Information

11.7: Rezeptor-vermittelte Endozytose – Biologie

11.7: Rezeptor-vermittelte Endozytose – Biologie


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ebenso wie ein vesikulärer Verkehr zur Plasmamembran, entweder zur Sekretion oder zum Einbau von Membranlipiden oder Proteinen, kann auch ein vesikulärer Verkehr von der Plasmamembran erfolgen. Manchmal wird die Endozytose intern initiiert, vielleicht um ein bestimmtes Protein von der Zelloberfläche zu entfernen (zum Beispiel siehe Hinterkantendynamik der Zellmotilität im nächsten Kapitel), aber oft ist die Endozytose das Ergebnis einer Ligandenbindung an einen extrazellulären Rezeptor Molekül, was zu seiner Aktivierung und anschließenden Nukleation einer Clathrin-Anordnung und zur Vesikelbildung führt.

Es gibt viele Arten von Liganden: ein Nährstoffmolekül (normalerweise auf einem Trägerprotein, wie in den Beispielen unten) oder sogar ein angreifendes Virus, das den endozytischen Mechanismus übernommen hat, um den Eintritt in die Zelle zu erleichtern. Das hier dargestellte Beispiel ist ein klassisches Beispiel: Endozytose von Cholesterin (über Low-Density-Lipoprotein). Dies veranschaulicht einen möglichen Weg, den die Rezeptoren und ihre Ladung nehmen können. Im Fall von Cholesterin wird das Trägerprotein vollständig abgebaut, während im Fall von Transferrin, einem Serumprotein, das Eisen im Blut trägt, das Trägerprotein nach Freisetzung seiner Transferrinfracht nur recycelt wird. Es wird in ein exozytäres Vesikel verpackt, das zurück zur Zelloberfläche führt.

Serumcholesterin wird normalerweise von LDL (Low Density Lipoprotein) verestert und gebunden, das dann im Blutkreislauf herumschwimmt, bis es auf einen LDL-Rezeptor auf der Oberfläche einer Zelle trifft. Wenn das LDL an seinen Rezeptor bindet, wird der Rezeptor aktiviert und ein Clathrin-beschichtetes Vesikel bildet sich um den LDL/Rezeptor-Komplex. LDL-Rezeptoren neigen dazu, in sogenannten Clathrin-beschichteten Grübchen zu aggregieren – kraterähnlichen Teilbläschen, die bereits eine kleine Anzahl polymerisierter Clathrin-Moleküle aufweisen. Das Vesikel bildet sich genau wie zuvor für von Golgi abgeleitete Clathrinvesikel beschrieben: Das Clathrin assembliert sich selbst zu einem kugelförmigen Vesikel und Dynamin drückt das Vesikel von der Zellmembran ab. Dieses Vesikel fusioniert dann mit einem frühen Endosom, das Protonenpumpen in seiner Membran trägt, wodurch die Umgebung im Inneren des Vesikels ansäuert (~pH 6). Diese Ansäuerung kann zu Konformationsverschiebungen in Proteinen führen, die beispielsweise dazu führen könnten, dass ein Rezeptor seinen Liganden freisetzt, wie es hier bei LDL und LDL-Rezeptor der Fall ist. Das frühe Endosom fungiert auch als Sortierstation: Der Rezeptor wird erneut vesikulärisiert und zur Plasmamembran zurücktransportiert. Währenddessen wird das LDL in ein anderes Vesikel verpackt und macht sich auf den Weg zur weiteren Verarbeitung.

Die endosomalen Protonenpumpen sind ATP-getrieben, Mg2+-abhängige V-Typ-Pumpe (im Gegensatz zur F-Typ-Pumpe in der mitochondrialen inneren Membran). Strukturell sind die beiden jedoch ähnlich, und die ATP-Hydrolyse treibt die Rotationseinheit an, die dann die Bewegung der Protonen durch die Membran vom Zytoplasma in das Endosom antreibt.

Das endosomale Vesikel mit dem darin enthaltenen LDL verschmilzt als nächstes mit einem anderen sauren, membrangebundenen Kompartiment. Das Lysosom ist mit einem pH-Wert von ~5,0 noch saurer als das Endosom, und es enthält auch eine große Anzahl von Säurehydrolasen – hydrolytische Enzyme, die sich über Substrate erstrecken (einschließlich Proteasen, Lipasen, Glycosidasen, Nukleasen), die unter sauren Bedingungen optimal funktionieren, und minimal in den neutralen oder schwach basischen Bedingungen im Zytoplasma. Teilweise ist dies ein Sicherheitsmechanismus – das Austreten von Verdauungsenzymen aus dem Lysosom führt nicht zu einer vollständigen Verdauung der Zelle, da die Enzyme im Zytoplasma keine oder nur eine geringe Aktivität aufweisen. Die lysosomale Membran besitzt neben Protonenpumpen zur Ansäuerung der inneren Umgebung auch viele Transportproteine, um die Verdauungsprodukte der sauren Hydrolasen aus dem Lysosom zu transportieren, damit die Zelle die Aminosäuren, Zucker, Nukleotide und daraus resultierende Lipide. Zurück zu unserem Beispiel bedeutet das, dass die Cholesterinester in einzelne Cholesterinmoleküle zerlegt werden und das Lipoprotein in Lipide und Aminosäuren zerlegt wird. Interessanterweise werden diese Transporterproteine ​​von den lysosomalen Proteasen nicht verdaut, da sie sehr stark glykosyliert sind, was potenzielle proteolytische Stellen von den Proteasen abschirmt.

Lysosomale Enzyme werden spezifisch durch ein Mannose-6-Phosphat markiert, das im cis-Golgi hinzugefügt wird. Dies ist ein zweistufiger Prozess, bei dem die N-Acetylglucosamin-Phosphotransferase eine Phospho-GlcNAc an einen Mannose-Rest anfügt und sich über die Phosphatgruppe verbindet, dann eine Phosphodiesterase das GlcNAc entfernt und das Mannose-6-P zurücklässt. Dies zielt spezifisch auf lysosomale Enzyme ab, da sie alle spezifische Proteinerkennungssequenzen aufweisen, an die die Phosphotransferase bindet, bevor sie die P-GlcNAc transferiert. Obwohl die lysosomalen Enzyme im cis-Golgi markiert sind, sortieren sie nicht bis zum trans-Golgi, wenn Mannose-6-P-Rezeptoren an die lysosomalen Enzyme binden und lysosomale Vesikel bilden, die sich ablösen und zu späten Endosomen und Lysosomen wandern, um ihre Säurehydrolase Nutzlast. Auch hier ist die pH-Änderung wichtig: In der etwas sauren (pH 6,5) Umgebung des trans-Golgi bindet der Rezeptor die Mannose-6-P-markierten Enzyme, aber im saureren Lysosom werden die Säurehydrolasen freigesetzt, um ihre Arbeit.

Wenn eine oder mehrere Säurehydrolasen nicht richtig funktionieren oder aufgrund unsachgemäßer Sortierung nicht in das Lysosom gelangen, ist das Ergebnis eine unvollständige Verdauung des lysosomalen Inhalts. Dies führt wiederum zur Bildung großer Einschlüsse von teilweise verdautem Material innerhalb der Lysosomen. Diese Ansammlung von Material kann zytotoxisch sein, und genetische Störungen, die die Expression oder Sortierung von lysosomalen Hydrolasen beeinflussen, werden kollektiv als lysosomale Speicherkrankheiten bezeichnet. Diese fallen in verschiedene Kategorien, abhängig von den Arten der angesammelten Moleküle.

Eine häufige und leicht behandelbare Erkrankung der Glykosaminoglykan-Akkumulation ist die Hurler-Krankheit, die durch eine Enzymersatztherapie effektiv behandelt und nicht-neurologische Effekte sogar rückgängig gemacht werden können. Hurlers andere in seiner Klasse betreffen eine Vielzahl von Geweben, da Glykosaminoglykane allgegenwärtig sind. Da das Gehirn hingegen mit Gangliosiden angereichert ist, weisen lysosomale Speicherkrankheiten wie Morbus Gaucher hauptsächlich Defekte im ZNS auf. Viele lysosomale Speicherkrankheiten haben ein ähnliches Erscheinungsbild: Entwicklungsanomalien, insbesondere verkümmertes Knochenwachstum, Fehlen feiner Gesichtszüge und neuromuskuläre Schwäche.

Da es stark vom Inhalt des/der damit fusionierten Endosom(s) abhängt, können Größe und Inhalt der Lysosomen stark variieren. Tatsächlich kann das Lysosom auch interne zelluläre Komponenten durch den Prozess der Autophagie. Gewöhnlich wird dies unter Hungerbedingungen initiiert, die zu einer Hemmung von mTor und anschließender Expression von autophagischen Genen führen. Diese interagieren dann mit Mitochondrien und anderen zellulären Komponenten und fördern die Bildung eines doppelmembranigen Autophagosoms um sie herum. Der Ursprung der Membranen ist unklar, obwohl das ER vermutet wird. Schließlich verschmilzt das Autophagosom mit einem Lysosom, und die sauren Hydrolasen bauen die Zellteile zur Energiegewinnung ab. Eine Variante dieser sogenannten Mikroautophagie kann auch auftreten, bei der das Lysosom selbst ein wenig zytoplasmatisches Material einstülpt und ein intralysosomales Vesikel internalisiert, das dann abgebaut wird.

Die schwerste I-Zell-Erkrankung (Mukolipidose Typ II) tritt auf, wenn in den Fibroblasten des Betroffenen fast alle lysosomalen Enzyme fehlen. Es gibt schwere Entwicklungsverzögerungen und frühes Wachstumsversagen, neuromuskuläre Probleme und Fehlbildungen in der frühen Skelettentwicklung. Die Schwere dieser Störung ist auf das fast vollständige Fehlen lysosomaler Enzyme zurückzuführen, das durch einen Mangel an GlcNAc-Phosphotransferase verursacht wird. Ohne sie werden keine Enzyme für die Sortierung zum Lysosom markiert.

Andere relativ häufige Erkrankungen sind die Tay-Sachs- und die Niemann-Pick-Krankheit. Tay-Sachs wird durch eine Ansammlung von Gangliosiden im Gehirn verursacht und endet in der Regel im Alter von 5 Jahren tödlich. Niemann-Pick hingegen kann sich als Typ A mit noch kürzerer Lebenserwartung oder als Typ B mit relativ geringen Symptomen manifestieren. Der Hauptunterschied besteht darin, dass Typ-A-Patienten eine sehr geringe (<5%) ihrer Sphingomyelinase-Aktivität aufweisen, während Typ-B-Patienten nur geringfügig weniger Aktivität als normal (~90%) aufweisen.

Schließlich ist anzumerken, dass die großen Vakuolen von Pflanzenzellen in der Tat spezialisierte Lysosomen sind. Denken Sie daran, dass Vakuolen dazu beitragen, den Turgor oder den äußeren Wasserdruck auf die Zellwände aufrechtzuerhalten, der zu einem starren Pflanzenteil und nicht zu einem schlaffen, welken führt. Dies geschieht unter anderem dadurch, dass die sauren Hydrolasen in der Vakuole den osmotischen Druck in der Vakuole verändern, um die Bewegung des Wassers entweder hinein oder heraus zu regulieren.

Ein weiteres Beispiel für eine rezeptorvermittelte Endozytose ist der Import von Eisen in eine Säugerzelle. Wie beim Serumcholesterin wird Eisen im Allgemeinen nicht von selbst in die Zelle importiert. Stattdessen ist es an Apotransferrin gebunden, ein Serumprotein, das zwei Fe . bindet3+ Ionen. Nachdem es die Eisenionen gebunden hat, wird das Apotransferrin nun als Transferrin bezeichnet und kann von Transferrin-Rezeptoren (TfR) auf der extrazellulären Oberfläche von Zellmembranen erkannt und gebunden werden. Dies initiiert eine rezeptorvermittelte Endozytose wie oben beschrieben. In diesem Fall ist das Lysosom jedoch nicht beteiligt. Da Transferrin und Transferrinrezeptor das frühe Endosom erreichen, dissoziieren sie nicht, sondern das Fe2+ wird vom Transferrin freigesetzt und verlässt dann das Endosom über DMT1, ein zweiwertiges Metalltransportprotein, das in Hämgruppen oder anderen Komplexen verwendet werden kann. Zurück bleibt der Apotransferrin-TfR-Komplex, der über Vesikel zur Zellmembran zurückgeführt wird. Sobald das Vesikel mit dem extrazellulären Raum verschmilzt, wird die Acidität des Endosoms abgebaut und das Apotransferrin bindet nicht mehr an TfR. Damit kann Apotransferrin wieder zu seiner Aufgabe zurückkehren, Eisenionen zu finden und in die Zelle zurückzubringen.


Grenzen in der Immunologie

Die Zugehörigkeiten der Herausgeber und Gutachter sind die neuesten Angaben in ihren Loop-Forschungsprofilen und spiegeln möglicherweise nicht ihre Situation zum Zeitpunkt der Überprüfung wider.


