Information

27.1: Der genetische Code - Biologie

27.1: Der genetische Code - Biologie


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

27.1: Der genetische Code

Der genetische Code

Zusammenfassend lässt sich sagen, dass der zelluläre Prozess der Transkription Boten-RNA (mRNA) erzeugt, eine mobile molekulare Kopie eines oder mehrerer Gene mit einem Alphabet von A, C, G und Uracil (U). Die Translation der mRNA-Matrize wandelt die genetische Information auf Nukleotidbasis in ein Proteinprodukt um. Dieser Fluss der genetischen Information in Zellen von der DNA über die mRNA bis zum Protein wird durch das zentrale Dogma (Abbildung 1) beschrieben, das besagt, dass Gene die Sequenz von mRNAs bestimmen, die wiederum die Sequenz von Proteinen bestimmen. Die Entschlüsselung eines Moleküls zum anderen erfolgt durch spezifische Proteine ​​und RNAs. Da die in der DNA gespeicherten Informationen so zentral für die Zellfunktion sind, ist es intuitiv sinnvoll, dass die Zelle mRNA-Kopien dieser Informationen für die Proteinsynthese anfertigt, während die DNA selbst intakt und geschützt bleibt.

Es stellt sich heraus, dass das zentrale Dogma nicht immer wahr ist. Auf die Ausnahmen werden wir hier jedoch nicht eingehen.

Abbildung 1 Anweisungen zur DNA werden auf Messenger-RNA transkribiert. Ribosomen sind in der Lage, die in einem Strang der Boten-RNA eingeschriebene genetische Information zu lesen und diese Information zu verwenden, um Aminosäuren zu einem Protein zusammenzufügen.


Das zentrale Dogma: DNA kodiert RNA RNA kodiert Protein

Abbildung 2. Anweisungen zur DNA werden auf Messenger-RNA transkribiert. Ribosomen sind in der Lage, die in einem Strang der Boten-RNA eingeschriebene genetische Information zu lesen und diese Information zu verwenden, um Aminosäuren zu einem Protein zusammenzufügen.

Der Fluss der genetischen Information in Zellen von der DNA über die mRNA bis zum Protein wird durch das zentrale Dogma (Abbildung 2) beschrieben, das besagt, dass Gene die Sequenz von mRNAs bestimmen, die wiederum die Sequenz von Proteinen bestimmen. Die Entschlüsselung eines Moleküls zum anderen erfolgt durch spezifische Proteine ​​und RNAs. Da die in der DNA gespeicherten Informationen so zentral für die Zellfunktion sind, ist es intuitiv sinnvoll, dass die Zelle mRNA-Kopien dieser Informationen für die Proteinsynthese anfertigt, während die DNA selbst intakt und geschützt bleibt. Das Kopieren von DNA in RNA ist relativ einfach, wobei für jedes im DNA-Strang gelesene Nukleotid ein Nukleotid an den mRNA-Strang angefügt wird. Die Translation zum Protein ist etwas komplexer, da drei mRNA-Nukleotide einer Aminosäure in der Polypeptidsequenz entsprechen. Die Translation zum Protein ist jedoch immer noch systematisch und kolinear, so dass die Nukleotide 1 bis 3 der Aminosäure 1 entsprechen, die Nukleotide 4 bis 6 der Aminosäure 2 entsprechen, und so weiter.


Biologie 171


Seit der Wiederentdeckung von Mendels Arbeit im Jahr 1900 hat sich die Definition des Gens von einer abstrakten Vererbungseinheit zu einer greifbaren molekularen Einheit entwickelt, die zur Replikation, Expression und Mutation fähig ist ((Abbildung)). Gene bestehen aus DNA und sind linear auf Chromosomen angeordnet. Gene spezifizieren die Sequenzen von Aminosäuren, die die Bausteine ​​von Proteinen sind. Proteine ​​wiederum sind für die Orchestrierung fast jeder Funktion der Zelle verantwortlich. Sowohl Gene als auch die von ihnen kodierten Proteine ​​sind für das Leben, wie wir es kennen, absolut lebensnotwendig.

