, wobei sie sich innerhalb der Zelle so organisieren, dass sie bei der Teilung die Der Chromosomensatz des einen Pols landet in der einen Zelle und der Chromosomensatz des anderen Pols in der anderen Zelle. Diese Trennung der Chromatiden, Disjunktion genannt, erfolgt unabhängig für jedes Chromosom, so dass jede Zelle eine Kopie jedes Chromosoms ihres Elternteils erhält. Wenn der Elternteil haploid ist, dann ist jede Nachkommenzelle haploid, wenn der Elternteil diploid ist, sind die Nachkommen diploid.

Informationsfluss bei Meiose:

Die meiotische Teilung (Abbildung 5) ist etwas komplizierter. Da der Nettoeffekt darin besteht, von einem diploiden Zustand in einen haploiden Zustand überzugehen, gibt es zwei Unterteilungen. In der ersten meiotischen Teilung lösen sich die Zentromere nicht. Stattdessen paaren sie sich: Die beiden Kopien jedes Chromosoms im diploiden Kern kommen Seite an Seite mit ihren Zentromeren zusammen.

Die beiden Kopien sind nicht unbedingt identisch, da sie stattdessen an einer beliebigen Anzahl von Genen heterozygot sein können, sie werden als homolog bezeichnet und manchmal als Homologe bezeichnet. Da jedes der paarigen homologen Chromosomen zweisträngig ist, nennen wir dies das Vierstrangstadium. Die gepaarten Chromosomen trennen sich und bewegen sich entlang der Spindel, wobei jedes doppelsträngige Mitglied zu einem entgegengesetzten Pol geht. Dieser Schritt kann als Zentromertrennung beschrieben werden. Die zweite meiotische Teilung ist analog zur Mitose in einer haploiden Zelle: Die Chromosomen, noch im Zweistrangstadium, werden im Zentrum einer neuen Spindel organisiert, und dann lösen sich die Zentromere und die Chromatiden wandern zu den Spindelpolen, wodurch ein a insgesamt vier haploide Chromosomensätze im Einzelstrangstadium. Diese werden in die vier Kerne der meiotischen Produkte eingebaut, bei Hefen in die Ascosporen. Abbildung 6 zeigt, wie eine diploide heterozygote für ADE2/ade2 (dargestellt als +/-) produziert vier haploide Sporen, zwei ADE2 (+) und zwei ade2 (-).

Wenn die homologen Chromosomen nicht identisch sind – das heißt, einige der Gene sind heterozygot – sind die vier Produktgenome offensichtlich nicht identisch. Da die Segregation der Chromatiden bei der ersten meiotischen Teilung unabhängig von einem Chromosom zum anderen ist, wird die Segregation der Gene auf verschiedenen Chromosomen unabhängig sein. Tatsächlich ist dies das Muster des Sortiments, das Mendel berühmt gemacht hat. Für jedes heterozygote Allelepaar gibt es zwei Produkte – Ascosporen – des einen Typs und zwei des anderen. Wenn zwei heterozygote Paare auf verschiedenen Chromosomen vorhanden sind, werden sie unabhängig voneinander getrennt, so dass alle möglichen Kombinationen in einer Probe der Nachkommensporen vertreten sind. Die Kombinationen, die den Eltern-Zell-Kombinationen gleich sind, werden als Elterntypen bezeichnet, während diejenigen, die nicht wie die Eltern-Zell-Kombinationen sind, als nicht-elterlich oder rekombinant bezeichnet werden, weshalb der Vorgang als Rekombination bezeichnet wird.

Die Chromosomensegregation ist jedoch nicht der einzige Weg, auf dem eine Rekombination stattfinden kann. Nach diesem Modell würden sich alle Gene auf demselben Chromosom absondern und niemals rekombinieren, aber wir beobachten dies nicht.Tatsächlich trennen sich fast alle Gene bis zu einem gewissen Grad voneinander, wenn auch nicht immer in der Häufigkeit, die durch die zufällige Auswahl vorhergesagt wird. Die Rekombination von Genen auf demselben Chromosom tritt auf, wenn die homologen Chromosomen Teile ihrer Chromatiden austauschen, während sie im Vierstrangstadium gepaart sind, um die erste meiotische Teilung vorzubereiten (Abbildung 6). Diese Austausche – Crossovers – treten zufällig entlang der Chromatiden auf, so dass die Wahrscheinlichkeit einer Rekombination zweier heterozygoter Gene auf demselben Chromosom davon abhängt, wie weit sie voneinander entfernt sind. Je näher sie beieinander liegen, desto seltener rekombinieren sie. Die Neigung von Allelen von Genen auf dem gleichen Chromosom, sich häufiger als durch Zufall allein erwartet zu segregieren, wird als Kopplung bezeichnet. Je seltener sie rekombinieren, desto enger sind sie verbunden.

In Hefe tritt Crossing-Over ziemlich häufig auf, sodass sogar Gene auf demselben Chromosom unabhängig voneinander zu segregieren scheinen, es sei denn, sie liegen sehr nahe beieinander. Die drei spezifischen Gene, die wir in diesen Experimenten verwenden, der Paarungstyp und die beiden roten Adenin-Gene, befinden sich auf drei verschiedenen Chromosomen, daher werden wir keine Fälle von Kopplung beobachten.

Mitotische Rekombination:

Wir stellen uns die Mitose normalerweise als einen Prozess vor, bei dem es keine Segregation von heterozygoten Merkmalen gibt. Jedes mitotische Produkt wird als identisch mit dem Elternteil betrachtet. Wir können leicht zeigen, dass mitotische Segregation oder Rekombination in Hefe mit geringer Häufigkeit auftritt (Abbildung 7) (Mortimer &. Hawthorne 1969). Es kommt auch in den Körperzellen höherer Organismen vor, ist aber schwieriger nachzuweisen. Die mitotische Segregation macht, wie wir zeigen werden, Gene, die heterozygot sind, homozygot, was zur Expression von rezessiven Allelen führt, die sonst nicht exprimiert würden. Da die meisten schädlichen Mutationen rezessiv sind und im heterozygoten Zustand nicht exprimiert werden, hat dies wichtige Konsequenzen. Bei höheren Organismen, einschließlich Menschen, kann es ein Mechanismus für die Entwicklung einiger Krankheiten sein, einschließlich Krebs. In experimentellen Organismen, insbesondere in Hefe, bietet es eine Alternative zur meiotischen Segregation zur Untersuchung des Genotyps diploider Stämme.

Wir können die mitotische Rekombination verstehen, wenn wir annehmen, dass bei der Mitose die homologen Chromosomen tatsächlich paaren, wie sie es bei der Meiose tun. Da wir dies unter dem Mikroskop nicht beobachten können, kommt es wahrscheinlich nur gelegentlich vor. Wenn wir dann annehmen, dass in diesem Vierstrangstadium ein Crossing-Over zwischen dem Zentromer und der Position eines Paares heterozygoter Allele stattfindet, dann könnte es tatsächlich zu einer Segregation kommen, wenn die Chromatiden getrennt werden. In der Tat, wenn die getrennten Chromatiden zufällig auf die Pole verteilt werden, dann würden in der Hälfte der Teilungen, in denen eine solche Kreuzung stattfindet, die heterozygoten Allele in den Nachkommenzellen homozygot werden, was dazu führt, dass zwei Klone von homozygoten Zellen nebeneinander wachsen. Seite. Wenn es in einer sich entwickelnden Kolonie auftritt, wird die Kolonie in Sektoren unterteilt. Da Zellen, die für eine der roten Adeninmutationen heterozygot sind (wie z ADE1/ade1 oder ADE2/ade2) sind weiß und solche, die homozygot für eines der rezessiven Allele (ade1/ade1 oder ade2/ade2) rot sind, führt die mitotische Segregation zum Auftreten roter Sektoren in den normalerweise weißen Kolonien (Abbildung 8).

Homozygot ade2/ade2 Klon produziert roten Sektor in ansonsten cremefarbener Kolonie. Die Entmischung bei der ersten Teilung erzeugt eine halbrote und halbcremefarbene Kolonie (rechts), während die Entmischung bei der späteren Teilung einen kleineren roten Sektor erzeugt (links).

Genkonversion:

Die mitotische Rekombination kann durch Strahlung, wie Ultraviolett- oder Röntgenstrahlen, induziert werden. Bestrahlen wir einzelne Zellen, die heterozygot sind für ADE2/ade2 mit einer Dosis, die etwa die Hälfte von ihnen tötet, bilden mehrere Prozent der Überlebenden Kolonien mit roten Sektoren. Wenn Strahlung diesen Effekt hervorruft, tritt die Segregation früh in der Entwicklung der Kolonie auf, so dass die Sektoren groß sind, manchmal die Hälfte der Kolonie. Erfolgt die Segregation aus einem reziproken Crossover, dann sollte die cremefarbene Hälfte der Kolonie für die dominante . homozygot sein ADE2 Allel. Der cremefarbene Sektor entpuppt sich jedoch häufig noch als heterozygot ADE2/ade2. Dies ist leicht zu erkennen, denn wenn es heterozygot ist, wird es rote Sektoren aussondern, aber wenn es homozygot ist, tut es das nicht. Diese Art von sektorierten Kolonien scheint aus einer Art nicht-reziproken Ereignisses hervorzugehen. Wir beobachten häufig nichtreziproke Segregations- oder Rekombinationsereignisse in Hefe und anderen Pilzen. Sie treten normalerweise seltener auf als die wechselseitigen Ereignisse, aber nicht immer. Wir betrachten sie jetzt als eine besondere Art von genetischen Ereignissen, die Genkonversion genannt werden, und dieser Prozess hat in letzter Zeit allgemeineres Interesse als attraktives Modell zur Erklärung der Ereignisse gewonnen, die an den genetischen Sequenzen auftreten, die mit der Produktion von Antikörpern in höheren Tieren verbunden sind (Fogel, Mortimer & Lusnak 1981).

Zurück zum Inhalt
Letzte Aktualisierung Mittwoch, 04. Dezember 2002 20:34:24 UTC


Wie identifiziere und isoliere ich ein Gen, das für einen bestimmten beobachtbaren Phänotyp kodiert - Biologie

Wie erkennen wir verschiedene Arten? Ein offensichtlicher Weg ist die Morphologie, das Aussehen eines Organismus. Dies kann Größe, Form und Körperfarbe umfassen. Feldführer oder Internet-Sites könnten verwendet werden, um auf diese Weise bei der Identifizierung eines bestimmten Organismus zu helfen. Aber was ist mit Organismen wie Insekten, die oft nur schwer nach ihrer Morphologie zu identifizieren sind? Hier kommt eine nützliche Methode namens DNA-Barcoding ins Spiel.

Wir verwenden die DNA-Barcoding-Technik in unserem Labor, um die Artenvielfalt von Insekten zu untersuchen, aber wir verwenden sie auch, um Studenten in Molekularbiologie auszubilden. Der Zweck dieses Beitrags ist es, die Geschichte sowie die Wissenschaft hinter dieser Technik zu beschreiben. Ich werde auch beschreiben, wie es in unserem Labor funktioniert.

Im Jahr 2003 entwickelte Paul Hebert, Professor und derzeitiger Direktor des Biodiversity Institute of Ontario, das „DNA-Barcoding“, um Arten zu identifizieren. Beim DNA-Barcoding wird eine kurze genetische Sequenz aus dem Genom eines Organismus verwendet. Bei fast allen Tieren wird als Genregion das mitochondriale Cytochrom-c-Oxidase-1-Gen oder „CO1“ verwendet. COI ist eine Region mit 648 Basenpaaren, die für ein Enzym kodiert, das eine wichtige Rolle bei der Zellatmung spielt (wie Ihr Körper Glukose in ATP umwandelt), insbesondere der letzte Schritt, der als oxidative Phosphorylierung bezeichnet wird. Das COI-Gen ist für das Barcoding geeignet, da seine Mutationsrate schnell genug ist, um zwischen Tierarten, sogar eng verwandten Arten, zu unterscheiden.

So sieht unsere „Pipeline“ aus:

Woche 1: Die Schüler unseres Labors sammeln Insekten von Probeflächen. Wir haben Grundstücke an einem Abschnitt der Greenway Trails der Stadt sowie Grundstücke auf dem Campus. Auf diese Weise können wir ein gestörtes Stadtgebiet (Campus) mit einem weniger gestörten Gebiet (Greenway) vergleichen. Nach dem Sammeln im Feld versuchen die Schüler, die Exemplare mithilfe von Feldführern und anderen Internetressourcen zu identifizieren. Hier ist ein großartiger. Die Insekten werden entweder im Gefrierschrank oder in 70%igem Ethanol gelagert.


Mitgliedschaften

Department of Molecular Biology & Biotechnology, University of Sheffield, The Florey Institute for Host-Pathogen Interactions, Sheffield, UK

Carolin M. Kobras und Andrew K. Fenton

Department of Biology & Biochemistry, University of Bath, Milner Centre for Evolution, Bath, UK

Sie können auch in PubMed Google Scholar nach diesem Autor suchen

Sie können auch in PubMed Google Scholar nach diesem Autor suchen

Sie können auch in PubMed Google Scholar nach diesem Autor suchen

Beiträge

CMK, AKF und SKS haben das Review konzipiert und gemeinsam das Paper verfasst. Die Autoren haben das endgültige Manuskript gelesen und genehmigt.

Informationen der Autoren

Twitter-Handys: @carokobras (Carolin M. Kobras) @AndrewKFenton (Andrew K. Fenton) @sheppard_lab (Samuel K. Sheppard).

Korrespondierende Autoren


Genotypen

Ein Genotyp ist die genetische Ausstattung eines einzelnen Organismus. Biologen verwenden den Begriff Genotyp, um vom Phänotyp zu unterscheiden, der aus den beobachtbaren Merkmalen eines Organismus besteht.

Frauenportrait

Viele körperliche Merkmale wie Haarfarbe und -struktur, Augenfarbe und Hautfarbe werden durch die Genotypen bestimmt, die Eltern an ihre Kinder weitergeben.