  • Artikel herunterladen
    • PDF Herunterladen
    • ReadCube
    • EPUB
    • XML (NLM)
    • Ergänzend
      Material
    • EndNote
    • Referenzmanager
    • Einfache TEXT-Datei
    • BibTex


    TEILEN EIN

    Einführung

    Myosin VI (Myo6) ist ein Mitglied der Myosin-Familie von auf Aktinfilamenten basierenden molekularen Motoren, die an einer Vielzahl von Funktionen beteiligt sind, einschließlich Clathrin-vermittelter Endozytose, Vesikeltransport, Bestimmung der Zellpolarität und Zellmigration (Buss et al. 2004). Myo6 ist insofern einzigartig unter den Myosinen, als es sich zum spitzen (Minus-)Ende des Aktinfilaments hin bewegt, in entgegengesetzter Richtung zu der aller anderen bisher charakterisierten Myosine (Wells et al. 1999). Da Aktinfilamente in Zellen überwiegend mit ihren spitzen Enden zum Zellinneren ausgerichtet sind, wurde vorgeschlagen, dass Myo6 die durch seine Bewegung auf Aktinfilamenten erzeugte Kraft nutzen könnte, um gebundene Ladung wie entstehende endozytische Vesikel an der Plasmamembran zu ziehen oder zu transportieren. unbeschichtete apikale endozytische Vesikel und membrangebundene Rezeptoren in die Zelle (Buss et al. 2004 Hasson 2003). In der Niere wird Myo6 stark im Bürstensaum (BB) von Epithelzellen des proximalen Tubulus (PT) exprimiert, wo es teilweise in der intermikrovillaren (interMV) Domäne lokalisiert ist, dem Ort der Megalin-abhängigen, Clathrin-vermittelten Endozytose von durch den Glomerulus gefilterte Plasmaproteine ​​(Biemesderfer et al. 2002). Diese Lokalisation von Myo6 wird während der PT-Differenzierung festgestellt, wenn die Zellen endozytosekompetent werden (Biemesderfer et al. 2002). Ein Teil von Myo6 ist auch in MV vorhanden (Biemesderfer et al. 2002) und Immunelektronenmikroskopie-Studien von Yang et al. weisen darauf hin, dass in Ratten-PT-Zellen bis zu 50% von Myo6 in MV lokalisiert sind (Yang et al. 2005). Interessanterweise beobachteten diese Arbeiter, dass bei Ratten, die akutem Bluthochdruck ausgesetzt waren, eine Umverteilung von MV-assoziiertem Myo6 in die interMV-Domäne stattfindet. Daher können Unterschiede in den zur Gewebepräparation verwendeten Methoden (z. B. Perfusions-Fixierungsdruck) die berichteten Unterschiede in den relativen Spiegeln von MV gegenüber der interMV-Lokalisierung von Myo6 erklären.

    Die PT-spezifischen endozytischen Multiligandenrezeptoren Megalin und sein Bindungspartner Cubulin, ein peripheres Membranprotein, vermitteln die Rückresorption einer großen Anzahl glomerulär gefilterter Proteine, darunter Albumin, das am häufigsten im Plasma vorkommende Protein (Birn und Christensen 2006 Christensen und Gburek 2004). Da Myo6 direkt an die Clathrin-assoziierten Adapterproteine ​​Dab2 und GIPC (GAIP interacting protein, C-terminal)/Synektin (Buss et al. 2004) bindet, die auch Megalin binden (Lou et al. 2002 Oleinikov et al. 2000 ) kann Myo6 für die Proteinendozytose durch PT-Zellen wichtig sein. Die Bedeutung der funktionellen PT-Endozytose wird durch die Korrelation zwischen dem Grad der Proteinurie und der Progressionsrate verschiedener Nierenerkrankungen und in vitro-Befunden unterstrichen, dass hohe Proteinkonzentrationen die Produktion von entzündlichen und fibrogenen Mediatoren durch Tubuluszellen induzieren (Birn und Christensen 2006) . Während insbesondere die glomeruläre Filtrationsbarriere den Durchgang des größten Teils des Serumalbumins in das Tubuluslumen verhindert, wird eine nennenswerte Menge Albumin vom Glomerulus gefiltert und anschließend vom PT resorbiert (Birn und Christensen 2006 Gekle 2005) und die Menge der über den Urin ausgeschiedenen Albuminmenge, die die Integrität dieser beiden Prozesse widerspiegelt, ist ein wichtiger Indikator für eine Nierenerkrankung.

    In-vitro-Studien mit dominant negativer Myo6-Expression in Zelllinien haben gezeigt, dass Myo6 für die Clathrin-vermittelte Endozytose und den Transport unbeschichteter endozytischer Vesikel essentiell ist (Aschenbrenner et al. 2003 Buss et al. 2001). Darüber hinaus können in Myo6-defizienten Neuronen, die aus dem Myo6-Funktionsnull kultiviert wurden, Snell’s Walzer (sv/sv) Maus, kommt es zu einer selektiven Hemmung der Clathrin-vermittelten Endozytose, da die Glutamat-, nicht aber die Transferrin-Rezeptor-Internalisierung gehemmt wird (Osterweil et al. 2005). Diese Mäuse zeigen auch eine reduzierte und verzögerte apikale Endozytose von CFTR in jejunalen Enterozyten (Ameen und Apodaca 2007). Sv/sv Mäuse sind taub, und ihre einzigen offensichtlichen abnormalen Phänotypen sind kreisendes/hyperaktives Verhalten, das aus der Degeneration des neurosensorischen Epithels des Innenohrs (Avraham et al. 1995, Deol und Green 1966) und einer geringeren Körpergröße resultiert. In dieser Studie untersuchten wir die physiologischen und histologischen Folgen des Verlusts der Myo6-Funktion in der Niere. Physiologische Messungen und Studien zur renalen Clearance zeigten einen erhöhten Blutdruck in sv/sv Mäuse verglichen mit Kontrolltieren unter Beibehaltung der normalen glomerulären Filtrationsrate (GFR), des Urinvolumens und der Urinkonzentrationsfähigkeit. Der Albuminspiegel im Urin war erhöht in sv/sv Mäuse, und die in-vivo-Aufnahme von HRP war in sv/sv PTs, was auf eine Rolle von Myo6 bei der PT-Proteinendozytose hinweist. Zusätzlich, sv/sv Nieren zeigten eine verringerte Assoziation von Adaptin β und Dab2 mit der BB-Membran und eine verringerte apikale Vakuolenzahl in PT-Zellen. Histologisch, sv/sv Nieren zeigten PT-Dilatation und Fibrose mit Anzeichen einer epithelial-mesenchymalen Transdifferenzierung (EMT) der Tubuluszellen. Diese Studie zeigt das Vorhandensein von Defiziten bei der Proteinresorption und Pathologie in der sv/sv Niere, mit dem interessanten Befund, dass die Nierenfunktion insgesamt weitgehend erhalten bleibt.


    Abstrakt

    Der apikale Transport ist für die Nierenfunktion von entscheidender Bedeutung, und die Aktivität von Efflux-Transportern und der rezeptorvermittelten Endozytose ist in diesem Prozess von entscheidender Bedeutung. Die bedingt immortalisierte proximale Tubulusepithelzelllinie (ciPTEC) exprimiert diese Systeme endogen. Hier haben wir ciPTEC verwendet, um die Aktivität von drei wichtigen Efflux-Transportern zu untersuchen, nämlich Brustkrebs-Resistenzprotein (BCRP), Multidrug-Resistenzprotein 4 (MRP4) und P-Glykoprotein (P-gp) sowie die Proteinaufnahme durch rezeptorvermittelte Endozytose unter Verwendung eines fluoreszenzbasierten Aufbaus für Transportassays. Zu diesem Zweck wurden die Zellen Hoechst33342, Chlormethylfluorescein-Diacetat (CMFDA) und Calcein-AM in Gegenwart oder Abwesenheit von Modellinhibitoren für BCRP (KO143), P-gp (PSC833) oder MRPs (MK571) ausgesetzt. Die Überexpressionszelllinien MDCKII-BCRP und MDCKII-P-gp wurden als positive Kontrollen verwendet und Membranvesikel, die einen Transporter überexprimierten, wurden verwendet, um die Substrat- und Inhibitorspezifitäten zu bestimmen. Die rezeptorvermittelte Endozytose wurde untersucht, indem die intrazelluläre Akkumulation von fluoreszenzmarkiertem Rezeptor-assoziiertem Protein (RAP-GST) bestimmt wurde. In ciPTEC zeigten BCRP und P-gp ähnliche Expressionen und Aktivitäten, während MRP4 häufiger exprimiert wurde. Hoechst33342, GS-MF und Calcein werden in Gegenwart von KO143, MK571 und PSC833 zurückgehalten, was eine deutliche Redundanz zwischen den Transportern zeigt. Bemerkenswert ist die Tatsache, dass sowohl KO143 als auch MK571 BCRP, P-gp und MRPs blockieren können, während PSC833 ein potenter Inhibitor für BCRP und P-gp, aber nicht die MRPs zu sein scheint. Darüber hinaus akkumuliert ciPTEC dosis- und zeitabhängig RAP-GST in intrazellulären Vesikeln, was in Megalin-defizienten Zellen reduziert wurde. Zusammenfassend lässt sich sagen, dass fluoreszenzsondenbasierte Assays schnell und reproduzierbar sind, um apikale Transportmechanismen zu bestimmen. in vitro. Wir zeigen, dass typische Substrate und Inhibitoren nicht spezifisch für die benannten Transporter sind, was die komplexen Wechselwirkungen widerspiegelt, die stattfinden können in vivo. Die von uns beschriebenen Werkzeuge sind auch mit innovativen Nierenkulturmodellen kompatibel und ermöglichen die Untersuchung von Transportmechanismen, die für die Aufnahme, Disposition und Entgiftung von Medikamenten von zentraler Bedeutung sind.


    Abstrakt

    Es ist bekannt, dass die Aufnahme von Nanopartikeln (NPs) durch eine Zellmembran von der NP-Größe abhängt, aber der Weg und die Kinetik für die Endozytose mehrerer NPs bleiben noch unklar. Mit Hilfe von Computersimulationstechniken zeigen wir, dass die Internalisierung mehrerer NPs tatsächlich ein kooperativer Prozess ist. Der kooperative Effekt, der in dieser Arbeit als Ergebnis einer durch die Membrankrümmung vermittelten NP-Wechselwirkung interpretiert wird, hängt von der NP-Größe, der Membranspannung und der NP-Konzentration auf den Membranen ab. Während kleine NPs im Allgemeinen zu einem dicht gepackten Aggregat auf der Membran gruppieren und als Ganzes internalisieren, neigen NPs mit mittlerer Größe dazu, zu einer linearen, perlenkettenartigen Anordnung zu aggregieren, und große NPs neigen dazu, sich voneinander zu trennen und unabhängig zu internalisieren . Der kooperative Umhüllungsprozess wird auch durch den Größenunterschied zwischen benachbarten NPs beeinflusst. Abhängig vom Größenunterschied benachbarter NPs und dem Abstand zwischen den NPs werden vier verschiedene Internalisierungswege beobachtet, nämlich synchrone Internalisierung, asynchrone Internalisierung, pinocytoseartige Internalisierung und unabhängige Internalisierung.


    DISKUSSION

    Unsere Daten legen die Bestimmung einer gemeinsamen Domäne in β-Adaptinen und der regulatorischen Untereinheit H der vakuolären ATPase mit signifikanter struktureller und funktioneller Ähnlichkeit nahe. Darüber hinaus weist diese Domäne in β-Adaptinen eine Spezifität für Dileucin-basierte Sortiermotive auf und ist am endozytischen Transport beteiligt. Dieser Befund stützt frühere Ergebnisse einer limitierten tryptischen Proteolyse von AP-1, die nahelegten, dass die Interaktionsstelle des LL-Motivs in CD3γ im N-terminalen ∼65-kDa-Stammabschnitt von β1 liegt (Rapoport et al., 1998).

    In diesem Bericht zeigen wir, dass das Dileucin-basierte Internalisierungsmotiv von Nef an die ARM-Wiederholungsstruktur von V1H (133–483) bindet, die Sequenzhomologie zu β-Adaptinen aufweist (Abbildungen 2-4). Die Expression der homologen Fragmente von V1H, β1 und β2 in Zellen blockiert die Internalisierung von Transmembranproteinen, die von Dileucin-basierten Sortiermotiven abhängen (Abbildungen 5 und 6). Beide β-Adaptin-Fragmente β1F und β2F aus den Adapterproteinkomplexen AP-1 und AP-2 zeigen eine homogene Verteilung im Zytoplasma und der Plasmamembran transfizierter Zellen (Abbildung 5). Diese Beobachtung legt nahe, dass die Spezifität von AP-Komplexen für unterschiedliche subzelluläre Lokalisationen auf Untereinheiten zurückzuführen ist, die einen höheren Grad an Heterogenität aufweisen, nämlich die großen α- und γ-Untereinheiten (Boehm und Bonifacino, 2001), während die hochhomologen Fragmente β1F und β2F hier identifizierten (92,3% Sequenzidentität) bilden eine strukturell und funktionell ähnliche Domäne. Somit sollte die Expression der verschiedenen LL-bindenden Domänen zu ihrer Assoziation mit Dileucin-Motiven an praktisch allen subzellulären Stellen führen, ohne zwischen unterschiedlichen Transportkomplexen zu unterscheiden. Da die LL-Bindungsdomänen die Hinge-Region mit dem Clathrin-Box-Signal sowie die sukzessive β-Anhängerdomäne verfehlen, wird die Rekrutierung von transportkompetenten Komplexen bei Bindung an ein Dileucin-Motiv gehemmt. Interessanterweise erinnert dieser dominante negative Effekt an den von Puertolano . verwendeten VHS-GAT-Konstrukt des GGA1-Proteinset al. (2001).