Lernziele

Am Ende dieses Abschnitts können Sie Folgendes tun:

  • Erklären Sie das „zentrale Dogma“ der DNA-Protein-Synthese
  • Beschreiben Sie den genetischen Code und wie die Nukleotidsequenz die Aminosäure- und Proteinsequenz vorschreibt

Der zelluläre Transkriptionsprozess erzeugt Boten-RNA (mRNA), eine mobile molekulare Kopie eines oder mehrerer Gene mit einem Alphabet von A, C, G und Uracil (U). Die Translation der mRNA-Matrize auf Ribosomen wandelt die genetische Information auf Nukleotidbasis in ein Proteinprodukt um. Das ist das zentrale Dogma der DNA-Protein-Synthese. Proteinsequenzen bestehen aus 20 häufig vorkommenden Aminosäuren, daher kann man sagen, dass das Proteinalphabet aus 20 „Buchstaben“ besteht ((Abbildung)). Unterschiedliche Aminosäuren haben unterschiedliche Chemien (wie sauer gegenüber basisch oder polar und unpolar) und unterschiedliche strukturelle Einschränkungen. Die Variation der Aminosäuresequenz ist für die enorme Variation in Proteinstruktur und -funktion verantwortlich.

Strukturen der 20 in Proteinen gefundenen Aminosäuren sind gezeigt. Jede Aminosäure besteht aus einer Aminogruppe (), eine Carboxylgruppe (COO – ) und eine Seitenkette (blau). Die Seitenkette kann unpolar, polar oder geladen sowie groß oder klein sein. Es ist die Vielfalt der Aminosäureseitenketten, die zu der unglaublichen Variation von Proteinstruktur und -funktion führt.

Das zentrale Dogma: DNA kodiert RNA RNA kodiert Protein

Der Fluss der genetischen Information in Zellen von der DNA über die mRNA zum Protein wird durch das zentrale Dogma ((Abbildung)) beschrieben, das besagt, dass Gene die Sequenz von mRNAs bestimmen, die wiederum die Sequenz der Aminosäuren bestimmen, aus denen alle Proteine ​​bestehen. Die Entschlüsselung eines Moleküls zum anderen erfolgt durch spezifische Proteine ​​und RNAs. Da die in der DNA gespeicherten Informationen so zentral für die Zellfunktion sind, ist es intuitiv sinnvoll, dass die Zelle mRNA-Kopien dieser Informationen für die Proteinsynthese anfertigt, während die DNA selbst intakt und geschützt bleibt. Das Kopieren von DNA in RNA ist relativ einfach, wobei für jedes im DNA-Strang gelesene Nukleotid ein Nukleotid an den mRNA-Strang angefügt wird. Die Translation zum Protein ist etwas komplexer, da drei mRNA-Nukleotide einer Aminosäure in der Polypeptidsequenz entsprechen. Die Translation zum Protein ist jedoch immer noch systematisch und kolinear, so dass die Nukleotide 1 bis 3 der Aminosäure 1 entsprechen, die Nukleotide 4 bis 6 der Aminosäure 2 entsprechen, und so weiter.

Der genetische Code ist entartet und universell

Jede Aminosäure wird durch eine Drei-Nukleotid-Sequenz definiert, die als Triplett-Codon bezeichnet wird. Angesichts der unterschiedlichen Anzahl von „Buchstaben“ in der mRNA und Protein-„Alphabeten“ vermuteten Wissenschaftler, dass einzelne Aminosäuren durch Kombinationen von Nukleotiden dargestellt werden müssen. Nukleotid-Dubletts würden nicht ausreichen, um jede Aminosäure zu spezifizieren, da es nur 16 mögliche Kombinationen aus zwei Nukleotiden gibt (4 2 ). Im Gegensatz dazu gibt es 64 mögliche Nukleotidtripletts (4 3 ), was weit mehr ist als die Anzahl der Aminosäuren. Wissenschaftler stellten die Theorie auf, dass Aminosäuren durch Nukleotidtripletts kodiert werden und dass der genetische Code „degeneriert“ ist. Mit anderen Worten, eine gegebene Aminosäure könnte von mehr als einem Nukleotidtriplett kodiert werden. Dies wurde später experimentell bestätigt: Francis Crick und Sydney Brenner nutzten das chemische Mutagen Proflavin, um ein, zwei oder drei Nukleotide in das Gen eines Virus einzufügen. Wenn ein oder zwei Nukleotide eingefügt wurden, wurden die normalen Proteine ​​nicht produziert. Wenn drei Nukleotide eingefügt wurden, war das Protein synthetisiert und funktionsfähig. Dies zeigte, dass die Aminosäuren durch Gruppen von drei Nukleotiden spezifiziert werden müssen. Diese Nukleotidtripletts werden Codons genannt. Die Insertion von einem oder zwei Nukleotiden veränderte den Triplett-Leseraster vollständig, wodurch die Botschaft für jede nachfolgende Aminosäure verändert wurde ((Abbildung)). Obwohl die Insertion von drei Nukleotiden die Insertion einer zusätzlichen Aminosäure während der Translation verursachte, wurde die Integrität des Rests des Proteins aufrechterhalten.