Foto von Martin Schoeller

In gewisser Weise bezieht sich der Begriff &ldquogenotyp&rdquo&rdquo wie der Begriff &ldquogenom&rdquo&mdash auf den gesamten Satz von Genen in den Zellen eines Organismus. Im engeren Sinne kann es sich jedoch auf verschiedene Allele oder Varianten eines Gens für bestimmte Merkmale oder Merkmale beziehen. Der Genotyp eines Organismus steht im Gegensatz zu seinem Phänotyp, bei dem es sich um die beobachtbaren Merkmale des Individuums handelt, die aus Wechselwirkungen zwischen dem Genotyp und der Umwelt resultieren.

Zwischen Genotyp und Phänotyp besteht ein komplexer Zusammenhang. Da der Phänotyp das Ergebnis einer Interaktion zwischen Genen und der Umwelt ist, können unterschiedliche Umgebungen bei Individuen mit einem bestimmten Genotyp zu unterschiedlichen Merkmalen führen.

Außerdem können unterschiedliche Genotypen zum gleichen Phänotyp führen. Dies geschieht, weil Gene unterschiedliche Allele haben. Bei einigen Genen und Merkmalen sind bestimmte Allele dominant, während andere rezessiv sind. Ein dominantes Merkmal ist ein Merkmal, das bei einem Individuum auftaucht, auch wenn das Individuum nur ein Allel hat, das das Merkmal hervorbringt.

Einige Aspekte der Augenfarbe funktionieren auf diese Weise. Braune Augen sind zum Beispiel dominant gegenüber blauen Augen. Dies liegt daran, dass ein Pigment namens Melanin die braune Farbe erzeugt, während das Fehlen von Pigmenten zu blauen Augen führt. Nur ein Allel für das dunkle Pigment reicht aus, um Ihre Augen braun zu machen. Tatsächlich gibt es mehrere verschiedene Pigmente, die die Augenfarbe beeinflussen, wobei jedes Pigment von einem bestimmten Gen stammt. Dies ist der Grund, warum Menschen grüne Augen, haselnussbraune Augen oder eine andere Augenfarbe außer Blau oder Braun haben können.

Bei der Diskussion des Genotyps verwenden Biologen Großbuchstaben für dominante Allele und Kleinbuchstaben für rezessive Allele. Bei der Augenfarbe steht beispielsweise &ldquoB&rdquo für ein braunes Allel und &ldquob&rdquo für ein blaues Allel. Ein Organismus mit zwei dominanten Allelen für ein Merkmal hat einen homozygoten dominanten Genotyp. Am Beispiel der Augenfarbe wird dieser Genotyp mit BB geschrieben. Ein Organismus mit einem dominanten Allel und einem rezessiven Allel hat einen heterozygoten Genotyp. In unserem Beispiel wird dieser Genotyp Bb geschrieben. Schließlich wird der Genotyp eines Organismus mit zwei rezessiven Allelen als homozygot rezessiv bezeichnet. Im Beispiel der Augenfarbe wird dieser Genotyp mit bb geschrieben.

Von diesen drei Genotypen erzeugt nur bb, der homozygot-rezessive Genotyp, einen Phänotyp von blauen Augen. Der heterozygote Genotyp und der homozygot dominante Genotyp produzieren beide braune Augen, obwohl nur der heterozygote Genotyp das Gen für blaue Augen weitergeben kann.

Die homozygot dominanten, homozygot rezessiven und heterozygoten Genotypen sind nur für einige Gene und einige Merkmale verantwortlich. Die meisten Merkmale sind tatsächlich komplexer, da viele Gene mehr als zwei Allele haben und viele Allele auf komplexe Weise interagieren.

Viele körperliche Merkmale wie Haarfarbe und -struktur, Augenfarbe und Hautfarbe werden durch die Genotypen bestimmt, die Eltern an ihre Kinder weitergeben.


Materialien

  • Ausdruck der Alien Genotype Table und Alien Phänotype Table
  • Tonpapier, verschiedene Farben (orange und grün müssen dabei sein)
  • Schere
  • Band
  • Kleber
  • Marker, Buntstifte oder Farbstifte
  • Bleistifte
  • Zwei Münzen

Sie können die Schüler auch ihre außerirdischen Babys zeichnen lassen, anstatt sie aus Tonpapier zu bauen. In diesem Fall sind Tonpapier, Schere, Klebeband und Kleber nicht erforderlich.


KONTROLLPUNKTE FÜR DIE GENEXPRESSION

Alle Stadien der Genexpression sind Punkte, an denen eine Regulation ausgeübt werden kann. Der primäre Kontrollpunkt liegt jedoch auf der Ebene der Transkription. Viele Promotoren und Enhancer von myokardialen Genen wurden kloniert und Transkriptionsfaktoren, die im Herzen aktiv sind und zu einer Vielzahl von Genfamilien gehören, wurden in den letzten Jahren identifiziert (Tabelle 1). 4– 9 Die überwältigende Beobachtung ist, dass die Expression einzelner Gene reguliert wird (1) durch die koordinierte Bindung verschiedener Arten von Transkriptionsfaktoren, (2) durch Interaktionen zwischen Faktoren und mit zusätzlichen Cofaktoren wie Histonacetylasen ( HATs) oder Deacetylasen (HDACs), die nicht unbedingt selbst an DNA binden, und (3) über Signalübertragungswege, die ihre Aktivität beispielsweise durch Phosphorylierung beeinflussen. 3 Die meisten Transkriptionsfaktoren sind modular aufgebaut und enthalten trennbare Proteindomänen, die eine bestimmte Funktion wie DNA-Bindung, Dimerisierung mit anderen Familienmitgliedern (zum Beispiel die verwandten bHLH-Proteine ​​HIF-1α und β, Produkte separater Gene 9 ) erfüllen oder als transkriptionale Aktivierungsdomänen (BISSCHENs) um die Transkription auf hohem Niveau zu fördern. Schließlich interagieren Transkriptionsfaktoren, sobald sie an DNA gebunden sind, mit anderen gebundenen Proteinen und wirken, um die Geschwindigkeit der RNA-Synthese zu erhöhen. Die TAD-Aktivität, die oft durch Einführen klonierter Transkriptionsfaktoren in in Kultur gezüchtete Zellen (siehe unten) gemessen wird, kann intrinsisch sein oder die Bindung eines Co-Aktivators oder Co-Faktor-Proteins widerspiegeln, das selbst signifikante Aktivierungseigenschaften besitzt. Myokardin ist beispielsweise ein kürzlich identifizierter herzrestriktionierter Cofaktor für den ubiquitär exprimierten Serum-Response-Faktor (SRF). 6 SRF bindet an die Promotoren mehrerer Gene, die im Herzen exprimiert werden, einschließlich des kardialen α-Aktins, und es hat sich gezeigt, dass es mit vielen Faktoren interagiert, einschließlich der homöobox Faktor Nkx-2.5 und der Zinkfingerfaktor GATA-4, um den Ausdruck zu regulieren. Im Kontrast zu Nkx-2.5 und GATA-4, die selbst Transkriptionsaktivatoren sind, bindet Myocardin nicht an DNA, sondern komplexiert mit gebundenem SRF und dient als extrem potenter Cofaktor für die Transkription, der in Kombination mit SRF eine bis zu tausendfache Aktivierung fördert.

Einige Beispiele für wichtige Transkriptionsfaktoren, die im Herzen exprimiert werden

Transkriptionsfaktoren können stark gewebebeschränkt oder in bestimmten Entwicklungsstadien exprimiert werden, wodurch wiederum die Expression ihrer Zielgene reguliert wird. Beispielsweise werden GATA-Faktoren von den frühesten nachweisbaren Stadien der Kardiogenese an exprimiert und können in dieser Phase eine Rolle bei der Genregulation spielen. 10 Später, Nkx2.5 zeigt regionale Variation in der Expression und kann eine spezifische Rolle im sich entwickelnden myokardialen Erregungsleitungssystem spielen. Die meisten Transkriptionsfaktoren können auf der Grundlage der Sequenzähnlichkeit in funktionell wichtigen Regionen, wie einer DNA-Bindungsdomäne oder einer Proteindimerisierungsschnittstelle, in Genfamilien gruppiert werden. Ein solch hoher Grad an Sequenzhomologie ermöglicht die Entdeckung neuer Familienmitglieder durch das Durchsuchen von DNA- oder Proteinsequenzdatenbanken über verschiedene Stämme hinweg. Auf diese Weise Nkx-2.5 wurde als das Säugetierhomolog von a . identifiziert Drosophila Gen namens Zinnmann, (benannt nach einem der Zeichen in Der Zauberer von Oz) ursprünglich als Mutation identifiziert, die zu einer fehlenden Entwicklung des Herzäquivalents in der Fliege, dem Rückengefäß, führte. 8 Beim Menschen sind Mutationen im Nkx-2.5 Gen wurden mit einer Vielzahl von Herzanomalien korreliert, einschließlich der Fallot-Tetralogie und dem idiopathischen atrioventrikulären Block. 11

Gegenwärtig besteht ein erneutes Interesse an der Rolle, die die Chromatinstruktur bei der Regulierung der Genexpression spielt. 12 Es ist seit langem bekannt, dass, wenn DNA in Form von Chromatin um Histone gewickelt wird, die Genaktivität zum Schweigen gebracht wird und dass das lokalisierte Abwickeln der DNA vom Chromatin, begleitet von der Histonverdrängung, für das Fortschreiten der Genexpression von entscheidender Bedeutung ist. Im Mittelpunkt neuerer Studien stand die Identifizierung und biochemische Charakterisierung von Proteinen, die HAT- oder HDAC-Aktivität besitzen, indem Acetylgruppen von exponierten Lysinresten auf Histone hinzugefügt bzw. entfernt werden. Die HAT-Aktivität korreliert mit der Aktivierung der Genexpression, während die HDAC-Aktivität zu einer Repression führt. 13 In mehreren Fällen wurde gezeigt, dass die Funktionen dieser Proteine ​​eng mit dem Zustand der Bindung von Transkriptionsfaktoren an Zielgene verbunden sind. Zum Beispiel erfasst die aktive heterodimere Form des basischen Helix-Loop-Helix-Transkriptionsfaktors HIF-1 (Tabelle 1) Veränderungen des Sauerstoffpartialdrucks und wirkt somit als Hypoxiesensor in mehreren Systemen, einschließlich Angiogenese und Gefäßremodellierung. 9 Sobald die C-terminalen TADs im HIF-Heterodimer an die DNA der Zielgene zur Regulation gebunden sind, interagieren sie mit transkriptionellen Co-Aktivatoren wie dem CREB-bindenden Protein CBP. (Im Herzmuskel ist der wahrscheinlichste Co-Aktivator das verwandte Protein p300). Diese großen Proteine ​​besitzen eine intrinsische Chromatin-Remodeling-Aktivität, indem sie noch mehr Proteine ​​an die DNA rekrutieren, die es dem Chromatin ermöglichen, sich zu lösen. Das wahrscheinlich am besten verstandene System ist derzeit dasjenige, das Retinoid- und Steroidhormonrezeptoren wie den Schilddrüsenhormonrezeptor α1 (TRα1) umfasst, der, sobald er seinen verwandten Liganden T3 gebunden hat, die Expression von Genen wie der schweren Kette des kardialen α-Myosins aktiviert. 2 Die Bindung von T3 an die Hormonbindungsdomäne von TRα1 führt zu einer Konformationsänderung in der Proteinstruktur, die es dem Rezeptor ermöglicht, mit Co-Aktivatoren zu interagieren. Das Nettoergebnis ist, dass die HAT-Aktivität die lokalisierte Entwindung von Chromatin fördert, was den Zugang von RNA pol II und basalen Transkriptionsfaktoren zur DNA ermöglicht. In Abwesenheit von T3 bindet der nukleäre Rezeptor immer noch an DNA, interagiert jedoch stattdessen mit Corepressoren wie N-CoR und SMRT, die dann HDACs an die DNA rekrutieren, was zur Chromatinkondensation und Unterdrückung der Genexpression führt. 14

Die Aktivierung von Transkriptionsfaktoren durch Phosphorylierung ist ein Brennpunkt für die Transduktion extrazellulärer Stimuli durch MAP-Kinase-Signaltransduktionswege. Zum Beispiel assoziiert CBP nur mit der phosphorylierten Form des CREB-Proteins, einem Transkriptionsfaktor, der das zyklische AMP-Antwortelement bindet, das in vielen Genpromotoren gefunden wird. Sobald es an CREB gebunden ist, bildet CBP Protein-Protein-Wechselwirkungen mit dem basalen Transkriptionsfaktor TFIIB, wodurch die Transkription durch RNA pol II fortschreiten kann. Mitglieder der Myocyte Enhancer Factor-2 (MEF-2)-Familie von Transkriptionsfaktoren (Tabelle 1), die häufig exprimiert werden, aber angereichert zu sein scheinen und eine besondere Rolle im Skelett- und Herzmuskel spielen, können Veränderungen in der Genexpression regulieren, die von a hypertropher Reiz. MEF-2-Proteine ​​wurden als Responder auf MAP-Kinasen in Verbindung gebracht, die durch hypertrophe Stimuli in Herzmyozyten aktiviert werden.15 Die hypertrophen Agonisten Endothelin-1 und Phenylepherin aktivieren p38-MAPKs in kultivierten neonatalen Herzmyozyten der Ratte 16, und in vivo steigt die p38-Aktivität in Aortenband-Mäusen, die eine drucküberlastete Hypertrophie entwickeln (Wang und Kollegen 1998, zitiert in Han und Molkentin 15 ). Bei Ratten führt eine ähnlich induzierte Hypertrophie zu einer Erhöhung der DNA-Bindungsaktivität von MEF-2. 17 Da die Entwicklung einer Hypertrophie mit Veränderungen in der Transkription verschiedener myokardialer Gene verbunden ist, die MEF-2 benötigen, deutet dies darauf hin, dass MEF-2 ein direktes Ziel für die MAP-Kinase-Signalübertragung sein könnte (Abb. 2).