    Erst kürzlich wurde festgestellt, dass das saure Cluster-Dileucin-Motiv der zytosolischen Schwänze von Sortilin und der Mannose-6-Phosphat-Rezeptor die VHS-Domäne von GGA-Proteinen (Nielsen et al., 2001Puertollano et al., 2001 Zhu et al., 2001). Die monomeren GGAs sind eine Multidomänen-Proteinfamilie, die am Proteintransport zwischen Golgi und Endosomen beteiligt ist. Frühere Strukturanalysen zeigen, dass die kleine 18-kDa-VHS-Domäne des Hrs-Proteins aus drei HEAT- oder ARM-Wiederholungen besteht (Mao et al., 2000), eine Proteinfaltung, die kürzlich auch in der Struktur der regulatorischen Untereinheit H der V-ATPase gefunden wurde (Sagermann et al., 2001). Aufgrund der gefundenen Sequenzähnlichkeit schließen wir, dass auch β-Adaptine und β-COP HEAT- oder ARM-Repeat-enthaltende Proteine ​​sind. Diese Beobachtungen legen nahe, dass HEAT- oder ARM-Wiederholungen das strukturelle Gerüst für die Erkennung von Dileucin-basierten Sortiermotiven bilden. Die detaillierte Spezifität für die erkannten Sequenzmotive muss jedoch für jede Proteinfamilie individuell bestimmt werden. In Übereinstimmung mit unseren Daten kann eine zusätzliche Spezifität für die Bindung an LL-Motive in β-Adaptinen von der μ-Kette der Adapterproteinkomplexe stammen, wie bereits vorgeschlagen (Hofmann et al., 1999). Da der N-terminale Stamm von β-Adaptinen die μ-Kette im AP-Aufbau binden soll (Hirst und Robinson, 1998Kirchhausen, 1999), könnte die Grenzfläche dieser beiden Moleküle zu einer kombinatorischen Oberfläche für Dileucin-basierte Motiverkennung.

    Eine Hauptschwierigkeit bei der Analyse endozytischer Transportkompartimente liegt in der geringen Affinität der Erkennung der verschiedenen Motive in vitro (Marsh und McMahon, 1999 Pearse et al., 2000). Für das LL-Motiv ist diese Beobachtung zusätzlich mit einer geringen Signaturspezifität gepaart, da Leucine die am häufigsten vorkommenden Reste sind und statistisch häufig zwei aufeinanderfolgende hydrophobe Reste vorkommen. Die Bildung eines multiplen Helixbündels, wie auch die repetitive HEAT- oder ARM-Repeat-Faltung, ist oft weniger empfindlich gegenüber N- oder C-terminaler Verkürzung als ein β-Faltblatt, wie z. B. die YxxL-Bindungsdomäne in μ2. In μ2 assoziiert das erste β-Faltblatt der YxxL-Bindungsdomäne mit 280 Resten mit dem vorletzten β-Faltblatt (Owen und Evans, 1998), und Verkürzungen an beiden Enden führen zum sofortigen Verlust der Bindungserkennung (Aguilar et al., 1997). Für den N-terminalen Rumpfteil von β-Adaptinen mit seiner vorgeschlagenen helikalen Struktur schlagen wir stattdessen vor, dass ein Proteinfragment, das nicht genau die erforderliche LL-Bindungsdomäne widerspiegelt, aber flexible Linkersegmente aufweist, seine eigene Zielstelle blockieren könnte. Daher könnte die Übertragung der Kartierungsergebnisse von V1H basierend auf Sequenzähnlichkeiten zu β-Ketten der Schlüssel zur Bestimmung eines Fragments in β-Adaptinen gewesen sein, das an Dileucin-basierte Sortiermotive bindet.

    Auf spekulativer Ebene schlagen wir vor, dass das Clathrin-Box-Signal LLNLD (Shih et al., 1995) oder andere LL-Stellen in der flexiblen Hinge-Region von β-Adaptinen konkurrieren in einem dynamischen Austauschprozess mit Dileucin-Sortiermotiven um die Bindung an ihre Zielstelle. Diese intramolekulare Interaktion würde durch die Erkennung eines echten LL-Sortiersignals gestört, was zu einer kontinuierlichen Exposition des Clathrin-Box-Signals führt und anschließend den Aufbau von AP-Clathrin-Hüllen induziert. Interessanterweise sind in β1- und β2-Adaptinen 5 LL- und 3 LI-Stellen innerhalb der 194 Reste zwischen der hier identifizierten LL-Bindungsdomäne und der β-Anhängerdomäne vorhanden (Abbildung 7B). Diese Autohemmung könnte einen funktionellen Schalter durch eine Konformationsänderung induzieren, die die Ladungsaufnahme anzeigt und die Bildung der Clathrinhülle initiiert. Dieses Modell würde auch erklären, warum leere Clathrinkäfige in vivo nie beobachtet werden (Kirchhausen, 1999) und mit früheren Beobachtungen durch Elektronenmikroskopie korrelieren, die verschiedene Anordnungen der Anhängseldomäne relativ zum Rumpfabschnitt zeigen (Heuser und Keen, 1988). Interessanterweise wurde für Importin α die Autohemmung durch ein internes nukleäres Lokalisierungssignal entdeckt und als Erklärung für den regulatorischen Wechsel zwischen der zytoplasmatischen, hochaffinen Form und der nukleären, niedrigaffinen Form für die NLS-Bindung des Importins gefunden (Kobe, 1999).

    Abb. 7. Modelldarstellung des Dileucin-Sortiermotivs in Nef und vorgeschlagene Domänenorganisation seiner Zielstellen. (A) Sequenz der flexiblen Schleife (Reste 152–184) von HIV-1 Nef (SF2) und Modellstruktur. Acht benachbarte Asparagin- und Glutaminsäurereste bilden einen stark negativ geladenen Cluster an den N- und C-Termini der flexiblen Schleife, während das Dileucin-basierte Motiv ExxxLL am besten in seiner Mitte exponiert ist. Der Grad der Ähnlichkeitserhaltung basierend auf 186 analysierten Sequenzen (Geyer und Peterlin, 2001) ist neben der Sequenz gedruckt. Die Bildung des negativ geladenen Clusters wird in der elektrostatischen Oberflächenanzeige (rechts) angezeigt. Die Abbildung wurde mit GRASP (Nicholls et al., 1991) unter Verwendung einer elektrostatischen Potentialanzeige von -16 kBT (rot) bis +16 kBT (blau). (B) Vorgeschlagene modulare Organisation für die Dileucin-Bindungsdomäne in β2 und ihre homologen Domänen in V1H und β-COP. Die flexible Gelenkregion, die das Clathrin-Box-Signal enthält, und die β-Anhängseldomäne sind markiert. Proteindomänensequenzen teilen 20,3% Identität zwischen V1H und β2 und 19,9% Identität zwischen β2 und β-COP. Die Konsensusstelle GEY in allen drei Proteinen (Position 415 in V1H) ist angegeben.

    Unter normalen Umständen werden CD4-Moleküle über ein Dileucin-Motiv in ihrem zytoplasmatischen Schwanz von der Plasmamembran internalisiert. Wie kann Nef die CD4-Endozytose aus der Plasmamembran unter Verwendung eines ähnlichen Dileucin-basierten Motivs zur Internalisierung verbessern? Die meisten Dileucin-basierten Sortiermotive enthalten einen stromaufwärts liegenden sauren Rest (D/ExxxLL) oder zusätzliche Phosphorylierungsstellen (Wilde und Brodsky, 1996). Ein minimaler Abstand von der Plasmamembran sowie diese sauren Reste N-terminal zum LL-Motiv erwiesen sich als kritisch für die Internalisierung (Geisler et al., 1998). Obwohl der zytosolische Teil von CD4 diese sauren Reste nicht enthält, sondern eher positiv geladen ist (pich 11.7), sofern nicht an seinen Serinresten phosphoryliert (Pitcher et al., 1999), enthalten die 33 Aminosäuren umfassenden flexiblen Schleife von Nef 10 saure Reste (pich 4.0) meist an seinen beiden Enden (Abbildung 7A). Diese Reste stehen sich gegenüber und bilden einen hochkonservierten negativen Cluster stromaufwärts des LL-Motivs (Geyer und Peterlin, 2001), der als EEx . beschrieben werden kann8LLx8DD-Internalisierungssignal. Im membrangebundenen Nef-Protein können diese sauren Reste dazu führen, dass das LL-Motiv dem Zytosol ausgesetzt wird und die Bevorzugung negativer Ladungen für die Erkennung der Dileucin-Bindungsdomäne befriedigen und daher die Internalisierung des CD4-Nef-Komplexes verstärken verglichen mit CD4 allein. Somit würde die Wechselwirkung von Nef mit CD4 das von der Phosphorylierung abhängige Dileucinsignal von CD4 in ein konstitutiv aktives Dileucinsignal von Nef umwandeln.

    Die Ähnlichkeiten, die für die Fragmente in V1H, β-Adaptinen und β-COP gefunden wurden, legen eine gemeinsame modulare Organisation der drei verschiedenen Proteine ​​nahe ( 7B ). Sie könnten zu der kürzlich beschriebenen Organisation der gemeinsamen Domänen von Adapterproteinkomplexen und Coatomeraggregaten beitragen (Eugster et al., 2000 Böhm und Bonifacino, 2001). Auch legen unsere Ergebnisse eine verwandte Funktion für die regulatorische Untereinheit H der vakuolären ATPase nahe. Da Wechselwirkungen zwischen den V1 und V0 Sektor der V-ATPase sind dynamisch und werden durch extrazelluläre Bedingungen reguliert (Kane, 2000), V1H könnte als spezialisiertes Transportmolekül fungieren. Zukünftige Studien werden enthüllen, ob die gesamte V-ATPase für die Funktionen von V1H bei der intrazellulären Sortierung benötigt wird und wie diese Prozesse reguliert werden. Mit der Identifizierung der Domänenorganisation im N-terminalen Stamm von β-Adaptinen sind nun präzise funktionelle und strukturelle Studien möglich. Die dominanten negativen Effekte der LL-bindenden Domänen sollten für funktionelle Studien zum Transport von Proteinen mit Dileucin-basierten Sortiermotiven nützlich sein. Darüber hinaus erscheint die Stabilität der identifizierten Domäne vielversprechend für ihre anschließende Kristallisation und strukturelle Charakterisierung.


    Materialen und Methoden

    1. Westernblot mit Live P. Larven und E. coli

    Winterarbeiter-Honigbienen-Hämolymphe (hl) und Fettkörperproteinextrakt (fb) sind reich an Vg und wurden zum Testen der Vg-Bindung an Bakterien verwendet, adaptiert aus dem Fisch-Vg-Experiment von Tong et al. [17] unter Verwendung eines Antikörpers, der Honigbienen-Vg erkennt. Für zellfreie hl- und fb-Probenahme siehe Havukainen et al. [33]. Das Experiment wurde bei Raumtemperatur durchgeführt, die Zentrifugationsschritte betrugen 3.000 g für 5 min und das Waschvolumen betrug 0,5 ml PBS, wenn nicht anders angegeben. P. Larven (Stamm 9820, erworben von Belgian Coordinated Collections of Micro-organisms, Gent, Belgien), kultiviert auf MYPGP-Agarplatten für 7 Tage und Epicurian Gold E. coli über Nacht in LB-Medium gewachsene Flüssigkultur wurden gewaschen und in 100 &mgr;l PBS pro Probe suspendiert. Die Bakteriensuspensionen (

    1,3 x 10 8 Zellen/ml) wurden entweder mit einem gleichen Volumen Hämolymphe, verdünnt 1/10 in PBS mit einem Protease-Inhibitor-Cocktail (Roche, Penzberg, Deutschland) oder mit Fettkörperproteinextrakt (5,7 mg/ml Gesamtprotein in PBS .) gemischt mit den Proteasehemmern). Folgende Negativkontrollen wurden verwendet: 1) 100 µl P.Larven und E. coli mit gleichem Volumen PBS, aber ohne hl/fb, um eine mögliche unspezifische Antikörperbindung an die Bakterien nachzuweisen, 2) 100 μl fb mit gleichem Volumen PBS, aber ohne Bakterien, um eine mögliche Vg-Aggregation nachzuweisen, und 3) 100 μl P.Larven und E. coli mit 100 µl 5 mg/ml Rinderserumalbumin (BSA-Kontrollprotein) behandelt. Als unbehandelte Kontrollen hielten wir 0,1 µl hl, 0,5 µl fb-Extrakt und 1 µl BSA auf Eis. Die Proben wurden bei 26°C für 50 min unter Rühren inkubiert, damit die Vg-Bakterien-Bindung auftritt. Die Bakterien wurden sechsmal gewaschen. Das endgültige Pellet wurde in 10 µl 4 M Harnstoff in PBS resuspendiert, 15 min gerührt und zentrifugiert. Die Proben wurden auf eine Nitrozellulosemembran gemäß einem Standardprotokoll für Meerrettichperoxidase-Konjugat mit dem zuvor getesteten Vg-Antikörper [33, 34] (Verdünnung 1:25.000 Pacific Immunology, Ramona, CA, USA) oder einem handelsüblichen BSA-Antikörper ( 1:2000 Life Technologies, Carlsbad, CA, USA). Die Banden wurden mit dem Immune-Star-Kit und dem ChemiDoc XRS+-Imager visualisiert. Alle Blotting-Reagenzien wurden von Bio-Rad (Hercules, CA, USA) bezogen.