Wissenschaftler haben den genetischen Code sorgfältig gelöst, indem sie synthetische mRNAs in vitro übersetzten und die von ihnen spezifizierten Proteine ​​sequenzierten ((Abbildung)).

Zusätzlich zu Codons, die die Addition einer spezifischen Aminosäure an eine Polypeptidkette anordnen, beenden drei der 64 Codons die Proteinsynthese und setzen das Polypeptid aus der Translationsmaschinerie frei. Diese Tripletts werden Nonsense-Codons genannt, oder Stopp-Codons. Ein weiteres Codon, AUG, hat ebenfalls eine besondere Funktion. Neben der Spezifizierung der Aminosäure Methionin dient sie auch als Startcodon zur Initiierung der Translation. Der Leserahmen für die Translation wird durch das AUG-Startcodon nahe dem 5′-Ende der mRNA gesetzt. Nach dem Startcodon wird die mRNA in Dreiergruppen gelesen, bis ein Stopcodon angetroffen wird.

Die Anordnung der Codiertabelle verrät die Struktur des Codes. Es gibt sechzehn “Blöcke” von Codons, die jeweils durch das erste und zweite Nukleotid der Codons innerhalb des Blocks spezifiziert werden, z. B. der “AC*” Block, der der Aminosäure Threonin (Thr) entspricht. Einige Blöcke sind in eine Pyrimidinhälfte unterteilt, in der das Codon mit U oder C endet, und eine Purinhälfte, in der das Codon mit A oder G endet. Einige Aminosäuren erhalten einen ganzen Block aus vier Codons, wie Alanin (Ala) , Threonin (Thr) und Prolin (Pro). Einige erhalten die Pyrimidinhälfte ihres Blocks, wie Histidin (His) und Asparagin (Asn). Andere erhalten die Purinhälfte ihres Blocks, wie Glutamat (Glu) und Lysin (Lys). Beachten Sie, dass einige Aminosäuren einen Block und einen halben Block für insgesamt sechs Codons erhalten.

Die Spezifizierung einer einzelnen Aminosäure durch mehrere ähnliche Codons wird als “Degeneration bezeichnet.” Degeneration wird als ein zellulärer Mechanismus angesehen, um die negativen Auswirkungen zufälliger Mutationen zu reduzieren. Codons, die dieselbe Aminosäure spezifizieren, unterscheiden sich typischerweise nur durch ein Nukleotid. Außerdem werden Aminosäuren mit chemisch ähnlichen Seitenketten durch ähnliche Codons kodiert. Aspartat (Asp) und Glutamat (Glu), die den GA*-Block besetzen, sind beispielsweise beide negativ geladen. Diese Nuance des genetischen Codes stellt sicher, dass eine Einzelnukleotid-Substitutionsmutation möglicherweise dieselbe Aminosäure spezifiziert, aber keine Wirkung hat oder eine ähnliche Aminosäure spezifiziert, wodurch verhindert wird, dass das Protein vollständig funktionsunfähig wird.

Der genetische Code ist nahezu universell. Mit wenigen Ausnahmen verwenden praktisch alle Arten den gleichen genetischen Code für die Proteinsynthese. Die Konservierung von Codons bedeutet, dass eine gereinigte mRNA, die das Globinprotein in Pferden kodiert, auf eine Tulpenzelle übertragen werden könnte, und die Tulpe würde Pferdeglobin synthetisieren. Dass es nur einen genetischen Code gibt, ist ein starker Beweis dafür, dass alles Leben auf der Erde einen gemeinsamen Ursprung hat, insbesondere wenn man bedenkt, dass es etwa 10 84 mögliche Kombinationen von 20 Aminosäuren und 64 Triplett-Codons gibt.

Sehen Sie ein Gen transkribieren und übersetzen (Webseite, Flash-Animation), um ein Gen zu transkribieren und es mithilfe komplementärer Paarung und des genetischen Codes in ein Protein zu übersetzen.

Was hat mehr DNA: Eine Kiwi oder eine Erdbeere?

Frage: Würden eine ungefähr gleich große Kiwi und eine Erdbeere ((Abbildung)) auch ungefähr die gleiche Menge an DNA haben?