Verknüpfung von MEF2 mit Hypertrophie. Hypertrophe Reize aktivieren intrazelluläre Signalwege. Upstream-Proteinkinasen (zum Beispiel MEKKs) aktivieren Mitglieder der MAP-Kinase-Familie (MKKs), die wiederum die drei MAP-Kinasen p38-MAPK, JNKs und ERKs phosphorylieren. MAP-Kinasen wurden mit der Phosphorylierung bestimmter Transkriptionsfaktoren in Verbindung gebracht, zum Beispiel wurde gezeigt, dass p38-MAPK Mitglieder der MEF2-Familie aktiviert (siehe Text für Details). Dies impliziert MEF2-Proteine ​​als direkte Transducer intrazellulärer Signalwege, um einige oder alle der mit Hypertrophie verbundenen Veränderungen der Genexpression herbeizuführen. Abbildung mit freundlicher Genehmigung von KA Dellow.

Ein zweiter Punkt, an dem die Genexpression kontrolliert werden kann, liegt auf der Ebene des mRNA-Spleißens. Das primäre RNA-Transkript vieler Gene kann alternativ gespleißt werden, indem bestimmte Exons aus dem Transkript ausgeschlossen oder eingeschlossen werden können, um die endgültige mRNA zu produzieren. Auf diese Weise können mehrere Proteine ​​aus einem einzelnen Gen gemäß der Kombination von Exon-abgeleiteten RNA-Segmenten erzeugt werden, die zusammen gespleißt werden. Die Tropomyosin (TM)-Gene von Vertebraten sind Beispiele für Gene, die sowohl im Herz- als auch im Skelettmuskel exprimiert werden und komplexen Mustern des alternativen mRNA-Spleißens unterliegen. Zum Beispiel zwei Isoformen des α-TM-Gens in Xenopus, unterscheiden sich in ihrem Einschluss alternativer 3`untranslatierter Regions-Exons und zeigen eine eingeschränkte Expression im Embryo. 18 Die Isoform XTMα7 findet sich in den Somiten, aus denen sich der Skelettmuskel entwickelt, während die Isoform XTMα2 sowohl in Somiten als auch im embryonalen Herzen exprimiert wird. Beim Erwachsenen wird XTMα2, jedoch nicht XTMα7, selektiv im quergestreiften Muskel und im Herzen exprimiert.

Nach der Translation der mRNA in ein Polypeptid kann die Produktion von reifem aktivem Protein mehrere Schritte erfordern, von denen jeder für die Regulierung offen ist. Dies wird gut durch die Matrix-Metallproteinasen (MMPs) veranschaulicht, von denen angenommen wird, dass sie eine Schlüsselrolle beim myokardialen Remodelling spielen. 19 MMPs werden in inaktiver Form (als Zymogen) produziert, die zur Bildung eines aktiven Enzyms gespalten werden müssen und durch spezifische inhibitorische Moleküle (Gewebeinhibitoren von Metalloproteinasen oder TIMPs) weiter reguliert werden. Die Untersuchung der MMP-Genexpression auf RNA-Ebene ist für das Verständnis der Genregulation wichtig, kann jedoch kein guter Indikator für die MMP-Enzymaktivität sein. Natürlich ist es wichtig, das fragliche biologische System zu verstehen, bevor entschieden wird, welches die relevanteste Regulierungsebene ist. Für die Zwecke dieses Übersichtsartikels konzentrieren wir uns auf das Anfangsstadium der Genexpression, nämlich die Transkription, und die Methoden, dies zu untersuchen sowie den RNA-Gehalt zu überwachen.


Wie identifiziere und isoliere ich ein Gen, das für einen bestimmten beobachtbaren Phänotyp kodiert - Biologie

C   Cytosin-Rest in DNA oder RNA.

CAAT-Box   (auch CAT-Box)  Eine konservierte Sequenz, die in der Promotorregion der proteinkodierenden Gene vieler eukaryontischer Organismen vorkommt. Es hat die Konsensussequenz GGCCAATCT, es tritt etwa 75 Basen vor der Transkriptionsinitiationsstelle auf und ist eine von mehreren Stellen für die Erkennung und Bindung von regulatorischen Proteinen, die als Transkriptionsfaktoren bezeichnet werden.

Kabinett   Siehe Wachstumskabinett.

Wadenschuppen. Ein wässriger Durchfall bei Kälbern.

Kallus   (L. Callum, dicke Haut pl: Schwielen oder Kalli) ف. Ein Schutzgewebe, bestehend aus Parenchymzellen, das sich über einer eingeschnittenen oder beschädigten Pflanzenoberfläche entwickelt.

2. Masse unorganisierter, dünnwandiger Parenchymzellen durch Hormonbehandlung.

3. Sich aktiv teilende unorganisierte Massen undifferenzierter und differenzierter Zellen, die sich oft aus einer Verletzung (Verwundung) oder in Gewebekulturen in Gegenwart von Wachstumsregulatoren entwickeln.

Kalluskultur   Eine Technik der Gewebekultur, die in der Regel auf verfestigtem Medium erfolgt und durch Inokulation kleiner Explantate oder Schnitte aus etablierten Organ- oder anderen Kulturen (den Inokula) eingeleitet wird. Die Kalluskultur wird als Grundlage für organogene (Spross-, Wurzel-)Kulturen, Zellkulturen oder die Vermehrung von Embryoiden verwendet. Kalluskulturen können durch regelmäßiges Unterkultivieren auf unbestimmte Zeit aufrechterhalten werden.

Kalorien (Abk.: cal)  Entspricht der Wärmemenge, die erforderlich ist, um die Temperatur von 1 g Wasser von 14,5°C auf 15,5°C zu erhöhen ( 4,19 J). cf Kilokalorie.

Kelch   (Gr. kalyx, eine Schale, Tasse)  Alle Kelchblätter einer Blüte zusammen betrachtet. Der äußerste Wirbel der Blütenteile.

Kambialzone   Region in Stämmen und Wurzeln, bestehend aus dem Kambium und seinen jüngsten Derivaten.

Kambium   (L. Kambium, eine der nährenden Körperflüssigkeiten, die die Körperorgane nähren sollen, pl: Kambium). Eine Schicht, die normalerweise als eine oder zwei Zellen dick angesehen wird, aus anhaltend meristematischem Gewebe zwischen dem Xylem- und Phloemgewebe, die zu sekundären Geweben führt und so zu einer Vergrößerung des Durchmessers führt. Die beiden wichtigsten Kambien sind das vaskuläre (faszikuläre) Kambium und das Korkkambium.

Krebs   Unkontrolliertes Wachstum der Zellen eines Gewebes oder Organs in einem vielzelligen Organismus. vgl. Onkogenese.

Kandidatengen   A-Gen, dessen Funktion darauf hindeutet, dass es an der für ein bestimmtes Merkmal beobachteten genetischen Variation beteiligt sein könnte, z. B. ist das Gen für Wachstumshormon ein Kandidatengen für das Körpergewicht.

Kandidatengen-Strategie   Ein experimenteller Ansatz, bei dem Kenntnisse der Biochemie und/oder Physiologie eines Merkmals verwendet werden, um eine Liste von Genen zu erstellen, deren Proteinprodukte an dem Merkmal beteiligt sein könnten.

Eckzahn   Bezieht sich auf Hunde.

canola   Eine von mehreren Sorten von Raps (genauer: Rapsöl) das Pflanzenöl mit einem hohen Gehalt an einfach ungesättigten Fettsäuren, das aus diesen Sorten gewonnen wird.

cap   Die Struktur am 5´-Ende der eukaryotischen mRNA, bestehend aus einem invertierten, methylierten Guanosinrest. Siehe G-Kappe.

cap site   Die Stelle in einem Gen, an der die Translation initiiert wird, auch bekannt als Translationsinitiationsstelle.

Kapazitation   Die letzte Phase des Reifungsprozesses eines Spermatozoons, die im weiblichen Genitaltrakt stattfindet, wenn das Sperma in die Eizelle eindringt.

Kapsid   Die Proteinhülle eines Virus. Das Kapsid bestimmt oft die Form des Virus. Siehe Hüllprotein.

Kohlenhydrat   Eine organische Verbindung basierend auf der allgemeinen Formel C x  (H 2 O) y , die viele lebenswichtige Funktionen in lebenden Organismen erfüllt. Die einfachsten Kohlenhydrate sind die Zucker (Saccharide), einschließlich Glucose und Saccharose. Polysaccharide sind Kohlenhydrate mit viel höherem Molekulargewicht und Komplexität Beispiele sind Stärke, die als Energiespeicher in Pflanzensamen und Knollen dient, Zellulose und Lignin, die die Zellwände und das holzige Gewebe von Pflanzen bilden, Glykogen usw.

Carbowax   Siehe Polyethylenglykol.

krebserregende Substanz, die in einem Organismus Krebs auslösen kann.

Karzinom   Ein bösartiger Tumor, der aus Epithelgewebe entsteht, das die Haut und die äußeren Zellschichten der inneren Organe bildet.

Carotin   (L. carota, carrot)  Ein rötlich-oranges Plastidenpigment, das an Lichtreaktionen bei der Photosynthese beteiligt ist.

Carotinoid   Rote bis gelbe Pigmente, die für die charakteristische Farbe vieler Pflanzenorgane oder Früchte wie Tomaten, Karotten usw. verantwortlich sind. Oxidationsprodukte von Carotin werden als Xanthophylle bezeichnet. Carotinoide dienen als lichtsammelnde Moleküle in photosynthetischen Anordnungen und spielen auch eine Rolle beim Schutz von Prokaryonten vor den schädlichen Auswirkungen von Licht.

Carboxypeptidasen   Zwei Enzyme (A und B) im Pankreassaft. Ihre Rolle besteht darin, die C-terminale Aminosäure aus einem Peptid zu entfernen. Die A-Form entfernt jede Aminosäure, die B-Form entfernt nur Lysin oder Arginin. Wird beim Sequenzieren von Peptiden verwendet.

Fruchtblatt   Weibliches Fortpflanzungsorgan von Blütenpflanzen, bestehend aus Narbe, Griffel und Fruchtknoten. Bei einigen Pflanzen vereinigen sich ein oder mehrere Fruchtblätter zum Stempel.

Träger   In der Genetik typischerweise ein Individuum, das ein rezessives mutiertes Allel für einen defekten Zustand hat, das durch ein dominantes normales Allel am selben Locus "maskiert" wird, dh ein Individuum, das heterozygot für ein rezessives schädliches Allel und ein dominantes normales Allel ist Allel ist der Phänotyp normal, aber das Individuum gibt das defekte (rezessive) Allel an die Hälfte seiner Nachkommen weiter.

Träger-DNA   DNA mit undefiniertem Sequenzgehalt, die der transformierenden (Plasmid-)DNA hinzugefügt wird, die in physikalischen DNA-Transferverfahren verwendet wird. Diese zusätzliche DNA erhöht die Effizienz der Transformation bei Elektroporation und chemisch vermittelten DNA-Abgabesystemen. Der für diesen Effekt verantwortliche Mechanismus ist nicht bekannt. Siehe auch chimäres Gen des binären Vektorplasmids.

Trägergas   Das Gas, das die Probe in der Gaschromatographie trägt.

Trägermolekül  ف. Ein Molekül, das eine Rolle beim Transport von Elektronen durch die Elektronentransportkette spielt. Trägermoleküle sind normalerweise Proteine, die an Nicht-Proteingruppen gebunden sind und relativ leicht oxidiert und reduziert werden können, wodurch Elektronen fließen können.

2. Ein fettlösliches Molekül, das an fettunlösliche Moleküle binden und diese durch Membranen transportieren kann. Trägermoleküle haben spezifische Stellen, die mit den von ihnen transportierten Molekülen interagieren. Die Effizienz von Trägermolekülen kann modifiziert werden, indem die interagierenden Stellen durch Gentechnik modifiziert werden.

Kasein   A Gruppe von Proteinen in Milch gefunden.

Caseinhydrolysat   Mischung aus Aminosäuren und Peptiden, hergestellt durch enzymatische oder saure Hydrolyse von Casein. cf  organischer Komplex undefiniert.

katabolischer Weg   A-Weg, durch den ein organisches Molekül abgebaut wird, um Energie für das Wachstum und andere zelluläre Prozesse des Abbauweges freizusetzen.

Katalyse   Der Prozess der Änderung der Geschwindigkeit einer chemischen Reaktion durch die Verwendung eines Katalysators.

Katabolismus   Der metabolische Abbau großer Moleküle im lebenden Organismus mit begleitender Energiefreisetzung.

Katabolitrepression   Glucose-vermittelte Reduktion der Transkriptionsraten von Operons, die Enzyme kodieren, die an katabolen Stoffwechselwegen beteiligt sind (wie das lac-Operon).

Katalysator  ( Gr. katalyein , sich auflösen)  Eine Substanz, die eine chemische Reaktion fördert, indem sie die Aktivierungsenergie einer chemischen Reaktion senkt, ohne selbst eine dauerhafte chemische Veränderung zu erfahren. Der Prozess ist Katalyse. vgl. katalytische Antikörper-katalytische RNA.

katalytischer Antikörper (= Abzym)  Ein Antikörper, der aufgrund seiner Fähigkeit ausgewählt wurde, eine chemische Reaktion zu katalysieren, indem er an das Übergangszustands-Zwischenprodukt bindet und dieses stabilisiert.

katalytische RNA (= Ribozym-Genschere)  Ein natürliches oder synthetisches RNA-Molekül, das ein RNA-Substrat schneidet.

Kation   Ein positiv geladenes Ion gegenüber ist Anion.

caulogenesis   Stammorganogenese Induktion der Sprossentwicklung aus Kallus.