    2. Mikroskopie von P. Larven und E. coli

    Die Vg-Bindung an Bakterien wurde weiter durch Fluoreszenzmikroskopie getestet. Die Inkubation mit hl war wie oben, außer dass hl und Bakterienvolumen beide 20 μl betrugen und die Anzahl der Bakterienzellen betrug

    3 x 10 6 . Alle Zentrifugationsschritte betrugen 10.000 g, +4 °C, 5 min und das PBS-T-Waschvolumen betrug 1 ml. Nach hl-Inkubation mit den Bakterien wurden die Bakterien gewaschen und mit 4% Paraformaldehyd für 10 min bei Raumtemperatur fixiert. Die Zellen wurden zweimal gewaschen und mit 5% Milch in PBS-T für 30 min bei Raumtemperatur blockiert und erneut gewaschen. Vg-Primärantikörper (wie oben) wurde 1:50 in PBS-T und 1% Milch zur Inkubation über Nacht bei +4°C verwendet. Die Proben wurden zweimal gewaschen und mit Alexa fluor 488 nm Anti-Kaninchen-Antikörper, 1:50, für 1 h bei Raumtemperatur im Dunkeln inkubiert und dreimal gewaschen. DNA wurde mit dem Standardprotokoll Propidiumiodid (PI) (Invitrogen) gefärbt. Die Bakterien wurden mit Glycerin befestigt und mit Zeiss Axio Imager M2 abgebildet, Anregungen 499 nm und 536 nm und Emissionen 519 nm und 617 nm. Der Primärantikörper wurde bei der Behandlung der Sekundärantikörperkontrollproben weggelassen.

    3. Oberflächenplasmonenresonanz mit LPS, PG und Zymosan

    Vg wurde aus Honigbienen-Hämolymphe mit Ionenaustauschchromatographie wie zuvor beschrieben gereinigt [20,34]. Es wurden Biacore T200-Instrument (GE Healthcare, Waukesha, USA) und Puffer des Herstellers verwendet. Die Analyten wurden von Sigma Aldrich bezogen: PG von S. aureus #77140, LPS von E. coli #L2630 und Zymosan aus S. cerevisiae #Z4250. 30 µl/ml Vg in 10 mM Acetatpuffer pH 4,5 wurden auf einem CM5-Chip immobilisiert – geprimt und nach Herstellerangaben konditioniert – bis die Reaktion 5150 RU erreichte. Der Chip wurde mit Ethanolamin blockiert. Die Analyten wurden im Laufpuffer (0,1 M HEPES, 1,5 M NaCl und 0,5% v/v Tensid P20) suspendiert und 30 min unter wiederholtem kräftigem Vortexen auf 90 °C erhitzt, gefolgt von 20 min Zentrifugieren in einer Tischzentrifuge. Zymosan wurde vor der Zentrifugation weitere 30 min auf 95 °C erhitzt. PG und Zymosan bilden in wässrigen Lösungen eine feine Suspension, und sie bildeten während der Zentrifugation ein Pellet, ihre Konzentrationen sind hier als das dem Volumen hinzugefügte Gewicht angegeben. Die Analyten wurden mit 120 s Kontaktzeit und 600 s Dissoziationszeit mit einer Flussrate von 30 μl/min bei 25°C laufen gelassen. Als Blindwert wurde der in einem separaten Kanal auf einem nackten Chip fließende Analyt verwendet, dessen Wert von der Probe abgezogen wurde. Nach Optimierung des Bindungsbereichs wurden die folgenden Konzentrationen gemessen. PG: 0, 0,25, 0,5, 2, 3,5 mg/ml LPS: 0, 0,1, 0,2, 0,9, 1,8, 3 mg/ml und Zymosan: 0, 0,5, 1, 2, 3, 4 mg/ml . Die PG- und LPS-Bindung erreichte keine Bindungssättigung, jedoch überschritten wir die Konzentration von 5 mg/ml bzw. 3 mg/ml nicht, um eine Aggregation des Analyten zu vermeiden (Arbeitskonzentrationen siehe Herstellerangaben und Referenzen darin).

    4. Mikroskopie der Eierstöcke der Königin

    Sechs ein Jahr alt EIN. mellifera ligustica Königinnen wurden auf Eis betäubt. Ihre Eierstöcke wurden seziert und in eiskaltem PBS gewaschen. Einer der gepaarten Eierstöcke pro Königin wurde dann in eine Kontrolllösung (50 µl PBS mit 2 mg/ml Texas Red-markiertem E. coli Bioparticles Life Technologies, Carlsbad, CA, USA) und der andere Eierstock wurde in dieselbe Lösung gegeben, die zusätzlich 0,5 mg/ml Vg, gereinigt aus Honigbienen-Hämolymphe, enthielt [20,33]. Die Eierstöcke wurden bei 28 °C für 2 h unter Rühren inkubiert. Als nächstes wurden die Eierstöcke zweimal in 1 ml eiskaltem PBS für 5 min unter Rühren gewaschen. Proben von zwei Königinnen wurden direkt unter Verwendung von Fluoromount (Sigma) montiert und durch Hellfeld- und Fluoreszenzmikroskopie (Anregung 595 nm, Emission 615 nm) beobachtet (Axio Imager M2, Carl Zeiss AG, Oberkochen, Deutschland). Eine weitere unbehandelte Kontrollkönigin wurde zum Nachweis des autofluoreszierenden pedikalen Bereichs des Ovars abgebildet. Die restlichen vier Königinnen wurden in Tissue-Tek (Sakura Finetek, Torrance, CA, USA) eingebettet und bei –80°C gelagert. Diese Ovarien wurden bei -20ºC in 17-mm-Schnitte geschnitten und unmittelbar nach dem Aufsetzen abgebildet. Die Mikroskopieeinstellungen wurden während der Bildgebung konstant gehalten.

    Um zu testen, ob Hämolymphproteine ​​auch in Abwesenheit von Vg die Aufnahme von Immunauslösern auslösen können, haben wir den Versuchsaufbau modifiziert, um andere Hämolymphproteine ​​als Vg einzubeziehen, von denen die meisten Apolipophorin und Hexamerine sind, die beide bekanntermaßen an Immunauslöser binden [35 ]. Die anderen Hämolymphproteine ​​wurden durch Durchführen einer Ionenaustauschchromatographie an Honigbienenhämolymphe und Aufteilen der gesammelten Hämolymphfraktionen in Vg- und Nicht-Vg-Proteine ​​erhalten (S1 Abb.) [20,33]. Verbleibende Hämolymphmoleküle mit kleinem Molekulargewicht, wie mögliche Peptide und Hormone, wurden während der Proteinkonzentration unter Verwendung von Zentrifugalfiltern mit einem Cutoff von 50 kDa sowohl mit Vg- als auch Nicht-Vg-Fraktionen (Millipore, Billerica, MA, USA) entfernt. Fraktionen, die sowohl Vg als auch andere Hämolymphproteine ​​enthielten, wurden verworfen.Die Vg- und die Nicht-Vg-Proteine ​​hatten im Experiment eine Endkonzentration von 0,5 mg/ml. Die Königinnen waren wie oben. Der Aufbau war wie folgt (alle Inkubationen enthielten die E. coli Biopartikel 1,5 mg/ml): ein Eierstock wurde mit Vg und der andere mit Kontrolllösung (siehe oben) inkubiert (N = 3), einer mit Vg und der andere mit Nicht-Vg-Hämolymphproteinen (N = 3), und ein Eierstock mit Nicht-Vg-Hämolymphproteinen und das andere mit Kontrolllösung (N = 2). Die Kryoschnitt-Bildgebung wurde wie oben durchgeführt.


    Ergebnisse

    Erzeugung von EHD1-defizienten Mäusen

    EHD1-defiziente Mäuse wurden unter Verwendung einer Rekombinationsstrategie erzeugt, wie in Methoden ( 1A ) beschrieben. Die PCR-Analyse der Schwanz-DNA bestätigte die Ehd1 Gen wurde in heterozygoten deletierten (Ehd1 +/- ), homozygot deletiert (Ehd1 -/- ), heterozygote floxed (Ehd1 fl-Neo/+ ) und homozygot floxed (Ehd1 fl-Neo/fl-Neo ) Mäuse (Abbildung 1B). RT-PCR bestätigte auch das Fehlen von Ehd1 mRNA im Hoden von Ehd1 –/– männliche Mäuse (Abbildung 1C).

    Generation von Ehd1 -/- Mäuse mit Cre/ loxP -vermittelte genetische Rekombination. (A) Eine partielle Restriktionskarte der Ehd1 Locus, der Targeting-Vektor und das mutierte Ehd1 Orte. Das erste Exon wurde von Cre/ gelöscht.loxP-vermittelte Rekombination. Schwarze Rechtecke repräsentieren Exons, graue und weiße Dreiecke repräsentieren loxP und FRT Sequenzen bzw. H, HindIII RI, ÖkoRI. (B) DNA wurde aus Mausschwänzen für die Genotypisierung durch PCR präpariert, um das WT . zu amplifizieren Ehd1 Allel, das deletierte Allel und/oder das floxed Allel. Die mit "keine Matrize" gekennzeichnete Spur zeigt eine negative Kontrolle in Abwesenheit von DNA an. (C) Die RT-PCR-Analyse wurde unter Verwendung von cDNA durchgeführt, die aus Maushoden und Primern, die für spezifisch sind, generiert wurde Ehd1 und Ehd4. Die Primer sind in Methoden beschrieben.

    Zuvor haben wir gezeigt, dass EHD-Proteine ​​in mehreren Mausorganen sowohl bei männlichen als auch bei weiblichen Mäusen exprimiert werden [7]. Western-Blots, durchgeführt mit Lysaten von Mausorganen, die aus WT gewonnen wurden, Ehd1 +/- und Ehd1 -/- Mäuse bestätigten, dass die Störung von Ehd1 führte zu einem Verlust der EHD1-Proteinexpression in Ehd1 –/– männliche (Abbildung 2) sowie weibliche Mäuse (Daten nicht gezeigt). Mittlere EHD1-Spiegel wurden in Lunge, Niere, Herz, Milz und Hoden von . beobachtet Ehd1 +/- Mäuse im Vergleich zu WT und Ehd1 -/- Mäuse (Abbildung 2). Diese Ergebnisse zeigten, dass die Targeting-Strategie zu einem vollständigen Verlust der EHD1-Expression in führte Ehd1 -/- Mausgewebe.

    EHD-Proteinexpression im erwachsenen WT, Ehd1 +/- und Ehd1 -/- männliche Mäuse. Aliquots von 100 &mgr;g Gewebelysaten, die von sieben Monate alten männlichen Mäusen stammten, wurden unter Verwendung von 7,5% SDS-PAGE aufgetrennt, und Western-Blots wurden unter Verwendung von Antiseren durchgeführt, die gegen EHD-Proteine ​​erzeugt wurden, wie in Methoden beschrieben. Das * bezeichnet Banden, die nach dem Strippen aus dem vorherigen Blot durchbluteten. Die unterschiedliche Mobilität von Hsc70 kann gewebespezifische Isoformen darstellen. Marker des relativen Molekulargewichts (MW) sind in Kilodalton (kD) angegeben. Hsc70 diente als Ladekontrolle.

    Löschung von Ehd1in verschiedenen Mausstämmen führt zu partieller Letalität

    Kreuze von Ehd1 +/- Mäuse auf einem gemischten 129B6-Hintergrund erzeugten nicht das erwartete Mendelsche Verhältnis von Ehd1 -/- Mäuse (8% statt der erwarteten 25% waren Ehd1 -/- an den postnatalen Tagen 10-12) (Tabelle 1). Diese Ergebnisse zeigten, dass der Verlust von EHD1 teilweise tödlich war. Ähnliche Ergebnisse wurden nach sieben Rückkreuzungen (N7) mit dem FVB/NJ-Stamm beobachtet (11 % statt der erwarteten 25 % waren) Ehd1 –/- n = 106 Mäuse). Der Mischstamm 129B6 wurde in weiteren Analysen verwendet, sofern nicht anders angegeben.

    Die Nachkommen aus Kreuzungen von Ehd1 +/- Mäuse waren zu 49 % weiblich und zu 51 % männlich mit doppelt so vielen Ehd1 +/- im Vergleich zu WT-Mäusen, was auf ein normales Geschlechterverhältnis und eine fehlende Letalität hindeutet, wenn eine Kopie von Ehd1 war anwesend. Es wurde eine separate Studie durchgeführt, in der der Genotyp von Welpen untersucht wurde, die zwischen dem 0. und 2. Tag nach der Geburt an unbekannten Ursachen starben. Interessanterweise waren 24 von 48 Welpen (50 %) Ehd1 -/- Mäuse, was auf eine unverhältnismäßig höhere Häufigkeit hinweist (erwartet

    25%) der Todesfälle unter Ehd1 -/- Mäuse bei oder kurz vor der Geburt.