Hintergrund: Gene werden auf Chromosomen getragen und bestehen aus DNA. Alle Säugetiere sind diploid, das heißt, sie haben zwei Kopien jedes Chromosoms. Allerdings sind nicht alle Pflanzen diploid. Die gewöhnliche Erdbeere ist oktoploid (8n) und die kultivierte Kiwi ist hexaploid (6n). Untersuchen Sie die Gesamtzahl der Chromosomen in den Zellen jeder dieser Früchte und überlegen Sie, wie diese mit der DNA-Menge in den Zellkernen dieser Früchte korrespondieren könnte. Welche anderen Faktoren könnten zur Gesamtmenge an DNA in einer einzelnen Frucht beitragen? Lesen Sie mehr über die Technik der DNA-Isolierung, um zu verstehen, wie jeder Schritt des Isolierungsprotokolls zur Freisetzung und Präzipitation von DNA beiträgt.

Hypothese: Stellen Sie eine Hypothese auf, ob Sie bei ähnlich großen Erdbeeren und Kiwis einen Unterschied in der DNA-Menge feststellen könnten. Welche Frucht würde Ihrer Meinung nach mehr DNA liefern?

Testen Sie Ihre Hypothese: Isolieren Sie die DNA von einer Erdbeere und einer Kiwi, die ähnlich groß sind. Führen Sie das Experiment mindestens dreifach für jede Frucht durch

  1. Bereiten Sie eine Flasche DNA-Extraktionspuffer aus 900 ml Wasser, 50 ml Geschirrspülmittel und zwei Teelöffeln Kochsalz vor. Mischen Sie durch Umkehren (verschließen Sie es und drehen Sie es ein paar Mal auf den Kopf).
  2. Mahlen Sie eine Erdbeere und eine Kiwi von Hand in einer Plastiktüte oder mit einem Mörser und Stößel oder mit einer Metallschüssel und dem Ende eines stumpfen Instruments. Mahlen Sie mindestens zwei Minuten pro Frucht.
  3. 10 ml des DNA-Extraktionspuffers zu jeder Frucht geben und mindestens eine Minute lang gut mischen.
  4. Entfernen Sie Zelltrümmer, indem Sie jede Fruchtmischung durch ein Käsetuch oder ein poröses Tuch filtern und in einen Trichter in ein Reagenzglas oder einen geeigneten Behälter geben.
  5. Gießen Sie eiskaltes Ethanol oder Isopropanol (Reinigungsalkohol) in das Reagenzglas. Sie sollten weiße, ausgefällte DNA beobachten.
  6. Sammeln Sie die DNA von jeder Frucht, indem Sie sie um separate Glasstäbe wickeln.

Notieren Sie Ihre Beobachtungen: Da Sie das DNA-Volumen nicht quantitativ messen, können Sie für jeden Versuch aufzeichnen, ob die beiden Früchte die gleiche oder unterschiedliche DNA-Mengen produzierten, wie mit dem Auge beobachtet. Wenn die eine oder andere Frucht merklich mehr DNA produziert hat, notieren Sie dies ebenfalls. Stellen Sie fest, ob Ihre Beobachtungen mit mehreren Stücken jeder Frucht übereinstimmen.

Analysieren Sie Ihre Daten: Haben Sie einen offensichtlichen Unterschied in der Menge an DNA festgestellt, die von jeder Frucht produziert wird? Waren Ihre Ergebnisse reproduzierbar?

Schlussfolgerungen ziehen: Können Sie aus dem, was Sie über die Anzahl der Chromosomen in jeder Frucht wissen, den Schluss ziehen, dass die Chromosomenzahl notwendigerweise mit der DNA-Menge korreliert? Können Sie Nachteile bei diesem Verfahren erkennen? Wenn Sie Zugang zu einem Labor hätten, wie könnten Sie Ihren Vergleich standardisieren und quantitativer gestalten?

Abschnittszusammenfassung

Der genetische Code bezieht sich auf das DNA-Alphabet (A, T, C, G), das RNA-Alphabet (A, U, C, G) und das Polypeptid-Alphabet (20 Aminosäuren). Das zentrale Dogma beschreibt den Fluss der Erbinformation in der Zelle von den Genen über die mRNA zu den Proteinen. Gene werden verwendet, um mRNA durch den Transkriptionsprozess herzustellen mRNA wird verwendet, um Proteine ​​durch den Translationsprozess zu synthetisieren. Der genetische Code ist degeneriert, weil 64 Triplett-Codons in der mRNA nur 20 Aminosäuren und drei Nonsense-Codons spezifizieren. Die meisten Aminosäuren haben mehrere ähnliche Codons. Fast jede Spezies auf dem Planeten verwendet den gleichen genetischen Code.