CD-Moleküle Cluster von Differenzierungsmolekülen   Jede Gruppe von Antigenen, die mit einer bestimmten Subpopulation von T -Zellen assoziiert ist. Auf verschiedenen Zellen des Immunsystems gibt es Bezeichnungen für Oberflächenmoleküle, z. B. liegt CD4 auf der Oberfläche von T -Helferzellen vor.

cDNA-komplementäre DNA   Das doppelsträngige DNA-Komplement einer mRNA-Sequenz, die in vitro aus einer reifen RNA-Matrize unter Verwendung von reverser Transkriptase (zur Erzeugung eines DNA-Einzelstrangs aus der RNA-Matrize) und DNA-Polymerase (zur Erzeugung der Doppel- gestrandete DNA). Die Herstellung von cDNAs ist oft der erste Schritt beim Klonieren von interessierenden DNA-Sequenzen. Wird als spezifische und empfindliche Sonden in Hybridisierungsstudien verwendet, da cDNAs normalerweise keine regulatorischen oder anderen Kontrollsequenzen enthalten und daher verwendet werden können, um Gene und ihre assoziierten Sequenzen aus genomischer DNA zu identifizieren (sondieren) und zu isolieren. Siehe binäre Vektorträger-DNA.

cDNA-Klon   Ein doppelsträngiges DNA-Molekül, das in einem Vektor enthalten ist und in vitro aus einer mRNA-Sequenz unter Verwendung von reverser Transkriptase und DNA-Polymerase synthetisiert wurde.

cDNA-Klonierung   A Verfahren zum Klonen der kodierenden Sequenz eines Gens, beginnend mit seinem mRNA-Transkript. Es wird normalerweise verwendet, um eine DNA-Kopie einer eukaryontischen mRNA zu klonen. Die cDNA-Kopie, die eine Kopie eines reifen Botenmoleküls ist, enthält keine Intronsequenzen und kann in jedem Wirtsorganismus leicht exprimiert werden, wenn sie an eine geeignete Promotorsequenz innerhalb des Klonierungsvektors angehängt wird.

cDNA-Bibliothek   Eine Sammlung von cDNA-Klonen, die in vitro aus mRNA-Sequenzen generiert wurden, die aus einem Organismus oder einem bestimmten Gewebe- oder Zelltyp oder einer Population eines Organismus isoliert wurden. cf  Bibliothek .

CDR   (komplementaritätsbestimmende Regionen)  Dies sind Regionen der variablen (V) Regionen der leichten und schweren Antikörperketten, die mit dem Antigen in Kontakt treten. Die primären Aminosäuresequenzen dieser Regionen sind unter Antikörpern derselben Klasse stark variabel.

Zelle   (L. cella, kleiner Raum)  Die kleinste Struktureinheit der lebenden Materie, die unabhängig funktionieren kann, eine mikroskopisch kleine Protoplasmamasse, die von einer semipermeablen Membran umgeben ist, die normalerweise einen oder mehrere Kerne und verschiedene umfasst nicht lebende Produkte, die - entweder allein oder durch Interaktion mit anderen Zellen - in der Lage sind, alle grundlegenden Funktionen des Lebens zu erfüllen.

Zellkultur   Das In-vitro-Wachstum von Zellen, die aus mehrzelligen Organismen gewonnen werden. Die Zellen sind normalerweise von einem Typ.

Zellzyklus   Abfolge von Stadien, die eine Zelle zwischen einer Teilung und der nächsten durchläuft. Der Zellzyklus oszilliert zwischen Mitose und der Interphase, die in G, S und G 2 unterteilt ist. In der G-Phase gibt es eine hohe Biosynthese- und Wachstumsrate in der S-Phase gibt es die Verdoppelung des DNA-Gehalts als Folge der Chromosomenreplikation in der G2-Phase werden die letzten Vorbereitungen für die Zellteilung (Zytokinese) getroffen.

Zelldifferenzierung   Kontinuierlicher Verlust der physiologischen und zytologischen Eigenschaften junger Zellen, was dazu führt, dass die Eigenschaften erwachsener Zellen erhalten werden. Die unspezialisierten Zellen werden modifiziert und auf die Ausführung bestimmter Funktionen spezialisiert. Die Differenzierung resultiert aus der kontrollierten Aktivierung und Deaktivierung von Genen.

Zellteilung   Bildung von zwei oder mehr Tochterzellen aus einer einzigen Mutterzelle. Der Zellkern teilt sich zuerst, gefolgt von der Bildung einer Zellmembran zwischen den Tochterkernen. Teilung von Zytoplasma und Kern in zwei oder mehr Teile durch Bildung einer Zellplatte.

zellfreie Proteinsynthese zellfreies System    Siehe in vitro-Übersetzung.

zellfreie Transkription   Siehe In-vitro-Transkription.

zellfreie Translation    Siehe In-vitro-Translation.

Zellfusion   Bildung einer einzelnen Hybridzelle aus zwei in vitro kultivierten Zellen unterschiedlicher Spezies . Die Zellen verschmelzen und verschmelzen, aber ihre Kerne können getrennt bleiben. Während der anschließenden Zellteilung wird eine einzelne Spindel gebildet, so dass jede Tochterzelle einen einzigen Kern hat, der Chromosomensätze jeder Elternlinie enthält. Spätere Teilungen führen oft zum Verlust von Chromosomen und damit von Genen. Die Zellfusionstechnik kann verwendet werden, um die Kontrolle spezifischer Gene und deren Zuordnung zu Chromosomen zu bestimmen. cf Zellhybridisierung.

Zellgenerationszeit   Das Intervall zwischen dem Beginn aufeinanderfolgender Teilungen einer Zelle. Die Zeit, die eine Population einzelliger Organismen benötigt, um ihre Zellzahl zu verdoppeln. Aufeinanderfolgende Generationen von Zellen oder Organismen innerhalb einer Population werden durch ein Zeitintervall getrennt, das als Generationszeit bezeichnet wird. Die Zellregenerationszeit kann mit Hilfe der Zeitraffer-Mikrokinematographie bestimmt werden.

Zellhybridisierung   Die Verschmelzung von zwei oder mehr unterschiedlichen Zellen, die zur Bildung eines somatischen Hybrids führt. cf Zellfusion.

Zelllinie   A Zelllinie, die in Kultur gehalten werden kann. Eine Zelllinie entsteht aus einer Primärkultur. Dies impliziert, dass Kulturen daraus aus mehreren Linien der Zellen bestehen, die ursprünglich in der Primärkultur vorhanden waren.

zellvermittelte Immunantwort   Die Aktivierung von T Zellen des Immunsystems als Reaktion auf das Vorhandensein eines fremden Antigens.

Zellmembran   Die Membran, die die Zellwand und das Zytoplasma trennt und den Materialfluss in die und aus der Zelle reguliert. Siehe Plasmalemma.

Zellzahl   Die Anzahl der Zellen pro Volumeneinheit einer Kultur.

Zellplatte   Der Vorläufer der Zellwand, der gebildet wird, wenn die Zytokinese während der Zellteilung beginnt. Die Zellplatte entwickelt sich im Bereich der Äquatorialplatte und geht aus Membranen im Zytoplasma hervor.

Zellsaft   Wasser und gelöste Stoffe, Zucker, Aminosäuren, Abfallstoffe etc. in der Pflanzenzellvakuole.

Zellselektion   Der Prozess der Zellselektion innerhalb einer Gruppe genetisch unterschiedlicher Zellen. Ausgewählte Zellen oder Zellinien werden zur weiteren Selektion auf frischem Medium subkultiviert und werden oft einer erhöhten Konzentration des Selektionsmittels ausgesetzt. Das Endziel besteht darin, Pflanzen zu regenerieren, die die auf zellulärer Ebene ausgewählten Merkmale aufweisen.

Zellstamm   A Stamm von Zellen mit spezifischen Eigenschaften oder Markern, die durch Selektion oder Klonierung aus einer Primärkultur einer Zelllinie gewonnen wurden. Die ausgewählten Eigenschaften müssen bei der anschließenden Kultivierung erhalten bleiben. auch bekannt als Einzelzelllinie.

Zellsuspension   Cells in Culture in bewegtem oder geschütteltem flüssigem Medium, wird oft verwendet, um Suspensionskulturen von Einzelzellen und Zellaggregaten zu beschreiben. Siehe Suspensionskultur.

zelluläre Immunantwort   Siehe T-Zell-vermittelte (zelluläre) Immunantwort.

zelluläres Onkogen (Proto-Onkogen). Ein normales Säugetier- oder Vogelgen, das, wenn es mutiert oder falsch exprimiert wird, zur Entwicklung von Krebs beiträgt. Siehe Onkogen.

Cellulase   Enzym, das den Abbau von Cellulose katalysiert.

Cellulose   (Zelle + ose, ein Suffix, das ein Kohlenhydrat angibt)  Ein komplexes Kohlenhydrat, das aus langen, unverzweigten Ketten von Beta-Glucose-Molekülen ((1.4)-verknüpft-b-d-Glucose) besteht, die dazu beitragen zum strukturellen Gerüst von Pflanzenzellwänden. Es macht 40 bis 55 Gew.-% der Pflanzenzellwand aus.

Cellulosenitrat   Siehe Nitrocellulose.

Cellulosom   Ein Multiproteinaggregat, das in einigen cellulolytischen Mikroorganismen vorhanden ist und mehrere Kopien aller Enzyme enthält, die zum vollständigen Abbau von Cellulose erforderlich sind. Dieser Komplex wird häufig auf der äußeren Oberfläche von cellulolytischen Mikroorganismen gefunden.

Zellwand   A feste äußere Hülle, die Pflanzenzellen umgibt. Es wird außerhalb des Plasmalemmas gebildet und besteht hauptsächlich aus Zellulose.

centiMorgan (cM)   Ein Prozent Rekombination zwischen zwei Loci. Siehe Kartenabstand Crossing-Over-Einheit.

zentrales Dogma   Das grundlegende Konzept, dass genetische Informationen in der Natur im Allgemeinen nur von DNA über RNA zu Proteinen fließen können. Inzwischen ist jedoch bekannt, dass Informationen, die in RNA-Molekülen bestimmter Viren (sogenannte Retroviren) enthalten sind, auch in die DNA zurückfließen können.

zentrale Mutterzelle   A unter der Oberfläche befindliche Zelle, die sich in einem Apikalmeristem der Pflanze befindet und durch eine große Vakuole gekennzeichnet ist.

Ursprungszentren   Die Orte auf der Welt, an denen bestimmte domestizierte Pflanzen ihren Ursprung haben. Diese Gebiete zeigen die höchste Variation und sind reich an wilden Allelen.

Zentrifugation   Trennung von Molekülen nach Größe oder Dichte unter Verwendung von Zentrifugalkräften, die von einem sich drehenden Rotor erzeugt werden. Bei der Ultrazentrifugation werden G-Kräfte von mehreren hunderttausendfacher Schwerkraft erzeugt. Siehe Dichtegradientenzentrifugation.

Zentrifuge   A Gerät, in dem feste oder flüssige Partikel unterschiedlicher Dichte durch Rotation in einem Röhrchen in einem horizontalen Kreis getrennt werden. Die dichteren Partikel neigen dazu, sich entlang der Röhrenlänge zu einem größeren Rotationsradius zu bewegen, wodurch die leichteren Partikel zum anderen Ende verdrängt werden.

Centriole   Eine Organelle in vielen tierischen Zellen, die während der Mitose an der Bildung der Spindel beteiligt zu sein scheint. Während der Zellteilung bewegen sich die beiden Zentriolen zu gegenüberliegenden Seiten des Zellkerns, um die Enden der Spindel zu bilden.

Zentromer   Der Teil des Chromosoms, an dem sich die Spindelfasern während der mitotischen und meiotischen Teilung anlagern. Es tritt als Verengung auf, wenn sich Chromosomen während der Zellteilung zusammenziehen. Nach der chromosomalen Duplikation, die zu Beginn jeder mitotischen und meiotischen Teilung auftritt, werden die beiden resultierenden Chromatiden am Zentromer verbunden.

Centrosom   Eine spezialisierte Region einer lebenden Zelle, die sich neben dem Zellkern befindet, in der Mikrotubuli während der Zellteilung zusammengesetzt und abgebaut werden. Das Zentrosom der meisten tierischen Zellen enthält ein Paar Zentriolen. Während der Metaphase teilt sich das Zentrosom in zwei Regionen, von denen jede eines der Zentriolen enthält.

Antibiotikum vom Cephem-Typ   Ein Antibiotikum, das die grundlegende chemische Struktur von Cephalosporin teilt.

Kettenabschluss  ف. Codons, die nicht für eine Aminosäure kodieren. Sie signalisieren Ribosomen, die Proteinsynthese zu beenden. Die Codons sind UAA, UAG und UGA und wurden als Ocker, Bernstein bzw. Opal bezeichnet. Auch als Stopcodons oder Terminationscodons bekannt. Häufig finden sich zwei dieser Codons zusammen am Ende einer kodierenden RNA-Sequenz.

2. Bei der DNA-Sequenzierung nach Sanger werden Di-Desoxynukleosidtriphosphate als Kettenabbrecher bei der Synthese eines komplementären DNA-Strangs hinzugefügt.

Charakter   Ein charakteristisches Merkmal eines Organismus.

Charakterisierung   1. Von AnGR: Alle Aktivitäten im Zusammenhang mit der Beschreibung von AnGR zielen auf eine bessere Kenntnis dieser Ressourcen und ihres Zustands ab. (Quelle: FAO, 1999)

Die Charakterisierung seiner AnGR durch ein Land umfasst die Entwicklung notwendiger Deskriptoren für die Identifizierung der souveränen AnGR-Basislinie des Landes und die fortgeschrittene Erhebung dieser Populationen, einschließlich ihrer Zählung und visuellen Beschreibung, ihrer vergleichenden genetischen Beschreibung in einer oder mehreren Produktionsumgebungen, ihrer Bewertung, und laufende Überwachung der gefährdeten AnGR. (Quelle: FAO, 1999)

2. Von PGR: Systematische Erfassung von Deskriptoren, die unabhängig von Umweltfaktoren sind.

Holzkohle   Die schwarzen porösen Rückstände von teilweise verbranntem Holz, Knochen usw. eine Form von Kohlenstoff. Bei einer Behandlung zur Reinigung und Steigerung der Adsorptionskraft wird sie als Aktivkohle (q.v.) bezeichnet und in dieser Form dem Nährmedium zugesetzt, um die Bräunung zu verhindern oder zu verringern.

Chelat   Noun: Komplexes organisches Molekül, das sich mit Kationen verbinden kann und nicht ionisiert. Chelate können Pflanzen langsam und gleichmäßig Mikronährstoffe zuführen. Wird normalerweise verwendet, um Pflanzenzellen mit Eisen zu versorgen.

chemisch definiertes Medium   Wenn alle chemischen Komponenten eines Pflanzengewebekulturmediums vollständig bekannt und definiert sind. cf  undefinierter organischer Komplex.

chemisches Mutagen   Eine Chemikalie oder ein Produkt, das in lebenden Organismen, die ihm ausgesetzt sind, genetische Mutationen verursachen kann.