    Ehd1 -/- Mäuse sind kleiner als WT-Mäuse und weisen Entwicklungsdefekte auf

    Ehd1 -/- Mäuse, die die frühe neonatale Letalität überlebten, waren kleiner als WT und Ehd1 +/- Wurfgeschwister von der Geburt (Abbildung 3A) bis zum Erwachsenenalter (Abbildung 3B). Sowohl männliche als auch weibliche Mäuse zeigten im Vergleich zu Kontrollen ein geringeres Gewicht (Fig. 3C-D). In mehreren Fällen, Ehd1 -/- Frauen zeigten eine Malokklusion (4/18, 22%), die eine zweiwöchentliche Schneidezahnbeschneidung bis ins Erwachsenenalter erforderte, um den Tod zu verhindern. Einige Tiere wurden aufgrund ungewöhnlich kleiner Größe und Unterernährung im Alter von 3-4 Wochen unabhängig von Schneidezahnproblemen eingeschläfert und mehrere andere starben zu dieser Zeit aus unbekannten Gründen. Ein erheblicher Teil der überlebenden Ehd1 -/- Tiere zeigten grobe Augendefekte (

    55% der Augen n = 39 Tiere) einschließlich Anophthalmie (selten), Mikrophthalmie (schwere Fälle mit geschlossenen Augenlidern) und angeborener zentraler Katarakt. Die Natur von Augenentwicklungsfehlern in Ehd1 -/- Mäuse werden separat verfolgt.

    Ehd1 -/- Mäuse sind kleiner als Wurfgeschwister Kontrollen und Erwachsene Ehd1 -/- Männchen zeigen kleine Hoden. (A) Neugeborene Welpen und (B) sieben Monate alte männliche Mäuse wurden fotografiert, um die Größe der Ehd1 -/- Mäuse im Vergleich zu Kontrollen von Wurfgeschwistern. (C) Quantitative Wachstumskurven von männlichen und (D) weiblichen Wurfgeschwister-Kontrollmäusen (n-Wert jeweils gezeigt). (E) Samenbläschen und Hoden wurden von in (B) abgebildeten Mäusen seziert. Fehlerbalken stellen die Standardabweichung vom Mittelwert dar. ** zeigt statistisch signifikant unter Verwendung eines Zweistichproben-t-Tests mit einer zweiseitigen Analyse (p < 0,05) an.

    Ehd1 -/- Männchen sind unfruchtbar

    Trotz unserer wiederholten Paarungsversuche Ehd1 -/- Mäusen wurden keine Nachkommen erzeugt, was auf den Mangel an Fertilität entweder eines oder beider Geschlechter hinweist. Zucht Ehd1 +/- Männchen mit Ehd1 -/- Weibchen brachten gesunde Jungtiere zur Welt (Tabelle 1), nur 29% (statt 50% erwartet) der Mäuse, die das Absetzalter überlebten, waren Ehd1 -/- . Aus unbekannten Gründen ist der Prozentsatz der Ehd1 -/- Mäuse, die bis zum Entwöhnungsalter überlebten, waren im Vergleich zu den Mendelschen Vorhersagen höher, wenn sie von einem . aufgezogen wurden Ehd1 -/- dam versus an Ehd1 +/- Damm. Diese Ergebnisse dokumentierten weiter, dass Ehd1 -/- Weibchen waren fruchtbar und die teilweise Letalität in Ehd1-null Mäuse (derzeit in Untersuchung).

    Um zu testen, ob Ehd1 -/- Männchen waren fruchtbar, 8 Wochen alte Männchen wurden mit jeweils zwei jungfräulichen erwachsenen Weibchen untergebracht. Trotz normalem Paarungsverhalten, das durch ihre Fähigkeit bestimmt wird, Weibchen zu besteigen und einen kopulativen Stecker hervorzubringen, nein Ehd1 -/- männliche Mäuse waren in der Lage, Nachkommen zu zeugen, was darauf hindeutet, dass Ehd1 -/- Männer waren unfruchtbar (Tabelle 1). Die in diesen Experimenten verwendeten Weibchen erwiesen sich nach der ersten Zucht mit als kompetent für die Imprägnierung durch andere fruchtbare Männchen Ehd1 -/- Männchen. Die Fähigkeit von acht Ehd1 fl-Neo/fl-Neo Zuchtpaare, um erfolgreich Nachkommen zu produzieren, lieferten den Beweis, dass das Vorkommen von loxP Websites im Zielbereich Ehd1 Gen verursachte keine Störungen der Fertilität oder des Gesamtüberlebens durch Beeinflussung eines ungezielten Gens.

    Zuvor zeigte eine C-terminale Deletion von EHD1 bei Mäusen keine Auswirkungen auf Lebensfähigkeit, Wachstum oder Fertilität bei 129/SvEv- oder Swiss Webster-Stämmen [27]. Um festzustellen, ob Fruchtbarkeitsdefekte im Ehd1 -/- männliche Mäuse wurden durch genetischen Hintergrund beeinflusst, wir haben uns gekreuzt Ehd1 +/- Mäuse zweimal in den FVB/NJ-Stamm (N2) und dann generiert Ehd1 -/- Mäuse. Das resultierende Ehd1 -/- männliche Mäuse waren währenddessen unfruchtbar Ehd1 -/- weibliche Mäuse waren fruchtbar (n = 8). Weitere Rückkreuzungen haben ergeben, dass Ehd1 -/- männliche FVB/NJ-Stamm (N7)-Mäuse waren ebenfalls unfruchtbar (n = 4), was darauf hindeutet, dass der Verlust von EHD1 bei männlichen Mäusen unabhängig vom Stamm zu vollständiger Unfruchtbarkeit führt.

    Erwachsene Ehd1 -/- Männchen zeigen kleine Hoden

    Die Rohgewichte von Hoden, Milz und Nieren von Ehd1 –/– männliche Mäuse am Tag 10 und 30 nach der Geburt unterschieden sich statistisch nicht von WT-Mäusen (Tabelle 2). Ab Tag 42 sind die Hoden jedoch in Ehd1 –/–-Mäuse waren kleiner als die von WT-Mäusen, was die erste Verzögerung der Hodenentwicklung, bestimmt nach Gewicht, anzeigte (Tabelle 2, Fig. 3E). Interessanterweise waren die androgenabhängigen Samenbläschen in der Größe zwischen WT, Ehd1 +/- und Ehd1 –/– Mäuse (Tabelle 2, Fig. 3E), was darauf hindeutet, dass die Hormonspiegel unbeeinflusst waren. Die Serumtestosteronspiegel von Mäusen waren jedoch variabel, die Spiegel in Ehd1 -/- Mäuse waren in einem Bereich vergleichbar mit denen von WT und Ehd1 +/- erwachsene Mäuse (824,5 ± 1364,0 ng/dL für WT [n = 3], 646,1 ± 859,4 ng/dL für Ehd1 +/- [n = 2] und 445,8 ± 511,4 für Ehd1 -/- [n = 11], Alter 9-69 Wochen, p > 0,05). Der Phänotyp der kleinen Hodengröße war bei N2- und N7-FVB/NJ-Mäusen ähnlich (Daten nicht gezeigt).

    EHD1-Expression in der postnatalen Maushodenentwicklung

    Um die zu beurteilen Ehd1 mRNA-Expression, vor Ort Hybridisierungen wurden in sich entwickelnden Maushoden durchgeführt. Ehd1 mRNA wurde in den meisten Zellen des Samenepithels (Fig. 4) einschließlich Sertoli-Zellen (Fig. 4, Einschub E') exprimiert.

    Ehd1-mRNA-Expression bei der postnatalen Maushodenentwicklung. Vor Ort Hybridisierungen wurden wie in Methods on WT (+/+) beschrieben durchgeführt und Ehd1 –/– (–/–) Hodenschnitte, hergestellt von 10, 30, 36, 42 (P10–P42) und 10 Monate alten (10 m) Mäusen nach der Geburt. Ehd1 Die mRNA-Expression ist in Dunkelfeldbildern rot zu sehen, die Hellfeldbildern überlagert sind. Die Tafeln A'-I' sind jeweils höhere Vergrößerungen der Tafeln A-I. Der Einschub innerhalb von E' ist eine vergrößerte Mikroaufnahme des Kästchens in E'. Pfeile bezeichnen Sertoli-Zellkerne. Der Maßstabsbalken in Panel I beträgt 100 µm für B-J, 50 µm für A, C'-I' und 25 µm für A'.

    Um die EHD-Proteinexpression in frühen Stadien der Hodenentwicklung zu beurteilen, wurde ein Western-Blot durchgeführt (Fig. 5A, oberes Feld). EHD1, EHD2 und EHD4 wurden in den WT-Hoden an den Tagen 10–42 exprimiert, während die EHD3-Spiegel relativ niedrig waren. Interessant, Ehd1 -/- Hoden zeigten einen Anstieg der EHD2-, EHD3- und EHD4-Expression an den Tagen 30, 36 und 42. EHD1, EHD2 und EHD4 wurden auch in einer immortalisierten Maus-Sertoli-Zelllinie (TM4) exprimiert, wie durch Western-Blot analysiert (Abbildung 5A, unten). Tafel).

    EHD-Proteinexpression und EHD1-Lokalisierung während der Entwicklung des Maushodens. (A, oberes Feld) Aliquots von 50 μg Hodenlysaten von Mäusen nach der Geburt am Tag 10–42 wurden unter Verwendung von 8% SDS-PAGE aufgetrennt und ein Western-Blot wurde unter Verwendung von affinitätsgereinigten Antikörpern gegen EHD1 (beschrieben in Methoden) durchgeführt, gefolgt von serielles Reprobing mit Antiseren, die gegen EHD-Proteine ​​erzeugt wurden, wie zuvor beschrieben [7]. β-Actin diente als Beladungskontrolle. Das * bezeichnet Banden, die aus dem vorherigen Blot durchbluteten. (A, unteres Feld) Aliquots von 20 μg immortalisierter Maus-TM4-Sertoli-Zelle und embryonaler Fibroblasten der Maus (MEF, Ehd1 fl-Neo/fl-Neo ) Lysate wurden ähnlich behandelt, außer dass die Membran mit Antiseren sondiert wurde, die EHD1 und EHD4 erkennen, gefolgt von EHD2. (B, C) Immunhistochemie wurde durchgeführt, um die EHD1-Lokalisierung in Tag 10 und Tag 30 formalinfixierten Hodenschnitten von WT und . zu bestimmen Ehd1 -/- Mäuse. Die EHD1-Expression kann als braun gefärbte Kerne gesehen werden, die mit Hämatoxylin (blau) gegengefärbt werden. Die Tafeln A und B enthielten affinitätsgereinigte anti-EHD1-Primärantikörper, während Tafeln C und D primäre Antikörper fehlten (Kontrolle). Einschübe in Feld A sind vergrößerte mikroskopische Aufnahmen der hervorgehobenen Zellen. Hinweis: Ähnliche Samenkanälchen aus benachbarten Abschnitten sind in A und C sowie B und D mit Sternchen (**) gekennzeichnet. Sc – Sertoli-Zelle, Sg – Spermatogonie. Maßstabsbalken = 100 µm.

    Um die EHD1-Lokalisierung im Hoden zu bestimmen, wurde eine Immunhistochemie durchgeführt und die EHD1-Expression in den meisten Zellen des Samenepithels nachgewiesen. Am 10. postnatalen Tag wurde EHD1 im Zytoplasma von Spermatogonien (gefüllte Pfeilspitzen) und Sertoli-Zellen (offene Pfeilspitzen) an der Basalmembran mit höheren Signalen in der Nähe der seitlichen und apikalen Oberflächen dieser Zellen exprimiert (Abbildung 5B, Bild EIN). Die EHD1-Expression wurde auch um den Kern der Spermatogonie (Pfeil) in Richtung des Lumens der Samenkanälchen beobachtet (Fig. 5B, Tafel A). Wie erwartet fehlte die EHD1-Expression in Ehd1 -/- Hoden (Abbildung 5B-C, Tafel B). Am 30. Tag war EHD1 im Zytoplasma von Sertoli-Zellen und Spermatogonien nahe der Basis der Samenkanälchen lokalisiert. Darüber hinaus wurde EHD1 in pachytänen Spermatozyten und runden und verlängerten Spermatiden exprimiert (Fig. 5C, Tafel A). Ähnliche Muster wurden bei erwachsenen WT-Hoden beobachtet (nicht gezeigt).

    Ehd1 -/- Mäuse zeigen eine Reihe von Anomalien in der Spermatogenese

    Während der Spermatogenese durchlaufen Spermatogonien mitotische Teilungen und differenzieren sich in Spermatozyten. Spermatozyten durchlaufen zwei meiotische Teilungen, differenzieren sich zu runden Spermatiden, die später verlängerte Spermatiden bilden und während der Spermien aus Sertoli-Zellen freigesetzt werden. Die Progression der Spermatogenese wird anhand der Histologie der Samenkanälchenquerschnitte beschrieben Stufen (I-XII), die die morphologische Entwicklung von Keimzellen als Gruppe definieren [28, 29]. Die Morphologie einer einzelnen Spermatide in der Spermiogenese wird als Schritt dies wird am einfachsten von einer mit Periodic Acid-Schiff (PAS) gefärbten Akrosombildung und -form gefolgt oder weniger leicht durch die Beurteilung der Chromatinkondensation und der Spermatidenkopfform [28]. Um initiale Läsionen in der Spermatogenese zu erkennen, führten wir histologische Analysen der Hoden von 10, 30 und 42 Tage alten Mäusen durch. In jedem Alter war die durchschnittliche Breite der Samenkanälchen zwischen WT und vergleichbar Ehd1 –/– Mäusen, was darauf hinweist, dass die Lumenbildung durch das seminifere Epithel in Abwesenheit von EHD1 unbeeinflusst war (Tabelle 2).

    Am 10. postnatalen Tag enthielten die Samenkanälchen des WT überwiegend Sertoli-Zellen und einige pachytäne Spermatozyten, den am weitesten fortgeschrittenen Keimzelltyp, der in diesem Alter beobachtet wurde ( 6A ). Spermatogonien waren in der Nähe der Basalmembran vorhanden und es wurden nur wenige apoptotische Merkmale beobachtet (Abbildung 6B) [30]. Ehd1 -/- Samenkanälchen waren im Aussehen ähnlich und zeigten auch einige apoptotische Merkmale im Lumen und in der Nähe der Basalmembran (Abbildung 6C-D). Die normale Reifung von Spermatogonien und Pachytän-Spermatozyten schien verzögert zu sein Ehd1 –/– im Vergleich zu WT-Mäusen, wie durch Chromatinkondensation und Zellgröße analysiert. Außerdem einige Ehd1 -/- Samenkanälchen enthielten eine größere Anzahl von apoptotischen-ähnlichen Dense Bodies als WT. In den Samenkanälchen von . wurden jedoch keine größeren Läsionen festgestellt Ehd1 -/- Mäuse am Tag 10.

    Postnataler Tag 10 Tubulusquerschnitte von Ehd1 -/- männliche Maushoden zeigen keine größeren Läsionen. Tag 10 Hoden wurden Bouins-fixiert, PAS-gefärbt und Hämatoxylin-gegengefärbt, um die Glykoproteine/Akrosomen (rosa) und Kerne (blau) sichtbar zu machen und durch Lichtmikroskopie unter Verwendung einer 40× Objektivlinse analysiert. Die Stufen sind mit römischen Ziffern beschriftet. (A, B) Die Samenkanälchen von WT (+/+)-Mäusen weisen Sertoli-Zellkerne (Sc) nahe der Basalmembran oder zum Lumen hin, große Spermatogonien (Sg) nahe der Basalmembran, pachytäne Spermatozyten (P) und gelegentlich Apoptose auf -ähnliche (Ap) Kerne in der Nähe des Lumens. (C, D) Die Samenkanälchen von Ehd1 -/- (-/-) Mäuse sind zum Vergleich gezeigt. Maßstabsbalken in A = 50 μm für A-D.

    Am 30. Tag war bei WT-Mäusen eine normale Spermatogenese mit gut organisierten Keimzellen erkennbar, die typisch für die erste Spermatogenese-Welle waren. Im Allgemeinen befanden sich Sertoli-Zellen in der Nähe der Basalmembran, während verlängerte Spermatiden das Lumen auskleideten ( 7A , Stadium I-II) und in Spermatozyten eine normale Meiose beobachtet wurde ( 7A , Stadium XII). Runde Spermatiden zeigten ein rundes/eiförmiges Aussehen bis zum Stadium IX, als der Spermatidenkopf eine dorsale und ventrale Oberfläche bildete, wobei das Akrosom hauptsächlich auf der dorsalen Oberfläche der Spermatiden der Stufe 9 lag ( 7B ). Im Gegensatz, Ehd1 -/- Samenkanälchen zeigten abnorme Zellen in der Meiose (Abbildung 7C, Stadium XII) und verlängerte Spermatiden, die eine abnorme Orientierung, Form und Chromatinkondensation (Abbildung 7C, Stadium X) zeigten. Etwas Ehd1 –/– Samenkanälchen zeigten einen reinen Sertoli-Zell-Phänotyp, der im WT nicht zu sehen war ( 7D ), was auf ein vollständiges Fehlen von Keimzellen hinweist. Interessanterweise wurde eine Verzögerung der Reifung von verlängerten Spermatiden mit einer Mischung von Spermatiden (Schritt 9, 10 und 11) beobachtet, die in einem Samenkanälchenquerschnitt vorhanden war (Abbildung 7E). Bei WT-Mäusen bedeckte die PAS-positive akrosomale Kappe von runden Spermatiden mehr als ein Drittel des Kerns im Stadium VII mit einem zentralen akrosomalen Körnchen ( 7F ). Allerdings in Ehd1 –/– Mäusen, die akrosomalen Kappen erschienen abnormal mit asymmetrischen Formationen ( 7G ) und punktförmigen Erscheinungen ( 7H ). Weder die Ehd1 -/- noch die WT-Nebenhoden enthielten am Tag 30 Spermatozoen, was bestätigt, dass sich diese Tiere in den ersten Wellen der Spermatogenese befanden. Da sich runde Spermatiden vor dem 30. Tag (Tag 20-25) bilden, kann es zu Läsionen kommen, die in der aktuellen Studie nicht aufgeklärt wurden.

    Abnorme Entwicklung von Akrosomen und Spermatiden bei Jugendlichen Ehd1 -/- männliche Mäuse. Tag 30 Hoden wurden Bouins-fixiert, PAS-gefärbt und Hämatoxylin-Gegenfärbung, um die Glykoproteine/Akrosomen (rosa) und Kerne (blau) sichtbar zu machen und durch Lichtmikroskopie mit einem 40-fach-Objektiv (AE) oder 60-fach-Objektiv analysiert unter Ölimmersion (FH). Die Stufen sind mit römischen Ziffern beschriftet. (A) WT (+/+) Stadium XII Samenkanälchen mit Schritt 12 verlängerten Spermatiden und Spermatozyten in Meiose I und II. (B) Samenkanälchen im WT-Stadium IX mit Spermatiden der Stufe 9. (C) Ehd1 -/- (-/-) Samenkanälchen im Stadium XII zeigen abnorme Meiosefiguren (Me). Stadium X zeigt eine Mischung von Spermatidenstufen mit abnormaler Orientierung, Form und Chromatinkondensation (Pfeile). (D) An Ehd1 -/- Samenkanälchen mit einem Phänotyp nur für Sertoli-Zellen (SCO) und einem Samenkanälchen (E) im Stadium IX-XI, das verlängerte Spermatiden der Stufen 9, 10 und 11 enthält (Pfeile). (F) Runde Spermatiden des Stadiums VII WT mit PAS-positiven akrosomalen Kappen bei der Entwicklung von runden Spermatiden in Schritt 7 (Pfeile). (G-H) Ehd1 -/- Schritt 7 runde Spermatiden zeigen abnorme akrosomale Kappen (Pfeile), während andere abnorme Verschiebungen des akrosomalen Körnchens, asymmetrische Formationen und punktförmige Erscheinungen aufweisen. Maßstabsbalken in A = 50 μm für A-E. Maßstabsbalken in F = 10 μm für F-H.

    An Tag 42 enthielten die Nebenhoden in WT-Mäusen reife Spermatozoen, während Ehd1 -/- Mäusen fehlten Spermien (Abbildung 8) dieser Defekt setzte sich bis ins Erwachsenenalter fort. Um weitere Erkenntnisse über die abnorme Spermatogenese zu gewinnen, führten wir eine detaillierte Untersuchung von 42 Tage alten WT und Ehd1 -/- Maushoden.WT-Mäuse zeigten eine normale Spermatogenese, bei der ein einzelner Schritt von runden und verlängerten Spermatiden von Sertoli-Zellen in gleichmäßigem Abstand und geordneter Weise in den Querschnitten der Samenkanälchen unterstützt wurde ( 9A-C). Auf der anderen Seite erschien die Spermatogenese nur vor der Akrosombildung in normal Ehd1 -/- Mäuse. Mehrere Ehd1 -/- Querschnitte der Samenkanälchen zeigten eine Mischung aus verlängerten Spermatiden (Abbildung 9D, Schritte 9-11) sowie falsch ausgerichteten verlängerten Spermatiden in der Nähe der Basalmembran, was auf eine Sertoli-Zell-Phagozytose von Spermatiden der Stufe 16 hindeutet, die nicht freigesetzt wurden (Abbildung 9D .). -E, Kreise). Im späten Stadium VIII wurde ein Versagen der Spermienbildung und eine Verklumpung der Spermatidenköpfe zusätzlich zur Verschmelzung großer Aggregate von Restkörpern und zytoplasmatischen Lappen, die verklumpte Spermatiden enthielten, beobachtet (Fig. 9F-H, Pfeile). Im Stadium X wurde eine Verklumpung der Spermatiden der Stufe 16 in membranösen Rädern und in der Nähe der Basalmembran beobachtet (Abbildung 9I). Es wurde auch beobachtet, dass Spermatiden der Stufe 16 mit ihren Köpfen und Schwänzen verschmolzen waren, wobei ihr Zytoplasma keine Zytoplasmalappen und Restkörper bildete, die normalerweise von Sertoli-Zellen reabsorbiert werden ( 9J ). Ehd1 -/- Hoden zeigten auch abnorme Spermatiden der Stufe 11 (Abbildung 9J). Somit zeigen unsere Ergebnisse deutliche Spermatogenese- und Spermiationsdefekte in Ehd1-null Hoden.

    Ehd1 -/- männlichen Mäusen fehlen reife Nebenhoden-Spermien an Tag 42. Caput Epididymide vom Tag 42 wurden Bouin's-fixiert, PAS-gefärbt und Hämatoxylin-gegengefärbt, um die Glykoproteine ​​(rosa) und Kerne (blau) sichtbar zu machen und durch Lichtmikroskopie unter Verwendung einer 40× Objektivlinse analysiert. (A) WT (+/+) Nebenhoden enthielten eine säulenförmige Epithelschicht (E) mit einer glatten Aktinschicht (Pfeil) unter den langen PAS-positiven Mikrovilli, die sich in das Lumen erstrecken. Im Lumen waren reife Spermatozoen (S) vorhanden. (B) Die Ehd1 -/- (-/-) Nebenhoden enthielten einige abgestorbene runde Spermatiden (Spt) und Spermatozyten (Spc). Maßstabsbalken = 20 μm.

    Tag 42 Ehd1 -/- Hoden zeigen eine verzögerte Spermatidenentwicklung und abnormale Spermatidenverklumpung. Die Hoden an Tag 42 wurden Bouins-fixiert, PAS-gefärbt und Hämatoxylin-gegengefärbt, um die Glykoproteine/Akrosomen (rosa) und Kerne (blau) sichtbar zu machen und durch Lichtmikroskopie unter Verwendung einer 40-fach-Objektivlinse analysiert. Die Stufen sind mit römischen Ziffern beschriftet. (AC) WT (+/+) Samenkanälchen zeigten gleichmäßig verteilte runde und verlängerte Spermatiden. (D) Ehd1 -/- (-/-) Samenkanälchen enthielten verlängerte Spermatiden der Stufen 9, 10 und 11 (Pfeile) und fehlorientierte 16 verlängerte Spermatiden in der Nähe der Basalmembran (Kreise) und (E) abnorme Spermatiden der Stufe 9 zusammen mit Aggregaten der Stufe 16 Spermatiden (Kreise). (F-H) Ehd1 -/- Samenkanälchen mit häutigen Rädern oder Restkörpern (Pfeile, Rb) mit verklumpten Spermatiden in der Nähe des Lumens im Stadium VIII, (I) falsch ausgerichteten Spermatiden (Kreis) und verklumpten Spermatidenkernen der Stufe 16 (Pfeile) im Stadium X, (J) abnorme Spermatiden der Stufe 11 im Stadium XI und Spermatiden der Stufe 16, die im Stadium VIII in häutigen Rädern verklumpen. Maßstabsbalken = 50 μm.

    Um die Defekte in der Spermatogenese weiter zu charakterisieren Ehd1 -/- Mäusen auf ultrastruktureller Ebene wurden Transmissionselektronenmikroskopie-Analysen an Dünnschnitten des Hodens durchgeführt. Im Stadium VIII des WT-Testis (Abbildung 10A) wurden verlängerte Spermatiden in der Nähe des Lumens oder im Lumen nach der Spermiung gefunden (Abbildung 10B). Verlängerte Spermatiden, die nicht spermiiert waren, behielten eine apikale ektoplasmatische Spezialisierung in Kontakt mit WT-Sertoli-Zellen (Abbildung 10C). Im späten Stadium VIII von Ehd1 -/- Hoden (Fig. 10D), verlängerte Spermatiden erschienen in phagozytischen, membranösen Rädern (Fig. 10E, Kasten). Bei näherer Untersuchung war das Phagozytoserad von ektoplasmatischen Spezialisierungen umhüllt und enthielt die Kerne, Akrosomen und Schwänze von verlängerten Spermatiden (Abbildung 10F). Da die ordnungsgemäße Funktion der Sertoli-Zellen einen konstanten endozytischen Transport erfordert [31], vermuten wir, dass EHD1-abhängiges endozytisches Recycling und Transport für die Spermienbildung bei Mäusen erforderlich sein könnte.