Chemilumineszenz   Die Emission von Licht aus einer chemischen Reaktion.

Chemostat   Eine kontinuierliche und offene Kultur, in der Wachstumsrate und Zelldichte durch eine feste Zufuhrrate eines wachstumslimitierenden Nährstoffs konstant gehalten werden. cf  Phytostat.

Chemotaxis   Bewegung einer beweglichen Zelle, eines Organismus oder eines Teils zu oder weg von einer ansteigenden Konzentration einer bestimmten Substanz.

Chemotherapie   Die Behandlung von Krankheiten, insbesondere Infektionen oder Krebs, mit Hilfe von Chemikalien. Bei der Behandlung von Krebs werden Chemikalien verabreicht, die für bösartige Zellen toxisch sind.

chiasma   (Gr. chiasma, zwei kreuzweise platzierte Linien pl. chiasmata)  A sichtbarer Verbindungspunkt zwischen zwei Nicht-Schwesterchromatiden homologer Chromosomen während der ersten meiotischen Prophase. auch bekannt als Crossover. Im diplotenen Stadium der Prophase I der Meiose sind die vier Chromatiden eines Bivalents paarweise verbunden, jedoch so, dass ein Teil von zwei Chromatiden ausgetauscht wird.

Chimäre (oder Chimäre)  Von Chimäre, eine mythologische Kreatur mit dem Kopf eines Löwen, dem Körper einer Ziege und dem Schwanz einer Schlange. Ein Organismus, dessen Zellen nicht alle von derselben Zygote stammen.

1. Tier. Ein Individuum, das zwei oder mehr Genotypen in Patches aufweist, die von zwei oder mehr Embryonen stammen. Ein Individuum, das durch experimentelle Intervention aus zwei Embryonen gewonnen wurde.

2. Pflanze. Teil einer Pflanze mit genetisch anderer Konstitution als andere Teile derselben Pflanze. Es kann aus verschiedenen Zygoten resultieren, die zusammenwachsen, oder durch künstliche Verschmelzung (Transplantation) es kann entweder eine periklinale Chimäre sein, bei der ein Gewebe wie ein Handschuh über dem anderen liegt Meriklinale Chimäre, bei der das äußere Gewebe das innere nicht vollständig bedeckt Gewebe- und Sektorchimäre, bei der die Gewebe nebeneinander liegen.

3. Ein rekombinantes DNA-Molekül, das Sequenzen aus verschiedenen Organismen enthält.

chimäre DNA   A rekombinantes DNA-Molekül, das nicht verwandte Gene enthält.

chimäres Gen   Ein halbsynthetisches Gen, bestehend aus der kodierenden Sequenz eines Organismus, fusioniert mit dem Promotor und anderen Sequenzen, die von einem anderen Gen abgeleitet sind. Die meisten Gene, die bei der Transformation verwendet werden, sind chimär. Siehe Träger-DNA-Binärvektor-Plasmid-Transformationsvektor.

chimäres Protein    Siehe Fusionsprotein.

chimäres selektierbares Markergen   A-Gen, das aus Teilen von zwei oder mehr verschiedenen Genen aufgebaut ist und es der Wirtszelle ermöglicht, unter Bedingungen zu überleben, unter denen sie sonst sterben würde.

Chi-Quadrat-Test   (c2-Test)  Ein Signifikanztest, der verwendet wird, um die Güte der Anpassung beobachteter Daten an eine Vorhersage statistisch zu bewerten.

Chitin   A stickstoffhaltiges Polysaccharid, das als Skelettmaterial in vielen Wirbellosen und Pilzen vorkommt.

Chitinase   Ein Enzym, das Chitin abbaut.

Chloramphenicol   Ein Antibiotikum, das die Proteinsynthese stört.

Chlorenchym   (Gr. Chloros, Grün + Enchym, ein Suffix für Gewebe)  Gewebe, das Chloroplasten enthält, einschließlich Blattmesophyll und andere Parenchymzellen.

Chlorophyll   (Gr. Chloros, Grün + Phyllon, Blatt)  Eines der beiden Pigmente, die für die grüne Farbe der meisten Pflanzen verantwortlich sind. Es ist wichtig bei der Absorption von Lichtenergie für die Photosynthese.

Chloroplast   (Gr. Chloros, grün + Plastos, gebildet)  Spezialisierte zytoplasmatische Organelle, die Chlorophyll enthält. Linsenförmig und von einer Doppelmembran begrenzt enthalten Chloroplasten häutige Strukturen (Thylakoide), die zu Stapeln aufgetürmt sind und von einer gelartigen Matrix (Stroma) umgeben sind. Sie sind der Ort der Sonnenenergieübertragung und wichtiger Reaktionen der Stärke- oder Zuckersynthese. Chloroplasten haben ihre eigene DNA und werden zytoplasmatisch vererbt, unabhängig von nuklearen Genen.

Chloroplastid    Siehe Chloroplast.

Chlorose   (Gr. Chloros, grün + osis, krankhafter Zustand)  Ausbleiben der Chlorophyllentwicklung und Auftreten von Gelbfärbung bei Pflanzen aufgrund einer Ernährungsstörung oder aufgrund einer Infektion durch ein Virus, Bakterien oder Pilz.

Chromatid   (Chromosom + ID, L. Suffix bedeutet "Töchter von") Jeder der beiden Tochterstränge umfasst ein dupliziertes Chromosom. Der Begriff bleibt in Gebrauch, solange die beiden Chromatiden noch am Zentromer verbunden sind. Sobald sich das Zentromer teilt und die beiden Chromatiden driftet (während der Anaphase der Mitose und während der Anaphase II der Meiose), werden sie Chromosomen genannt.

Chromatin   (Gr. Chroma, Farbe)  Substanz, aus der eukaryotische Chromosomen bestehen. Es besteht hauptsächlich aus DNAm mit einigen Proteinen (hauptsächlich Histone) und kleinen Mengen an RNA. Ursprünglich benannt wegen der Bereitschaft, mit der es mit bestimmten Farbstoffen färbt (Chromatizität).

Chromatinfasern   Eine grundlegende Organisationseinheit eukaryontischer Chromosomen, bestehend aus DNA und assoziierten Proteinen, die zu Strängen mit einem durchschnittlichen Durchmesser von 30 nm zusammengesetzt sind.

Chromatographie   (Gr. Chroma, Farbe + Graphein , was Zeichnen oder Schreiben bedeutet) 1. Eine Methode zur Trennung und Identifizierung der Komponenten von Mischungen von Molekülen mit ähnlichen chemischen und physikalischen Eigenschaften.

2. Der Begriff, der ursprünglich von Mikhail Tswett (1906) verwendet wurde, um die Trennung einer Mischung von Blattpigmenten auf einer Calciumcarbonatsäule zu beschreiben.

Chromozentrum   Körper, der durch Verschmelzung der heterochromatischen Regionen der Chromosomen in den polytänen Geweben (z. B. den Speicheldrüsen) bestimmter Dipteren entsteht.

chromogenes Substrat   Eine Verbindung oder Substanz, die eine farbbildende Gruppe enthält.

Chromomere  Kleine Körper, beschrieben von J. Belling, die durch ihre charakteristische Größe und lineare Anordnung entlang eines Chromosoms identifiziert werden.

Chromonema (pl: chromonemata)  Ein optisch einzelner Faden, der innerhalb jedes Chromosoms eine axiale Struktur bildet.

Chromoplast   Plastid, das Pigmente enthält, wie Chloroplasten oder eines, in dem Carotinoide vorherrschen.

Chromosomenaberration   Jede Veränderung der Chromosomenstruktur oder -zahl. Obwohl es ein Mechanismus zur Verbesserung der genetischen Vielfalt sein kann, sind solche Veränderungen in der Regel tödlich oder schlecht adaptiv, insbesondere bei Tieren.

chromosomale Integrationsstelle   A chromosomaler Ort, an dem fremde DNA integriert werden kann, oft ohne eine wesentliche Funktion im Wirtsorganismus zu beeinträchtigen.

chromosomale Polymorphismus & # 160 & # 160The Auftreten von einer bis mehrere Chromosomen in zwei oder mehr alternativen strukturellen Formen innerhalb einer Population strukturell veränderten Chromosomen sind das Ergebnis von Chromosomenmutationen (dh jede strukturelle Veränderung der Verstärkung, Verlust oder Relokation des Chromosoms beteiligt Segmente).

Chromosom   (Gr. Chroma, Farbe + Soma, Körper) ف. Ein einzelnes DNA-Molekül, ein eng gewundener DNA-Strang, der in vivo durch Komplexierung mit akzessorischen Histonen oder histonähnlichen Proteinen zu einer kompakten Struktur kondensiert wird.

2. Eine Gruppe von Kernkörperchen, die Gene enthalten, die maßgeblich für die Differenzierung und Aktivität einer eukaryontischen Zelle verantwortlich sind. Einer der Körper, in die sich der Kern zu Beginn der Mitose auflöst und aus denen er am Ende der Mitose stammt. Chromosomen enthalten den größten Teil der DNA der Zelle. Chromosomen kommen in Eukaryoten paarweise vor - ein väterliches (vom männlichen Elternteil) und ein mütterliches (vom weiblichen Elternteil). Jede eukaryontische Spezies hat eine charakteristische Anzahl von Chromosomen. Bakterielle und virale Zellen enthalten nur ein einzelnes Chromosom, bestehend aus einem Einzel- oder Doppelstrang von DNA oder, bei manchen Viren, RNA, ohne Histone.

Chromosomenaberration   Die abnormale Struktur oder Anzahl der Chromosomen umfasst Mangel, Duplikation, Inversion, Translokation, Aneuploidie, Polyploidie oder jede andere Veränderung vom normalen Muster.

chromosom banding   Färbung der Chromosomen in einer Weise, dass helle und dunkle Bereiche entlang der Länge der Chromosomen in wiederholbaren Mustern auftreten. Seitliche Vergleiche identifizieren Paare. Jedes Chromosom kann durch sein Bandenmuster identifiziert werden.

Chromosomenmutation   A Veränderung der groben Struktur eines Chromosoms, die normalerweise schwerwiegende schädliche Auswirkungen auf den Organismus hat. Sie sind oft auf einen Fehler bei der Paarung während des Crossing-over-Stadiums der Meiose zurückzuführen. Die wichtigsten Arten von Chromosomenmutationen sind Translokation, Duplikation, Deletion und Inversion.

Chromosom-Jumping   A-Technik, die es ermöglicht, zwei Segmente der Duplex-DNA, die durch Tausende von Basenpaaren (ca. 200 kb) getrennt sind, zusammen zu klonen. Nach der Subklonierung kann jedes Segment als Sonde verwendet werden, um klonierte DNA-Sequenzen zu identifizieren, die auf Chromosomenebene ungefähr 200 kb voneinander entfernt sind. Siehe positionelles Klonen.

Chromosomentheorie der Vererbung   Die Theorie, dass Chromosomen die genetische Information tragen und dass ihr Verhalten während der Meiose die physikalische Grundlage für Segregation und unabhängige Sortierung liefert.

Chromosomen-Walking-Technik, die überlappende geklonte DNA-Fragmente identifiziert, die ein kontinuierliches Segment eines Chromosoms bilden. Diese Fragmente können entweder durch zufälliges Scheren oder durch teilweisen Verdau mit einem Vier-Basenpaar-Schneider wie Sau 3A erzeugt werden. Dann wird eine Reihe von Koloniehybridisierungen durchgeführt, beginnend mit einem klonierten Fragment, das bereits identifiziert wurde und von dem bekannt ist, dass es sich in der von den überlappenden Klonen umfassten Region befindet. Dieses identifizierte Fragment wird als Sonde verwendet, um Klone auszuwählen, die benachbarte Sequenzen enthalten. Diese werden dann selbst als Sonden verwendet, um Klone zu identifizieren, die benachbarte Sequenzen tragen, und so weiter. Bei jeder Hybridisierungsrunde "läuft" man vom anfänglichen Fragment weiter entlang des Chromosoms. Siehe positionelles Klonen.

Chymosin   Ein Enzym, das die Milch gerinnen lässt und bei der Käseherstellung verwendet wird.

cilium   (pl: cilia adj: ciliate)  Haarartige lokomotorische Struktur auf bestimmten Zellen eine lokomotorische Struktur auf einem Ciliaten-Protozoen.

circadian Von physiologischer Aktivität usw.: etwa einmal täglich auftretend oder wiederkehrend. cf  tagaktiv.

2 m m Kreis   Siehe 2 m m Plasmid.

Zirkularisierung   A DNA-Fragment, das durch Verdauung mit einer einzelnen Restriktionsendonuklease erzeugt wird, wird komplementäre 5´- und 3´-Erweiterungen (klebrige Enden) aufweisen. Wenn diese Enden angelagert und ligiert werden, wird das DNA-Fragment in einen kovalent geschlossenen Kreis umgewandelt oder zirkularisiert.

cis-Konfiguration    Siehe Kopplung.

cis-Heterozygot   Ein Heterozygot, der zwei Mutationen enthält, die in einer cis-Konfiguration angeordnet sind (z. B. a + b+ / a b).

cis-wirkende Sequenz   A Nukleotidsequenz, die nur die Expression von Genen beeinflusst, die sich auf demselben Chromosom befinden.

Cistron   A DNA-Sequenz, die für ein spezifisches Polypeptid eines Gens kodiert. Siehe DNA-Gen.

Ansprüche   Der Abschnitt eines Patents, der detailliert die Verwendungen und möglichen Anwendungen der im Patent beschriebenen Erfindung angibt.