    Elektronenmikroskopische Aufnahmen der Samenkanälchen an Tag 45 zeigen abnorme Phagozytose-Membranräder in Ehd1 -/- Mäuse. (A) Bei WT-Mäusen wurden runde Spermatiden der Stufe 8 in (B) Samenkanälchen des frühen Stadiums VIII gefunden, die verlängerte Spermatiden im Spermiationsprozess in der Nähe des Lumens enthielten, wobei nach der Spermiationsbox in (C) vergrößerte Schwänze sichtbar waren. (C) Eine verlängerte WT-Spermatide vor der Spermiung behält ihre ektoplasmatischen Spezialisierungen (ES). (D) In Ehd1 -/- Mäuse, Stufe 8 runde Spermatiden wurden in (E) Samenkanälchen des späten Stadiums VIII gefunden, die phagozytische membranöse Räder enthielten, die verlängerte Spermatiden umschlossen, ihre Akrosomen und Spermaschwänze in (F) vergrößert.


    • Abstrakt
    • 1.1 Prokaryonten-Zellmembranen
    • 1.2 Eukaryonten-Zellmembranen
    • 1.3 Plasmamembranen
    • 1.4 Intrazelluläre Membranen
    • 1.5 Virusmembranen
    • 1.6 Membranmotive
    • 1.7 Der hydrophobe Effekt
    • 1.8 Struktur des Wassers
    • 1.9 Unpolare Moleküle und Wasser
    • 1.10 Höhepunkte
    • Verweise

    Kapitel 2. Die Lipide biologischer Membranen

    • Abstrakt
    • 2.1 Phospholipide
    • 2.2 Sphingolipide
    • 2.3 Glykolipide
    • 2.4 Sterole
    • 2.5 Zweiköpfige Lipide
    • 2.6 Lipopolysaccharid
    • 2.7 Lipididentifikation
    • 2.8 Höhepunkte
    • Verweise

    Kapitel 3. Biogenese von Membranlipiden

    • Abstrakt
    • 3.1 Entsättigung von Fettsäuren
    • 3.2 Biosynthese von Phospholipiden
    • 3.3 Biosynthese von Sphingolipiden
    • 3.4 Cholesterin-Biosynthese
    • 3.5 Zusammenbau neu synthetisierter Lipide zu Membranen
    • 3.6 Höhepunkte
    • Verweise
    • Abstrakt
    • 4.1 Nichtionische Reinigungsmittel
    • 4.2 Ionische Reinigungsmittel
    • 4.3 Waschmitteleigenschaften
    • 4.4 Waschmittel und Membranflöße
    • Verweise

    Kapitel 5. Membranmodelle

    • Abstrakt
    • 5.1 Der Beweis für die Lipiddoppelschicht
    • 5.2 Das Singer-Nicholson-Modell für Membranen
    • 5.3 Aktuelles Modell für biologische Membranen
    • 5.4 Höhepunkte
    • Verweise

    Kapitel 6. Labormembransysteme

    • Abstrakt
    • 6.1 Aufbau von Labormembransystemen
    • 6.2 Von Labormembransystemen abgeleitete Eigenschaften
    • 6.3 Flüssigkeitszufuhr
    • 6.4 Ionenbindung
    • 6.5 Höhepunkte
    • Verweise

    Kapitel 7. Strukturen von Lipidaggregaten

    • Abstrakt
    • 7.1 Lamellenstruktur (Doppelschicht)
    • 7.2 Ineinandergreifende Doppelschichten
    • 7.3 Mizellenphase
    • 7.4 Hexagonale I-Phase (HI)
    • 7.5 Hexagonale II-Phase (HII)
    • 7.6 Kubische Phase
    • 7.7 Subphase für Phospholipid-Doppelschichten
    • 7.8 Lösungsphase
    • 7.9 Lipidphasenübergänge
    • 7.10 Phasenübergänge in Zellmembranen
    • 7.11 Phasenübergang lamellar zu HII
    • 7.12 Lipid-Mikrodomänen in Membranen
    • 7.13 Lipidkonformation in Membranen
    • 7.14 Wasser in der Lipiddoppelschicht
    • 7.15 Höhepunkte
    • Verweise

    Kapitel 8. Lipiddynamik in Membranen

    • Abstrakt
    • 8.1 Einführung
    • 8.2 ESR
    • 8.3 2H-NMR
    • 8.4 Antragsstellung
    • 8.5 Bewegungspreise
    • 8.6 Integrierte Sicht auf Bewegungsordnung und Dynamik
    • 8.7 Membranfluidität
    • 8.8 Freies Volumen innerhalb einer Membrandoppelschicht
    • 8.9 Laterale Diffusion von Membrankomponenten
    • 8.10 Laterale Phasentrennung
    • 8.11 Transmembrane Bewegung von Lipiden
    • 8.12 Bewegung von Phospholipiden zwischen Membranen
    • 8.13 Transmembranlipid-Asymmetrie
    • 8.14 Höhepunkte
    • Verweise

    Kapitel 9. Cholesterin und verwandte Sterole: Rollen in der Membranstruktur und -funktion


    4. DISKUSSION

    Wir zeigten, dass miRNAs die AQP5-Expression in der hochaggressiven und invasiven dreifach-negativen Brustkrebszelllinie (MDA-MB-231-Zellen) regulierten. Auf AQP5 gerichtete miRNAs wurden mithilfe bioinformatischer Analysen basierend auf den Sequenzen der AQP5 3ʹ-UTR und miRNAs identifiziert (Tabelle 1). Wenn MDA-MB-231-Zellen mit der identifizierten auf AQP5 gerichteten miRNA (miR-1226-3p, miR-19a-3p oder miR-19b-3p) überexprimiert wurden, war die AQP5-Proteinexpression signifikant verringert, verbunden mit der Hemmung von Zellen Migration als Reaktion auf die chemotaktischen und LDL-stimulierten Bedingungen. Um AQP5-gerichtete miRNAs effizient an Krebszellen zu liefern, wurde die Exosomen-vermittelte Lieferung von miRNAs etabliert. Tumor-Targeting-Peptid (IL-4RPep-1) und AQP5-Targeting miRNA (miR-19b-3p) wurden in Exosomen koexprimiert, die von HEK293T-Zellen in das konditionierte Medium sekretiert wurden. Dann lieferte das konditionierte Medium erfolgreich miR-19b-3p an MDA-MB-231-Zellen und verringerte die AQP5-Proteinexpression und die Krebszellmigration signifikant.

    Die vorübergehende Transfektion von miRNAs in MDA-MB-231-Zellen erhöhte die relative Menge an miRNA bemerkenswert (Abbildung 2A). Nach der Verabreichung des entsprechenden miRNA-Mimetikums in MDA-MB-231-Zellen wurde das relative Expressionsniveau von miR-1226-3p zu dem der Negativkontroll-siRNA-Behandlung sehr hoch (928-fach), was im Gegensatz zu den Veränderungen stand in den Expressionsspiegeln von miR-19a-3p (53-fach) und miR-19b-3p (201-fach). Unterschiede in den zellulären Spiegeln zwischen miRNA-Mimetika nach der Transfektion der gleichen Menge jedes miRNA-Mimetikums könnten auf den Unterschied im endogenen Expressionslevel jeder miRNA zurückzuführen sein, da relative Faltungsänderungen durch Vergleich mit dem endogenen miRNA-Level geschätzt wurden. Tatsächlich zeigte ein früheres Hochdurchsatz-miRNA-Profiling basierend auf der RNA-Seq-Analyse (GSE108286), dass das endogene Expressionsniveau von miR-1226-3p (read count: 35) viel niedriger war als das von miR-19a-3p (read count: 2832) und miR-19b-3p (read count: 5055) in MDA-MB-231-Zellen. Trotz des enormen Anstiegs der miRNA-Spiegel nach der Transfektion des jeweiligen miRNA-Mimetikums ist jedoch zu beachten, dass nur eine begrenzte Menge an miRNA-Mimetik eine Rolle bei der Regulation von Zielgenen spielen könnte. Konsequenterweise zeigten neuere Studien, dass die Zunahme der miRNA-Expression nach vorübergehender Transfektion von miRNA-Mimetika nicht das Niveau von authentisch aktiver miRNA repräsentiert, da die Population von miRNA, die mit dem RISC-Komplex interagieren könnte, begrenzt war. 52 Abbildung 2B zeigte, dass die AQP5-mRNA-Expression durch miR-1226-3p-mimische Transfektion deutlich verringert wurde. Die Ergebnisse zeigten, dass miR-1226-3p wahrscheinlich am Abbau von AQP5-mRNA beteiligt ist, der zu einer Abnahme der Proteinexpression von AQP5 führte. Eine andere Möglichkeit ist, dass miR-1226-3p möglicherweise auf die 3'-UTR von AQP5-regulierenden Genen abzielt, die die Transkription von AQP5 hemmen. Allerdings müssen die mutmaßlichen Ziele von miR-1226-3p, die die AQP5-Transkription regulieren könnten, erforscht werden.

    miR-1226-3p befindet sich in 3p21.31 (Chromosom 3:47.849.555-47.849.629) und die Sequenz von miR-1226-3p ist UCACCAGCCCUGUGUUCCCUAG. miR-19a-3p und miR-19b-3p befinden sich im 13q31.3 (Chromosom 13:91,350,891-91,350.972 bzw. 91,351,192-91,351,278) und haben die Sequenzen UGUGCAAAUCUAUGCAAAACUGA bzw (elftes Nukleotid: U oder C). miR-19a-3p und miR-19b-3p behalten die gleichen Seed-Sequenzen bei und teilen gemeinsame Zielgene (neun gemeinsame Zielgene im Gap-Junction-Weg, microT > 0,8 und P < 0,05, Tabelle 2). In der vorliegenden Studie reagierten drei Zielsequenzen von miR-1226-3p, die von DIANA-Tools vorhergesagt wurden, nicht auf die miR-1226-3p-Mimik in MDA-MB-231-Zellen, während die AQP5-Proteinexpression signifikant verringert war. Somit könnte spekuliert werden, dass es andere Zielsequenzen in der 3'-UTR von AQP5-mRNA geben könnte, die auf miR-1226-3p ansprechen. miR-19a-3p und miR-19b-3p haben gemeinsame Seed-Sequenzen. miR-19b-3p reduzierte jedoch signifikant die Luciferase-Aktivität in MDA-MB-231-Zellen, die die Zielsequenz 2 exprimieren (Abbildung 2C, D), während dies bei miR-19a-3p nicht der Fall war. Dieses Ergebnis deutet darauf hin, dass miR-19b-3p direkt mit der 3'-UTR der AQP5-mRNA interagieren und die AQP5-Expression regulieren könnte, indem es den Translationsprozess der AQP5-mRNA stört. Nach der Analyse von DIANA-Werkzeuge, ein Nukleotid im miR-19b-3p (Cytosin, C im elften Nukleotid) ist komplementärer als ein Nukleotid im miR-19a-3p (Uracil, U im elften Nukleotid), dadurch ist miR-19b-3p möglicherweise reaktiver gegenüber der Zielsequenz 2. Obwohl die miR-19a-3p-mimische Transfektion keine Abnahme der Luciferase-Aktivität zeigte, könnte die beobachtete signifikante Abnahme der AQP5-Proteinexpression darauf hindeuten, dass miR-19a-3p auch mit anderen unerforschten Zielen interagieren könnte Sequenzen in der 3'-UTR von AQP5-mRNA. Darüber hinaus ist es möglich, dass miR-19a-3p andere Gene angreift, die die Translation von AQP5 regulieren können.