Klassenwechsel   Der Prozess, bei dem eine Plasmazelle aufhört, Antikörper einer Klasse zu produzieren, und mit der Produktion von Antikörpern einer anderen Klasse beginnt.

spalten   Um Phospho-Diester-Bindungen von doppelsträngiger DNA zu brechen, normalerweise mit einer Typ-II-Restriktionsendonuklease. alias zu schneiden oder zu verdauen.

klonale Vermehrung   Asexuelle Vermehrung vieler neuer Pflanzen (ramets) von einem Individuum (Ortet) haben alle den gleichen Genotyp.

klonale Selektion   Die Produktion einer Population von Plasmazellen, die alle denselben Antikörper produzieren, als Reaktion auf die Interaktion zwischen einem B-Lymphozyten, der diesen spezifischen Antikörper produziert, und dem von diesem Antikörper gebundenen Antigen.

Klon   (Gr. Klon, ein Zweig oder Slip) ف. Eine Gruppe von Zellen oder Organismen, die aufgrund ungeschlechtlicher Fortpflanzung, Züchtung von vollständig ingezüchteten Organismen oder der Bildung genetisch identischer Organismen durch Kerntransplantation genetisch identisch sind.

2. Gruppe von Pflanzen, die genetisch identisch sind und alle von einem ausgewählten Individuum durch vegetative Vermehrung ohne den sexuellen Prozess stammen.

3. Eine Population von Zellen, die alle ein Klonierungsvehikel mit dem gleichen Insert-DNA-Molekül tragen.

4. Verb: Klonen. Um ein DNA-Segment in einen Vektor oder ein Wirtschromosom einzufügen. Siehe Klonen.

5. In AnGR: Eine genetische Nachbildung eines anderen Organismus, die durch einen nicht-sexuellen (keine Befruchtung) Reproduktionsprozess gewonnen wird.

Das Klonen durch Kerntransfer beinhaltet den Transfer einer Spenderzelle (aus (kultivierten) Zellen embryonalen, fötalen oder adulten Ursprungs) in das Empfängerzytoplasma einer entkernten Eizelle oder Zygote und die anschließende Entwicklung von Embryonen und Tieren. (Basierend auf: FAO, 1999)

Klonbank    Siehe Genbank.

geklonter Stamm oder Linie   A Stamm oder Linie, die direkt von einem Klon abstammt.

Klonen  ف. Die mitotische Teilung einer Vorläuferzelle, um eine Population von identischen Tochterzellen oder Klonen hervorzubringen.

2. Einbau eines DNA-Moleküls in eine chromosomale Stelle oder einen Klonierungsvektor.

3. Klonen von Tieren: die Schaffung eines ganzen Tieres durch mitotische Teilungen aus einer einzelnen diploiden somatischen Zelle, typischerweise durch den Prozess des Kerntransfers (s. v.). Das Klonen durch Kerntransfer von undifferenzierten embryonalen Zellen ist seit vielen Jahren möglich, aber seine weit verbreitete Anwendung wurde durch die Unfähigkeit, embryonale Zellen von anderen Tieren als Mäusen zu kultivieren, behindert.1997 zeigten Ian Wilmut und Kollegen aus Edinburgh, dass es möglich ist, aus einer Zelle, die aus differenziertem adultem Gewebe entnommen wurde, ein ganzes Tier zu erschaffen und damit die Möglichkeit des weit verbreiteten Klonens von Tieren zu eröffnen. Siehe gerichtetes Klonen Megabasen-Klonen Molekulares Klonen Sub-Klonen Dolly.

Klon-Site    Siehe Insertions-Site .

Klonierungsvektor   Ein kleines, selbstreplizierendes DNA-Molekül – normalerweise ein Plasmid oder ein virales DNA-Chromosom – in das fremde DNA beim Klonieren von Genen oder anderen interessierenden DNA-Sequenzen eingefügt wird. Es kann inserierte DNA tragen und in einer Wirtszelle verewigt werden. Auch Klonierungsvehikel, Vektor oder Vehikel genannt. Siehe Vektor.

Klonen des Fahrzeugs   Siehe Klonvektor.

geschlossene kontinuierliche Kultur   Eine kontinuierliche Kultur, bei der der Zufluss von frischem Medium durch den Abfluss entsprechender Volumina an verbrauchtem Medium ausgeglichen wird. Zellen werden mechanisch vom ausfließenden Medium abgetrennt und der Kultur wieder zugesetzt. cf  offene kontinuierliche Kultur Batch-Kultur kontinuierliche Kultur.

Cluster der Differenzierung   Siehe CD.

cM    Siehe CentiMorgan Kartenentfernung.

Hüllprotein (= Kapsid). Das Hüllprotein, das den Nukleinsäurekern eines Virus umschließt.

coccus   (pl: cocci) Ein kugelförmiges Bakterium. Kokken können einzeln, paarweise, in Gruppen von vier oder mehr und in kubischen Paketen vorkommen.

Kokosmilch   Flüssiges Endosperm der Kokosnuss, das oft verwendet wird, um kultivierte Zellen und Gewebe mit organischen Nährstoffen zu versorgen. Siehe Anhang organischer Komplex undefiniert.

Kokon   Eine Schutzhülle für Eier und/oder Larven, die von vielen wirbellosen Tieren wie der Seidenraupenmotte produziert werden.

Co-Kultur   Die gemeinsame Kultur von zwei oder mehr Arten von Zellen, wie einer Pflanzenzelle und einem Mikroorganismus, oder zwei Arten von Pflanzenzellen. Wird in verschiedenen Dual-Culture-Systemen oder in der Ammenkultur verwendet, s.

Codierung   Die Spezifikation einer Peptidsequenz durch den Code, der in DNA-Molekülen enthalten ist.

kodierende Sequenz   Der Teil eines Gens, der direkt die Aminosäuresequenz seines Proteinprodukts spezifiziert. Nicht-kodierende Sequenzen von Genen umfassen Kontrollregionen, wie Promotoren, Operatoren und Terminatoren, sowie die Intronsequenzen bestimmter eukaryontischer Gene.

Codierungsstrang   Der Strang der Duplex-DNA, der die gleiche Basensequenz enthält (nach dem Ersetzen von U durch T), die im mRNA-Molekül gefunden wird, das aus der Transkription dieses DNA-Segments resultiert. auch bekannt als Sinnesstrang. Das mRNA-Molekül wird vom anderen Strang transkribiert, der als Matrize oder Antisense-Strang bekannt ist.

Codierungsstrang 5´ ATGAAAGCTTTAGTGGGCGCCCGTAT 3´

Schablonenstrang 3´ TACTTTCGAAATCACCCGCGGGCATA 5´

mRNA 5´ AUGAAAGCUUUAGUGGGCGCCCGUAU 3´

Co-Dominanz   Die Situation, in der beide Allele in einem heterozygoten Individuum exprimiert werden, so dass der Phänotyp von Heterozygoten die phänotypische Wirkung jedes Allels beinhaltet. Zum Beispiel resultiert die Fellfarbe des Rotschimmels bei Rindern aus einer Mischung aus roten Haaren und weißen Haaren, verursacht durch Heterozygotie für das rote Allel und das weiße Allel. Auch Proteinpolymorphismen und Mikrosatelliten zeigen eine Co-Dominanz: Heterozygote haben zwei Banden, während Homozygote nur eine Bande haben.

kodominante Allele   Allele, die im heterozygoten Zustand unabhängige Wirkungen erzeugen.

Codon   Ein Satz von drei Nukleotiden in der mRNA, der als Einheit der genetischen Kodierung fungiert, indem er eine bestimmte Aminosäure während der Synthese von Polypeptiden in einer Zelle spezifiziert. Ein Codon bezeichnet eine Transfer-RNA, die eine bestimmte Aminosäure trägt, die während der Proteinsynthese in eine Polypeptidkette eingebaut wird. Die Spezifität für die Übersetzung genetischer Information von DNA in mRNA und dann in Protein wird durch die Codon-Anticodon-Paarung bereitgestellt. Siehe Anticodon-Initiationscodon-Terminationscodon.

Codon-Optimierung   Eine experimentelle Strategie, bei der Codons innerhalb eines klonierten Gens – solche, die im Allgemeinen nicht vom Translationssystem der Wirtszelle verwendet werden – durch in vitro-Mutagenese in die bevorzugten Codons geändert werden, ohne die Aminosäuren des synthetisierten Proteins zu ändern.

Koeffizient   Eine Zahl, die das Ausmaß einer Veränderung oder eines Effekts unter bestimmten Bedingungen ausdrückt (z. B. der Inzuchtkoeffizient).

Co-Enzym   Ein organisches Molekül mit niedrigem Molekulargewicht und normalerweise kein Protein, wie z. B. ein Vitamin, das an ein Enzym bindet und dessen katalytische Aktivität fördert.

Co-Evolution   Die Evolution komplementärer Anpassungen bei zwei Arten, die durch den Selektionsdruck verursacht werden, den jede auf die andere ausübt. Es kommt häufig in symbiotischen Verbänden, in insektenbestäubten Pflanzen usw. vor.

Co-Faktor   Ein organisches Molekül oder anorganisches Ion, das für die normale katalytische Aktivität eines Enzyms erforderlich ist.

Co-Fermentation   Das gleichzeitige Wachstum zweier Mikroorganismen in einer Bioreaktion.

Kraft-Wärme-Kopplung   Erzeugung von sowohl Strom als auch Prozesswärme (Dampf) in einer Industrieanlage.

Kohäsion   Halten einer Kraft, die einen Festkörper an einen Festkörper oder einen Festkörper an eine Flüssigkeit hält, aufgrund der Anziehung zwischen gleichen Molekülen.

kohäsive Enden   Doppelsträngige DNA-Moleküle mit einzelsträngigen Enden, die zueinander komplementär sind und es den verschiedenen Molekülen ermöglichen, sich miteinander zu verbinden. auch bekannt als hervorstehende Enden klebrige Enden Überhang. cf  cos endet. Siehe Erweiterung.

Koinzidenz   Das Verhältnis der beobachteten Häufigkeit von Doppelübergängen zur erwarteten Häufigkeit, wobei die erwartete Häufigkeit unter der Annahme berechnet wird, dass die beiden Übergänge unabhängig voneinander auftreten.

co-integrieren Vektorsystem   A Zwei-Plasmid-System zum Übertragen klonierter Gene auf Pflanzenzellen. Der Klonierungsvektor weist ein T-DNA-Segment auf, das klonierte Gene enthält. Nach der Einführung in Agrobacterium tumiefasciens durchläuft die Klonierungsvektor-DNA eine homologe Rekombination mit einem residenten entwaffneten Ti -Plasmid, um ein einzelnes Plasmid zu bilden, das die genetische Information für den Transfer der gentechnisch veränderten T-DNA-Region in Pflanzenzellen trägt.

co-integrieren ein   A-DNA-Molekül, das durch die Fusion von zwei verschiedenen DNA-Molekülen gebildet wird, die normalerweise durch ein transponierbares Element vermittelt wird.

Colchicin (L. colchicum , Wiesensafran, aus Colchis, alte Mingrelia). Ein aus Colchicum autumnale, Herbstkrokus oder Wiesensafran gewonnenes Alkaloid, das die Spindelbildung in Zellen während der Mitose hemmt, so dass sich Chromosomen während der Anaphase nicht trennen können und so mehrere Chromosomensätze induzieren. Wird auch verwendet, um die Mitose in der Metaphase zu stoppen - dem Stadium, in dem die Chromosomen am sichtbarsten sind.

Coleoptile   Schutzhülle, die die Sprossspitze des Embryos bei einkeimblättrigen Pflanzen bedeckt. Es schützt die Pflaume, wenn sie durch den Boden auftaucht.

Coleorhiza   (Gr. koleos, Hülle + Rhiza, Wurzel)  A Schutzhülle um die Keimwurzel von einkeimblättrigen Pflanzen.

Kolinearität   A-Beziehung, in der die Einheiten in einem Molekül in der gleichen Sequenz wie die Einheiten in einem anderen Molekül vorkommen, die sie spezifizieren, z dieses Gen.

collection   In PGR: s ee base collection active collection.

Kollenchym   (Gr. kolla , Leim + Enchym , ein Suffix, abgeleitet von Parenchym und bezeichnet eine Art von Zellgewebe) Ein Gewebe aus lebenden Zellen, dessen Wände ungleichmäßig mit Zellulose und Hemizellulose verdickt, aber nie verholzt sind, es funktioniert in mechanische Unterstützung in jungen, kurzlebigen oder nicht verholzenden Organen und findet sich daher in Mittelrippen und Blattstielen.

Kolonie-Hybridisierungs-Technik, die eine Nukleinsäuresonde verwendet, um eine Bakterienkolonie mit einem Vektor zu identifizieren, der ein bestimmtes kloniertes Gen oder Gene trägt.

Kolonie   1. Ein Aggregat identischer Zellen (Klone), die aus einer einzigen Vorläuferzelle stammen.

2. Eine Gruppe von voneinander abhängigen Zellen oder Organismen.

kombinatorische Bibliothek   Während der Ligationsreaktion mit cDNAs von leichten und schweren Antikörperketten in einen Bakteriophagen-Lambda ( 1 )-Vektor werden viele neue Kombinationen gebildet, die aus einer kodierenden Region für die schwere und eine leichte Kette bestehen. Die Bibliothek umfasst diese Kombinationen jeweils in einem separaten Vektor.

Kommensalismus   Die Interaktion von zwei oder mehr unähnlichen Organismen, bei denen die Verbindung für einen von Vorteil ist, ohne die anderen zu beeinträchtigen. cf  Parasitismus Symbiose.

Begleitzelle   Lebende Zelle, die mit der Siebzelle des Phloemgewebes in Gefäßpflanzen assoziiert ist.

vergleichende Genkartierung Der Vergleich von Kartenpositionen von Genen zwischen Arten. Die Ergebnisse dieser Vergleiche zeigen eine wesentliche Konservierung von Genblöcken und sogar großen Chromosomensegmenten zwischen den Arten. Von dieser Erhaltung der Kartenposition kann viel Gebrauch gemacht werden. Im Fall von Säugetieren bedeutet dies beispielsweise, dass, wenn ein Gen in einer oder beiden der intensiv kartierten Spezies (Mensch und Maus) kartiert wurde, die wahrscheinliche Lage dieses Gens in anderen Säugetieren mit ziemlicher Sicherheit vorhergesagt werden kann . Umgekehrt, wenn ein kartierter anonymer DNA-Marker einen Einfluss auf ein quantitatives Merkmal hat (dies weist darauf hin, dass der Marker mit einem quantitativen Merkmals-Locus (QTL) verbunden ist) beispielsweise bei Rindern, dann kann die Kenntnis der vergleichenden Karte zwischen Rindern und Menschen Gene in der homologen Region des menschlichen Genoms identifizieren, die dem QTL entsprechen könnten. Solche Gene werden als vergleichende Positionskandidatengene (q.v.) bezeichnet.

vergleichendes positionelles Kandidatengen   A-Gen, das sich wahrscheinlich in derselben Region wie ein DNA-Marker befindet, von dem gezeigt wurde, dass er mit einem Single-Locus-Merkmal oder einem quantitativen Trait-Locus (QTL) verknüpft ist, bei dem das Gen die wahrscheinliche Position im Genom der fraglichen Art basiert auf ihrer bekannten Position in der Karte einer anderen Art, dh basiert auf der Vergleichskarte zwischen den beiden Arten.

Kompetenz   Fähigkeit einer Bakterienzelle, DNA-Moleküle aufzunehmen und genetisch zu transformieren.

Kompetenz   Ein ephemerer Zustand, induziert durch die Behandlung mit kalten Kationen, in dem Bakterienzellen in der Lage sind, fremde DNA aufzunehmen.

kompetente   A kompetente Zelle ist in der Lage, sich zu einem voll funktionsfähigen Embryo zu entwickeln. Das Gegenteil ist inkompetent.

Komplementproteine ​​  Proteine, die an Antikörper-Antigen-Komplexe binden und beim Abbau der Komplexe durch Proteolyse helfen.

Komplementarität   Die Beziehung zwischen den beiden Strängen einer DNA-Doppelhelix. Thymin in einem Strang paart sich mit Adenin im anderen Strang und Cytosin in einem Strang paart sich mit Guanin im anderen Strang.

komplementaritätsbestimmende Regionen    Siehe CDR.

Komplementäre DNA   Siehe cDNA.

komplementäre Entität  ف. Eine von einem Paar von Nukleotidbasen, die miteinander Wasserstoffbrückenbindungen bilden. Adenin (A) paart sich mit Thymin (T) [oder mit Uracil (U) in RNA] und Guanin (G) paart mit Cytosin (C).

2. Einer von einem Paar von Nukleinsäuresegmenten oder -strängen, die miteinander hydridisieren (durch Wasserstoffbrückenbindung verbinden).

komplementäre Gene   Zwei oder mehr voneinander abhängige Gene, sodass (bei dominanter Komplementarität) das dominante Allel eines der beiden Gene nur dann einen Einfluss auf den Phänotyp eines Organismus haben kann, wenn auch das dominante Allel des anderen Gens vorhanden ist oder (bei rezessiver Komplementarität) nur doppelt homozygot rezessiv den Effekt zeigen.

komplementäres homopolymeres Tailing   Der Vorgang des Hinzufügens komplementärer Nukleotidverlängerungen zu verschiedenen DNA-Molekülen, zB dG (Desoxyguanosin) an die 3´-Hydroxyl-Enden eines DNA-Moleküls und dC (Desoxycytidin) an die 3´-Hydroxyl-Enden eines anderen DNA-Moleküls, um nach dem Mischen die Verbindung der beiden DNA-Moleküle durch Basenpaarung zwischen den komplementären Verlängerungen zu erleichtern. Auch dG - dC-Tailing, dA - dT-Tailing genannt.

komplementäre Nukleotide   Mitglieder der Paare Adenin-Thymin, Adenin-Uracil und Guanin-Cytosin, die die Fähigkeit haben, Wasserstoffbrücken zu bilden. Siehe Nukleotid.

Komplementation    Siehe genetische Komplementation.

Komplementationstest trans-Test   Einführung zweier mutierter Chromosomen in dieselbe Zelle, um festzustellen, ob die Mutanten Allele desselben Gens sind. Wenn die Mutationen nicht-allelisch sind, ist der Genotyp m 1 + / + M 2 und der Phänotyp ist der Wildtyp (normal), da jedes Chromosom das andere "überdeckt". Im Gegensatz dazu, wenn sie allelisch sind, wird der mutierte Phänotyp resultieren.

vollständiger Verdau   Die Behandlung eines DNA-Präparats mit einer Endonuklease über einen ausreichenden Zeitraum, damit alle potentiellen Zielstellen innerhalb dieser DNA gespalten wurden. cf  Teilverdau.

zusammengesetztes Transposon   A transponierbares Element, das gebildet wird, wenn zwei identische oder nahezu identische Transposons auf beiden Seiten eines nicht transponierbaren DNA-Segments, wie dem bakteriellen Transposon Tn5, inserieren.

zusammengesetztes Chromosom   A-Chromosom, das durch die Vereinigung zweier separater Chromosomen gebildet wird, wie bei angehängten X-Chromosomen oder angehängten X-Y-Chromosomen.

Concatemer   A DNA-Segment, das aus wiederholten Sequenzen besteht, die Ende an Ende verbunden sind.

Konkordanz   Identität übereinstimmender Paare oder Gruppen für ein bestimmtes Merkmal, z. B. Geschwister, die dasselbe Merkmal ausdrücken.

bedingte letale Mutation   A-Mutation, die unter einer Reihe von Umweltbedingungen - den restriktiven Bedingungen - tödlich ist, aber unter einer anderen Reihe von Umweltbedingungen - den permissiven Bedingungen - lebensfähig ist, z. B. temperaturempfindliche Mutationen.

Konditionierung  ف. Die Auswirkungen auf die phänotypischen Eigenschaften externer Wirkstoffe während kritischer Entwicklungsstadien.

2. Die undefinierte Interaktion zwischen Gewebe und Kulturmedium, die zum Wachstum einzelner Zellen oder kleiner Aggregate führt. Die Konditionierung kann durch Eintauchen von Zellen oder Kallus, die in einem porösen Material (wie einem Dialyseschlauch) enthalten sind, in frisches Medium für einen Zeitraum erfolgen, der von der Zelldichte und einem Volumen in Bezug auf die Menge an frischem Medium abhängt.

Conidium   (pl: Conidien)  Eine asexuelle Spore, die von einer spezialisierten Hyphe in bestimmten Pilzen produziert wird.

Konjugation  ف. Vereinigung von Geschlechtszellen (Gameten) oder einzelligen Organismen während der Befruchtung.

2. Der unidirektionale Transfer von DNA (bakterielles Plasmid) von einer Bakteriumszelle zu einer anderen unter Beteiligung von Zell-Zell-Kontakt. Das Plasmid kodiert normalerweise die Mehrzahl der für seinen eigenen Transfer notwendigen Funktionen.

konjugative Funktionen   Plasmid-basierte Gene und ihre Produkte, die den Transfer eines Plasmids von einem Bakterium auf ein anderes erleichtern.

Blutsverwandtschaft   Bezogen auf die Abstammung von einem gemeinsamen Vorfahren.

Konsensussequenz   Die Nukleotidsequenz, die in den meisten genetischen Signalen oder Elementen vorhanden ist, die eine bestimmte Funktion erfüllen.

Erhaltung der genetischen Ressourcen von Nutztieren   In AnGR: Bezieht sich auf alle menschlichen Aktivitäten, einschließlich Strategien, Pläne, Richtlinien und Maßnahmen, die unternommen werden, um sicherzustellen, dass die Vielfalt der genetischen Ressourcen von Nutztieren erhalten wird, um zur Nahrungs- und landwirtschaftlichen Produktion beizutragen und Produktivität jetzt und in Zukunft. (Quelle: FAO, 1999)

konstante Domänen   Regionen von Antikörperketten, die die gleiche Aminosäuresequenz in verschiedenen Mitgliedern einer bestimmten Klasse von Antikörpermolekülen aufweisen.

konstitutives Enzym  Ein Enzym, das unabhängig von den Wachstumsbedingungen kontinuierlich synthetisiert wird. cf  Induzierbares Enzym Reprimierbares Enzym.

konstitutives Gen   Ein Gen, das kontinuierlich in allen Zellen eines Organismus exprimiert wird.

konstitutiver Promotor   Ein unregulierter Promotor, der die kontinuierliche Transkription seines assoziierten Gens ermöglicht. Siehe Veranstalter.

konstitutive Synthese   Kontinuierliche Produktion von RNA oder Protein durch einen Organismus.

konstitutiv   Ein Organismus wird als konstitutiv für die Produktion eines Enzyms oder eines anderen Proteins bezeichnet, wenn dieses Protein unter allen physiologischen Bedingungen immer von den Zellen produziert wird. Siehe induzierbar.

Verunreinigung  Bakterien-, Pilz- oder Algenmikroorganismus, der versehentlich in eine Kultur oder ein Kulturmedium eingebracht wurde. Verunreinigungen können die Pflanzenzellen überwuchern und folglich ihr Wachstum hemmen. In der Pflanzengewebekultur muss das Arbeiten unter aseptischen Bedingungen unter striktem Ausschluss potenzieller Kontaminanten geübt werden. Siehe Desinfektion Entwesung.

contig   Ein Satz überlappender Klone, die eine physische Karte eines Teils eines Chromosoms liefern. cf zusammenhängende Karte.

Contiguous Map Contig Map   Der Abgleich von Sequenzdaten aus großen, benachbarten Regionen des Genoms, um eine kontinuierliche Nukleotidsequenz über eine chromosomale Region zu erzeugen. Siehe  -Zuordnung.

Kontinuierliche Kultur   A Suspensionskultur wird durch den Zufluss von frischem Medium kontinuierlich mit Nährstoffen versorgt. Das Kulturvolumen ist normalerweise konstant. cf Batch-Kultur geschlossen kontinuierliche Kultur kontinuierliche Fermentation offene kontinuierliche Kultur.

Kontinuierliche Fermentation   Ein Prozess, bei dem Zellen oder Mikroorganismen in der exponentiellen Wachstumsphase durch die kontinuierliche Zugabe von frischem Medium in Kultur gehalten werden, das durch die Entnahme der Zellsuspension aus dem Bioreaktor genau ausgeglichen wird. vgl. kontinuierliche Kultur.

kontinuierliche Variation   Variation nicht durch unterschiedliche Klassen dargestellt. Phänotypen gradieren ineinander und Messdaten werden für die Analyse benötigt. Für diese Art der Variation sind in der Regel mehrere Gene verantwortlich. auch bekannt als quantitative Variation. cf  diskontinuierliche Variation.

Kontrolle  ف. Nomen: Unverändertes (Standard-)Protokoll oder Behandlung zum Vergleich mit der experimentellen Behandlung. Der Begriff wird häufig für unbehandelte Organismen verwendet.

2. Verb: Kulturen unter Zusatz von Pflanzenwachstumsregulatoren lenken oder regulieren.

kontrollierte Umgebung   Die Umgebung, in der Parameter wie Licht, Temperatur, relative Luftfeuchtigkeit und manchmal der Gaspartialdruck vollständig kontrolliert werden.

Kontrollelement   In Eukaryoten transponierbare Elemente, die die Aktivität von Standardgenen kontrollieren. Ein Kontrollelement kann im einfachsten Fall die Aktivität eines Gens hemmen, indem es in oder in die Nähe dieses Gens integriert wird. Gelegentlich kann es entweder im Keim- oder Körpergewebe von dieser Stelle ausgeschnitten werden, und durch die Entfernung wird die Aktivität des Gens mehr oder weniger wiederhergestellt, während das Element an anderer Stelle im Genom wieder integriert werden kann, wo es die Aktivität eines anderen beeinträchtigen kann Gen. In Mais beispielsweise ist ein Kontrollelement wie Ac oder Ds in der Lage, die Expression eines nahegelegenen Gens zu beeinflussen. Siehe   transponierbares Element.

Umwandlung   Die Entwicklung eines somatischen Embryos zu einer Pflanze. Siehe  Regeneration Mikropropagation Organogenese.

koordinieren Repression   Korrelierte Regulation der Strukturgene in einem Operon durch ein Molekül, das mit der Operatorsequenz interagiert.

Co-Polymere   Mischungen, die aus mehr als einem Monomer bestehen, zum Beispiel Polymere aus zwei Arten organischer Basen wie Uracil und Cytosin (Poly-UC) wurden für Studien des genetischen Codes kombiniert.

Kopienzahl   Die durchschnittliche Anzahl von Molekülen eines Plasmids oder Gens pro Genom, die in einer Zelle enthalten sind.

Corepressor   Ein Effektormolekül, das mit einem Repressor einen Komplex bildet und die Expression eines Gens oder einer Reihe von Genen ausschaltet.

Korpus   Der Korpus befindet sich unterhalb der Tunika (q.v.) und ist ein Teil des Apikalmeristems. Im Korpus teilen sich Zellen in alle Richtungen, wodurch ihr Volumen zunimmt. Siehe Apikalmeristem.

Korrelation   A statistischer Zusammenhang zwischen Variablen.

Kortex   Primäres Gewebe eines Stammes oder einer Wurzel, das außen durch die Epidermis und innen im Stamm durch das Phloem und in der Wurzel durch das Pericyclus begrenzt wird.

cos endet   Die 12 Basen umfassenden, einzelsträngigen, komplementären Erweiterungen der Bakteriophagen Lambda ( l ) DNA. auch bekannt als cos-Sites.

Co-Segregation   Wenn zwei genetische Bedingungen gemeinsam vererbt werden.

Cosmid   A Plasmidvektor, der die beiden cos (kohäsiven) Enden des Phagen Lambda (l) und einen oder mehrere selektierbare Marker wie ein Antibiotikaresistenzgen enthält. Cosmide nutzen bestimmte Eigenschaften des Phagen Lambda (l) aus, um die Klonierung großer DNA-Fragmente von 40–50 kb mit hoher Effizienz zu ermöglichen. Cosmide und Cosmid-Rekombinanten replizieren als Plasmide.