    Frühere Beweise zeigten, dass miR-1226, miR-19a und miR-19b an der Regulierung von krebsbezogenen Proteinen beteiligt sind. Es wurde berichtet, dass miR-1226 eine Rolle als Tumorsuppressor über die Herunterregulierung der Mucin-1-Expression in Brustkrebszellen (MCF-7 und MCF-10A) durch Interaktion mit der 3ʹ-UTR von Mucin 1 spielt. 53 miR-19a- 3p wurde gemeldet, um auf die . abzuzielen FOSL1 Gen, das für das Transkriptionsfaktor Fos-related Antigen 1 (FRA-1) in tumorassoziierten Makrophagen kodiert, das die Migration und Invasion von Brustkrebszellen verstärkt. 54 Außerdem interagierte miR-19a-3p direkt mit der 3ʹ-UTR des Gewebefaktors (dem primären Initiator der Gerinnung) und reduzierte die Migration und Invasion von Dickdarmkrebszellen (LoVo und DLD1). 54 In den Geweben von Magenkrebspatienten war die Expression von miR-19b im Vergleich zu tumorbenachbarten Geweben signifikant verringert. 55 Die Gesamtüberlebensrate und die krankheitsfreie Überlebensrate waren bei Magenkrebspatienten mit geringerer Expression von miR-19b signifikant niedriger. 55 Darüber hinaus führte stabil überexprimiertes miR-19b-1 in MDA-MB-231-Zellen im Mausmodell über die Regulation der angiogenen Aktivität zum Stillstand des Tumorwachstums. 56

    In Übereinstimmung mit den oben genannten Studien zeigten wir, dass die Transfektion von Mimetika von miR-1226-3p, miR-19a-3p und miR-19b-3p die Migration von MDA-MB-231-Zellen als Reaktion auf die chemotaktischen Bedingungen ( Abbildung 3A,B). Es wurde gezeigt, dass die LDL-Stimulation die Zellproliferation und die Migration von MDA-MB-231-Zellen induziert, 39 und wir haben auch zuvor gezeigt, dass LDL die Migration von MDA-MB-231-Zellen stimuliert. 44 Während in dieser Studie die LDL-Behandlung (50 μg/ml, 24 Stunden) die MDA-MB-231-Zellmigration beschleunigte, wurde sie durch miR-1226-3p-, miR-19a-3p- und miR-19b-3p-Mimics signifikant behindert Transfektion (40 nM, 48 Stunden, Fig. 3C, D). Der Transwell-Zellmigrationsassay zeigte, dass die Zellmigration von MDA-MB-231-Zellen, die vorübergehend mit miR-19b-3p allein transfiziert wurden, stärker behindert war (Abbildung 3B), als bei dem Ansatz mit IL-4RPep-1 und miR-19b-3p (Abbildung .). 6D). Dieses Ergebnis könnte durch die unterschiedlichen Expressionsniveaus von miR-19b-3p (Abbildung 2A vs Abbildung 6A) erklärt werden, und dementsprechend waren die AQP5-Expressionsniveaus unterschiedlich (Abbildung 1D vs Abbildung 6B). Darüber hinaus verwendeten wir in Bezug auf die miRNA-Dosis eine höhere Dosis von miRNA (80 nM) anstelle einer niedrigeren Dosis (40 nM) in den Experimenten, um zu untersuchen, ob Kulturmedium, das Exosomen enthält, die IL-4RPep-1 und miR- exprimieren, 19b-3p könnte die Zellmigration aus den folgenden Gründen beeinflussen. Wenn miR-19b-3p (40 nM) direkt in MDA-MB-231-Zellen transfiziert wurde, wurde das Expressionsniveau von miR-19b-3p um . erhöht

    200-fach in den Zellen (Abbildung 2A). Im Gegensatz dazu führte die Beladung von miRNA (40 nM) in IL-4RPep-1-exprimierende Exosomen in HEK293T-Zellen, wie in Abbildung 5D gezeigt, zu einem signifikanten Anstieg von miR-19b-3p in den Exosomen, jedoch nur um 8,8 -fache Erhöhung im Vergleich zu Kontroll-HEK293T-Zellen oder 12,3-fache Erhöhung im Vergleich zu IL-4RPep-1-Vektor-transfizierten HEK293T-Zellen. Darüber hinaus zeigten, wie in Fig. 6A gezeigt, MDA-MB-231-Zellen, die mit konditioniertem Medium behandelt wurden, das aus HEK293T-Zellen gesammelt wurde, die sowohl mit dem pDisplay-IL-4RPep-1-Vektor als auch mit miR-19b-3p-Mimic (40 nM) kotransfiziert waren, ein erhöhtes Niveau von miR-19b-3p, aber es war ein 4,1-facher Anstieg. Daher erhöhten wir für den Zellmigrationsassay in Abbildung 6D die Dosis von miR-19b-3p auf 80 nM für die Transfektion in HEK293T-Zellen anstatt auf 40 nM, um mehr miR-19b-3p über Exosomen enthaltende Zellen an migrierende Zellen abzugeben Kulturmedium.

    Wir haben zuvor gezeigt, dass der shRNA-vermittelte AQP5-Knockdown die Zellmigration von MCF-7-Zellen in vitro abschwächte und eine höhere AQP5-Expression in Brustkrebsgeweben von Patienten mit Lymphknotenmetastasen in vivo assoziiert war. 13 Neben der direkten Wirkung von AQP5 auf die Migration von Brustkrebszellen zeigten wir auch, dass aktiviertes Rac1 im Gewebe von Brustkrebspatientinnen erhöht war. 16 Rac1, eine GTPase, die eine wichtige Rolle bei der Migration von Krebszellen spielt, ist wahrscheinlich ein nachgeschaltetes Ziel von AQP5 bei Brustkrebs. 16 DIANA-mirPath sagten voraus, dass miR-1226-3p, miR-19a-3p und miR-19b-3p Zielgene im Gap-Junction-Weg haben (Tabelle 2) und qRT-PCR und semiquantitativer Immunblotting wurden durchgeführt, um die Wirkung von miRNAs auf diese Ziele zu untersuchen Gene. Wie in Tabelle 3 gezeigt, ist die mRNA-Expression von NRAS und ITPR1 Gen war nach miR-1226-3p- bzw. miR-19b-3p-Transfektion in MDA-MB-231-Zellen signifikant verringert. Interessanterweise ist die Proteinhäufigkeit von Connexin-43, dem Produkt der GJA1 Gen, war nach miR-19a-3p- oder miR-19b-3p-Transfektion signifikant verringert. Die Beteiligung dieser identifizierten miRNAs am Gap-Junction-Weg wurde nicht untersucht und die Interaktionen dieser identifizierten miRNAs und der Zielgene am Gap-Junction-Weg müssen bei der Migration und Metastasierung von Brustkrebszellen untersucht werden.

    Wir zeigten, dass die AQP5-Proteinhäufigkeit in MDA-MB-231-Zellen als Reaktion auf die Transfektion von miR-19a-3p oder miR-19b-3p stärker verringert war als die von miR-1226-3p (Abbildung 1B vs. Abbildung 1D). miR-19a-3p und miR-19b-3p veränderten die Häufigkeit von AQP5-Transkripten nicht (Abbildung 2B), was darauf hindeutet, dass miR-19a-3p und miR-19b-3p wahrscheinlich die Häufigkeit von AQP5-Protein auf translationaler Ebene regulieren . Darüber hinaus zeigte der Luciferase-Reportergen-Assay, dass miR-19b-3p direkt mit der 3'-UTR von AQP5-mRNA interagiert und zur Hemmung der Translation führt (Abbildung 2D). Angesichts der deutlichen Wirkung von miR-19b-3p auf die Regulation der AQP5-Häufigkeit wurde miR-19b-3p ausgewählt und auf die Studien der exosomalen Abgabe an die Brustkrebszelllinie angewendet. In MDA-MB-231-Zellen führte die Behandlung mit einem konditionierten Medium, das IL-4RPep-1/miR-19b-3p nachahmende Exosomen enthielt, zu einem signifikanten Anstieg des zellulären miR-19b-3p (

    4,1-fach, Abbildung 6A) und eine Abnahme der AQP5-Proteinexpression um

    30% im Vergleich zur Kontrollgruppe (Abbildung 6C). Es ist allgemein bekannt, dass der Interleukin-4-Rezeptor (IL-4R) in mehreren Krebszellen exprimiert wird, einschließlich Nierenzellkarzinom, Brustkrebs, Bauchspeicheldrüsenkrebs und malignem Pleuramesotheliom (MPM). 57-60 Die Expression von IL-4R wird bei malignem Pankreaskarzinom und MPM überexprimiert, und die erhöhte Expression von IL-4Rα, einer Hauptuntereinheit von IL-4R, war mit einem schlechten Überleben der Patienten verbunden, was darauf hindeutet, dass eine Überexpression von IL- 4R steht im Zusammenhang mit der Malignität von Krebszellen. 57, 60 Daher wurden IL-4R-vermittelte therapeutische Versuche in großem Umfang versucht. 36, 40 Zum Beispiel zeigte eine frühere Studie, dass auf IL-4R gerichtete siRNA-Komplexe spezifisch mit IL-4R interagierten und effizient internalisiert wurden. 36

    In der vorliegenden Studie haben wir gezeigt, dass das IL-4R-bindende Peptid (IL-4RPep-1)-exprimierende Exosomen miRNA effizienter lieferten als Exosomen, die nur miRNA exprimierten (Abbildung 6E).Wir haben Exosomen und isolierte Exosomen konstruiert, um die Expression der miR-19b-3p-Expression im Exosom zu untersuchen (Abbildung 5). Für die Lieferung von miRNA an MDA-MB-231-Zellen verwendeten wir jedoch nicht die isolierten Exosomen, sondern das exosomhaltige konditionierte Medium, das aus IL-4RPep-1/miR-19b-3p-mimik-co-transfizierten HEK293T-Zellen gewonnen wurde. Dies lag hauptsächlich an der technischen Einschränkung bei der massiven Produktion und Reinigung von IL-4RPep-1 exprimierenden Exosomen, die miRNAs enthalten, dh biotechnologisch hergestellte Exosomen. Es wurde anerkannt, dass die Verfügbarkeit ausreichender Mengen an Exosomen für Tierstudien oder klinische Studien eine der Einschränkungen von Exosomen als Therapeutika darstellt. 61 Weitere Einschränkungen sind das Fehlen von Methoden zur Isolierung homogener Exosomenpopulationen und die Kostenineffizienz. 61, 62 Zukünftige Studien sind erforderlich, um genom-manipulierte Zelllinien herzustellen, die sowohl IL-4RPep-1 als auch miRNAs stabil produzieren. Wie in Abbildung 6A gezeigt, zeigte die qRT-PCR jedoch, dass miR-19b-3p erfolgreich an MDA-MB-231-Zellen abgegeben wurde, wenn die Zellen mit konditioniertem Medium behandelt wurden, das aus IL-4RPep-1/miR-19b-3p-Mimic- co-transfizierte HEK293T-Zellen. Darüber hinaus wurde, wie in 6B gezeigt, die AQP5-Proteinexpression signifikant verringert, wenn MDA-MB-231-Zellen mit konditioniertem Medium behandelt wurden, das aus IL-4RPep-1/miR-19b-3p-mimik-co-transfizierten HEK293T-Zellen für 48 Stunden gesammelt wurde. Daher zeigten diese Daten, dass konditioniertes Medium, das aus IL-4RPep-1/miR-19b-3p-mimik-cotransfizierten HEK293T-Zellen gewonnen wurde, Exosomen enthielt, die miR-19b-3p exprimierten, die miR-19b-3p lieferten und die AQP5-Proteinexpression in . verringerten MDA-MB-231-Zellen.

    Die isolierten Exosomen aus nicht-transfizierten HEK293T-Zellen und HEK293T-Zellen, die mit dem IL-4RPep-1-exprimierenden pDisplay-Vektor transfiziert waren, zeigten die Expression von TSG101 und CD63 und waren meist <200 nM groß (Fig. 5C). Wichtig ist, dass die Größenverteilung der extrazellulären Vesikel in dem konditionierten Medium, das aus HEK293T-Zellen gesammelt wurde [nicht transfiziert, IL-4RPep-1 transfiziert oder IL-4RPep-1/miR-19b-3p mimisch-cotransfiziert], hauptsächlich <200 nm betrug. die sich nicht von den isolierten Exosomen unterschied (Fig. 5E). Im Gegensatz zu den isolierten Exosomen zeigten sie jedoch auch kleinere Fraktionen mit einer Größe von >200 nm, was darauf hindeutet, dass andere extrazelluläre Vesikel oder Faktoren im Kulturmedium möglicherweise die Veränderungen der AQP5-Expression beeinflussen und dies in untersucht werden muss zukünftige Studien.

    Interessanterweise konnte das IL-4RPep-1 exprimierende Exosom miRNAs durch rezeptorvermittelte Endozytose effizienter an die Empfängerzellen abgeben, wenn Krebszellen für einen kürzeren Zeitraum mit einem Exosom-haltigen Medium behandelt wurden. Im Gegensatz dazu war die Exosomenabgabe von miRNA bei längerer Behandlungsdauer wahrscheinlich nicht von der Expression des Tumor-Targeting-Peptids auf der Oberfläche der Exosomen abhängig. Daher spekulierten wir, dass die Wirkung der rezeptorvermittelten Endozytose durch andere Mechanismen außer Kraft gesetzt werden könnte, einschließlich Fusion, Mikropinozytose oder Phagozytose, die für die Aufnahme von Exosomen bekannt sind. 63 Im gegenwärtigen Stadium ist die Anwendung von IL-4RPep-1-exprimierenden Exosomen, die mit miRNAs beladen sind, auf Tierkrankheitsmodelle aufgrund der Schwierigkeiten bei der massiven Produktion und Reinigung von IL-4RPep-1-exprimierenden Exosomen, die miRNAs enthalten, begrenzt, was weiter erforscht werden.

    Zusammenfassend haben wir neue auf AQP5 gerichtete miRNAs identifiziert und ihre Rolle bei der Regulation der AQP5-Expression und Migration von Brustkrebszellen untersucht. Die Wirkung von auf AQP5 gerichteten miRNAs wurde in menschlichen Brustkrebszellen gezeigt, indem die biotechnologisch hergestellten Exosomen, die auf AQP5 gerichtete miRNAs koexprimieren, und ein Peptid (CRKRLDRNC: IL-4RPep-1), das auf den IL-4R abzielt, der in der Brust reichlich exprimiert wird, abgegeben werden Krebszellen.


    Schau das Video: Receptor-Mediated (Juni 2022).