Cot-Kurve   Wenn Duplex-DNA erhitzt wird, dissoziiert sie in Einzelstränge. Wenn die Temperatur gesenkt wird, neigen komplementäre Stränge zum Annealing oder zur Renaturierung. Das Ausmaß der Renaturierung hängt vom Produkt der DNA-Konzentration in Mol Nukleotiden pro Liter und der Zeit in Sekunden ab. Ein Diagramm, das den Anteil der renaturierten DNA im Verhältnis zum cot zeigt, wird als cot-Kurve bezeichnet. Das Feldbett, bei dem die Hälfte der DNA re-naturiert ist, ist das halbe Feldbett, ein Parameter, der den Komplexitätsgrad der DNA angibt.

Co-Transfektion   In Baculovirus-Expressionssystemen das Verfahren, bei dem das Baculovirus und der Transfervektor gleichzeitig in kultivierte Insektenzellen eingeführt werden.

Co-Transformation  In gentechnischen Experimenten ist es oft notwendig, mit einem Plasmid zu transformieren, für das es keinen selektierbaren Phänotyp gibt, und dann auf das Vorhandensein dieses Plasmids in der Wirtszelle zu screenen. Co-Transformation ist eine Technik, bei der Wirtszellen mit zwei Arten von Plasmiden inkubiert werden, von denen einer selektierbar ist und der andere nicht. Zellen, die mit dem ersten Plasmid transformiert wurden, werden dann selektiert. Wenn die Transformation bei hoher DNA-Konzentration durchgeführt wurde, ist es wahrscheinlich, dass diese Zellen auch mit dem zweiten (nicht selektierbaren) Plasmid transformiert wurden. Die Technik wird häufig in Experimenten mit Säugerzellen verwendet.

Keimblätter   Blattartige Strukturen am ersten Knoten des Keimlingsstamms. In einigen Dikotyledonen enthalten sie gespeicherte Nahrung für die junge Pflanze, die noch nicht in der Lage ist, ihre eigene Nahrung zu photosynthetischen. Oft als Samenblätter bezeichnet.

Kopplung  Der Phasenzustand, in dem entweder zwei dominante oder zwei rezessive Allele zweier verschiedener Gene auf demselben Chromosom vorkommen. Auch cis-Konfiguration genannt. cf  Abstoßung.

kovalente Bindung   A Bindung, in der ein Elektronenpaar zu gleichen Teilen von Protonen in zwei benachbarten Atomen geteilt wird.

kovalent geschlossener Kreis (CCC)  A doppelsträngiges DNA-Molekül ohne freie Enden. Die beiden Stränge sind miteinander verbunden und bleiben auch nach Denaturierung zusammen. In seiner nativen Form nimmt ein CCC eine supercoiled-Konfiguration an.

Kovarianz  A Maß für die statistische Assoziation zwischen Variablen das Ausmaß, in dem zwei Variablen zusammen variieren.

cpDNA   Die DNA von Pflanzenplastiden, einschließlich Chloroplasten.

kritische Rasse   In AnGR: Eine Rasse, bei der die Gesamtzahl der brütenden Weibchen weniger als 100 beträgt oder die Gesamtzahl der brütenden Männchen kleiner oder gleich fünf ist oder die Gesamtpopulation nahe, aber leicht über 100 liegt und sinkt, und der Anteil reinrassiger Weibchen liegt unter 80 %. (Quelle: FAO, 1999)

Kritisch gepflegte Rasse Vom Aussterben bedrohte Rasse   In AnGR: Kategorien, in denen kritische oder gefährdete Rassen durch ein aktives öffentliches Erhaltungsprogramm oder in einer kommerziellen oder Forschungseinrichtung gepflegt werden. (Quelle: FAO, 1999)

Kreuz   In genetischen Studien die Paarung zweier Individuen oder Populationen. Auch Paarung genannt.

Kreuzung   Paarung zwischen Mitgliedern verschiedener Populationen (Linien, Rassen, Rassen oder Arten).

Kreuzhybridisierung   Die Wasserstoffbrückenbindung einer einzelsträngigen DNA-Sequenz, die teilweise, aber nicht vollständig komplementär zu einem einzelsträngigen Substrat ist. Dies beinhaltet häufig die Hybridisierung einer DNA-Sonde für eine spezifische DNA-Sequenz mit den homologen Sequenzen verschiedener Spezies.

Crossing over   A-Prozess, bei dem homologe Chromosomen Material durch den Bruch und die Wiedervereinigung zweier Chromatiden austauschen. Ein einzelner Crossover repräsentiert ein wechselseitiges Bruch- und Wiedervereinigungsereignis. Ein Doppel-Crossover erfordert zwei gleichzeitige wechselseitige Bruch- und Wiedervereinigungsereignisse. auch bekannt als Rekombinations-Rekombinationsereignis.

Crossover   A rekombinantes Chromosom.

Crossing-over-Einheit   Ein Maß für den Abstand zwischen zwei Loci auf genetischen Karten, das auf der durchschnittlichen Anzahl von Crossing-over-Ereignissen basiert, die im Intervall zwischen diesen beiden Loci während der Meiose stattfinden. Ein Kartenintervall mit einer Länge von einer Crossing-Over-Einheit (ein CentiMorgan) beschreibt ein Intervall zwischen zwei Loci, so dass einer von hundert aus der Meiose gewonnenen Gameten in diesem Intervall rekombinant ist, dh das Allel am ersten Locus ist mütterlichen Ursprungs , während das Allel am anderen Locus in demselben Gameten väterlichen Ursprungs ist.

Fremdbestäubung   Befruchtung einer Pflanze aus einer Pflanze mit einer anderen genetischen Ausstattung.

Kreuzbestäubungseffizienz   Effizienz von Pollen einer Pflanze, die das Stigma einer anderen Pflanze erreicht.

Kronengalle (AS gealla, gall)  Ein Knollenwachstum, das an der Basis bestimmter Pflanzen als Folge einer Infektion auftritt, insbesondere durch Agrobacterium tumefaciens ein bakterielles Gen, das vom Ti-Plasmid getragen wird, wird von den Bakterien in eine höhere Pflanzenzelle übertragen , wo es ein tumorähnliches Wachstum verursacht. auch bekannt als Kronengallentumor. Siehe Haarwurzelkrankheit Agrobacterium.

Krone   Die Region an der Basis des Stammes von Getreide- und Futterarten, aus der Bestockungen oder Äste hervorgehen. Bei Gehölzen die Wurzel-Stängel-Verbindung. In der Forstwirtschaft die oberen Teile des Baumes.

Kryobiologische Konservierung Kryokonservierung Gefrierkonservierung . Die Konservierung von Keimplasmaressourcen in einem ruhenden Zustand durch kryogene Techniken, wie sie derzeit bei der Lagerung von Pflanzensamen und Pollen, Mikroorganismen, Tiersperma und Gewebekulturzelllinien angewendet werden. Siehe Genbank zur Ex-situ-Erhaltung.

kryogen   Bei sehr niedriger Temperatur.

Kryokonservierung   Siehe Kryobiologische Konservierung.

Kryoprotektivum   Verbindung zur Verhinderung von Zellschäden beim Einfrieren und Auftauen. Kryoschutzmittel sind Mittel mit hoher Wasserlöslichkeit und geringer Toxizität. Zwei Arten von Kryoschutzmitteln werden üblicherweise verwendet: permeierend (Glycerin und DMSO (q.v.)) und nicht permeierend (Zucker, Dextran, Ethylenglykol, Polyvinylpyrrolidon und Hydroxyethylstärke).

kryptisch  ف. Strukturell heterozygote Individuen, die nicht anhand abnormer meiotischer Chromosomen-Paarungskonfigurationen identifiziert werden können ('kryptische Strukturhybride').

2. Eine Form des Polymorphismus, die von rezessiven Genen kontrolliert wird („kryptischer Polymorphismus“).

3. Jede Mutation, die durch eine sensibilisierende Mutation exponiert und ansonsten schlecht nachgewiesen wird (solche Mutationen entgehen wahrscheinlich der Entdeckung wegen der Plastizität der Zusammensetzung des entsprechenden Polypeptids).

4. Phänotypisch sehr ähnliche Arten (kryptische Arten), die unter normalen Bedingungen nicht hybridisieren.

5. Kryptische genetische Variation bezieht sich beispielsweise auf die Existenz von Allelen, die einem Merkmal eine hohe Leistung verleihen, in einer Rasse, die eine geringe Leistung für dieses Merkmal aufweist.

Sorte (von kultiviert + Sorte) (Abk.: cv.)  A Kategorie von Pflanzen, die erstens taxonomisch unter dem Niveau einer Unterart liegen und zweitens nur in Kultur vorkommen. Es handelt sich um einen internationalen Begriff, der bestimmte Kulturpflanzen bezeichnet, die sich durch bestimmte Merkmale klar von anderen unterscheiden lassen und die ihre Unterscheidungsmerkmale auch bei Vermehrung unter bestimmten Bedingungen behalten.

Kultur   A Population von Pflanzen- oder Tierzellen oder Mikroorganismen, die unter kontrollierten Bedingungen gezüchtet wird.

Kulturveränderung   Ein Begriff, der verwendet wird, um eine anhaltende Änderung der Eigenschaften des Verhaltens einer Kultur anzuzeigen (z. B. veränderte Morphologie, Chromosomenkonstitution, Virusanfälligkeit, Nährstoffbedarf, Proliferationskapazität usw.). Der Begriff sollte immer durch eine genaue Beschreibung der eingetretenen Kulturveränderung qualifiziert werden.

Kulturmedium   Jedes Nährstoffsystem zur Kultivierung von Zellen von Pflanzen, Bakterien oder anderen Organismen meist eine komplexe Mischung aus organischen und anorganischen Nährstoffen. cf mittel.

Kulturraum   Raum zum Aufbewahren von Kulturen und oft in einer kontrollierten Umgebung von Licht, Temperatur und Feuchtigkeit. cf  Wachstumsschrank Inkubator.

Heilung   Die Eliminierung eines Plasmids aus seiner Wirtszelle. Viele Mittel, die die DNA-Replikation stören, z. B. Ethidiumbromid, können Plasmide entweder aus Bakterien- oder eukaryontischen Zellen heilen.

  Slang schneiden: um einen doppelsträngigen Bruch in der DNA zu machen, normalerweise mit einer Typ-II-Restriktionsendonuklease. Z. B. "Die DNA wurde mit Eco RI geschnitten und auf einem 1% Agarosegel auslaufen lassen." vgl. nick cleave.

Cuticula   (L. cuticula, Verkleinerungsform von Cutis, der Haut)  Cutin- oder Wachsschicht auf der äußeren Oberfläche von Blättern und Früchten, die den Wasserverlust reduziert.

Schneiden   Noun: Ein abgelöster Pflanzenteil, der unter geeigneten Kulturbedingungen die komplette Pflanze ohne sexuellen Prozess regenerieren kann.

Cybrid   A zytoplasmatisches Hybrid, das aus der Fusion eines Zytoplasten (dem Zytoplasma ohne Kern) mit einer ganzen Zelle entsteht, wie beim Kerntransfer (obwohl der Begriff in diesem Zusammenhang nicht verwendet wird). Beachten Sie, dass der Kern und das Zytoplasma der fusionierten Zellprodukte aus unterschiedlichen genetischen Quellen stammen.

zyklisches AMP (zyklisches Adenosinmonophosphat)  A "messenger", das viele intrazelluläre Reaktionen reguliert, indem es Signale von extrazellulären Wachstumsfaktoren auf zelluläre Stoffwechselwege überträgt.

Cyclodextrin   Cyclic Polymer von Dextrose.

Zytogenetik   Bereich der Biologie, der sich mit Chromosomen und ihren Auswirkungen auf Genetik, Zellaktivität und Variabilität befasst.

Zytokin   In der Immunologie eines von vielen löslichen Molekülen, die Zellen produzieren, um Reaktionen zwischen anderen Zellen zu kontrollieren.

Zytokinese   Zytoplasmatische Teilung und andere Veränderungen ausschließlich der Kernteilung, die Teil der Mitose oder Meiose sind. Siehe Zellteilung.

Cytokinin   Pflanzenwachstumsregulatoren (Hormone), charakterisiert als Substanzen, die die Zellteilung und Zelldifferenzierung induzieren (z. B. BA, Kinetin und 2-iP). In Gewebekulturen sind diese Substanzen mit einer verstärkten Kallus- und Sprossentwicklung verbunden. Die Verbindungen sind Derivate von Adenin.

Zytologie   Das Studium der Struktur und Funktion von Zellen.

Zytolyse   Zellzerfall.

Zytoplasma   (Gr. kytos, ein Hohlgefäß + Plasma, Form)  Das lebende Material der Zelle, ausschließlich des Zellkerns, bestehend aus einer komplexen Proteinmatrix oder einem Gel. Der Teil der Zelle, in dem sich essentielle Membranen und Zellorganellen (Mitochondrien, Plastiden usw.) befinden.

Zytoplasmatische Gene   DNA-enthaltende Körper in der Zelle, aber außerhalb des Zellkerns.

zytoplasmatische Vererbung   Erbliche Übertragung abhängig vom Zytoplasma oder Strukturen im Zytoplasma und nicht von der extrachromosomalen Vererbung der Kerngene. Somit werden Plastideneigenschaften in Pflanzen durch einen Mechanismus vererbt, der von nuklearen Genen unabhängig ist.

Zytoplasmatische männliche Sterilität   Genetischer Defekt aufgrund von Fehlfunktionen der Mitochondrien im Pollen. Eine Befruchtung findet nicht statt. Wird in bestimmten Pflanzenzüchtungsstrategien verwendet, wie z. B. F 1 -Hybridmaissorten.

Zytoplasmatische Organellen   Diskrete subzelluläre Strukturen im Zytoplasma von Zellen, die eine Arbeitsteilung innerhalb der Zelle ermöglichen.

Cytosin   A Pyrimidinbase in DNA und RNA gefunden.

Zytosol   Der flüssige Teil des Zytoplasmas, d. h. das Zytoplasma abzüglich seiner Organellen.

zytotoxische T-Zelle    Siehe Killer-T-Zelle.

Zytotyp   A mütterlicherseits vererbter zellulärer Zustand bei Drosophila, der die Aktivität von transponierbaren P-Elementen reguliert.


Schau das Video: Koda in a nutshell lazy mhaBNHA (August 2022).