Freie Antwort

Stellen Sie sich vor, es gäbe 200 statt 20 häufig vorkommende Aminosäuren. Was wäre die kürzeste mögliche Codonlänge, wenn Sie wissen, was Sie über den genetischen Code wissen? Erklären.

Für 200 häufig vorkommende Aminosäuren müssten Codons, die aus vier Nukleotidtypen bestehen, mindestens vier Nukleotide lang sein, denn 4 4 = 256. In diesem Fall gäbe es viel weniger Degeneration.

Diskutieren Sie, wie die Degeneration des genetischen Codes Zellen robuster gegenüber Mutationen macht.

Codons, die dieselbe Aminosäure spezifizieren, unterscheiden sich typischerweise nur durch ein Nukleotid. Außerdem werden Aminosäuren mit chemisch ähnlichen Seitenketten durch ähnliche Codons kodiert. Diese Nuance des genetischen Codes stellt sicher, dass eine Einzelnukleotid-Substitutionsmutation entweder dieselbe Aminosäure spezifizieren kann und keine Wirkung hat oder eine ähnliche Aminosäure spezifizieren kann, wodurch verhindert wird, dass das Protein vollständig funktionsunfähig wird.

Ein Wissenschaftler, der mRNA sequenziert, identifiziert den folgenden Strang: CUAUGUGUCGUAACAGCCGAUGACCCG

Welche Sequenz der Aminosäurekette bildet diese mRNA, wenn sie translatiert wird?

Der erste Schritt zum Schreiben der Aminosäuresequenz besteht darin, das Startcodon AUG zu finden. Dann wird die Nukleotidsequenz in Tripletts aufgetrennt: CU AUG UGU CGU AAC AGC CGA UGA. Wir stoppen die Translation bei UGA, weil dieses Triplett ein Stoppcodon kodiert. Wenn wir diese Codons in Aminosäuren umwandeln, wird die Sequenz zu Met Cys Arg Asn Ser Arg.

Glossar


Der genetische Code

Der zelluläre Transkriptionsprozess erzeugt Boten-RNA (mRNA), eine mobile molekulare Kopie eines oder mehrerer Gene mit einem Alphabet von A, C, G und Uracil (U). Die Translation der mRNA-Matrize wandelt die genetische Information auf Nukleotidbasis in ein Proteinprodukt um. Proteinsequenzen bestehen aus 20 häufig vorkommenden Aminosäuren, daher kann man sagen, dass das Proteinalphabet aus 20 Buchstaben besteht ([link]). Jede Aminosäure wird durch eine Drei-Nukleotid-Sequenz definiert, die als Triplett-Codon bezeichnet wird. Unterschiedliche Aminosäuren haben unterschiedliche Chemien (wie sauer gegenüber basisch oder polar und unpolar) und unterschiedliche strukturelle Einschränkungen. Die Variation der Aminosäuresequenz führt zu enormen Variationen in der Proteinstruktur und -funktion.

Das zentrale Dogma: DNA kodiert RNA RNA kodiert Protein

Der Fluss der genetischen Information in Zellen von DNA über mRNA bis hin zu Protein wird beschrieben durch die Zentrales Dogma ([Link]), die besagt, dass Gene die Sequenz von mRNAs spezifizieren, die wiederum die Sequenz von Proteinen spezifizieren. Die Entschlüsselung eines Moleküls zum anderen erfolgt durch spezifische Proteine ​​und RNAs. Da die in der DNA gespeicherten Informationen so zentral für die Zellfunktion sind, ist es intuitiv sinnvoll, dass die Zelle mRNA-Kopien dieser Informationen für die Proteinsynthese anfertigt, während die DNA selbst intakt und geschützt bleibt. Das Kopieren von DNA in RNA ist relativ einfach, wobei für jedes im DNA-Strang gelesene Nukleotid ein Nukleotid an den mRNA-Strang angefügt wird. Die Translation zum Protein ist etwas komplexer, da drei mRNA-Nukleotide einer Aminosäure in der Polypeptidsequenz entsprechen. Die Übersetzung in Protein ist jedoch immer noch systematisch und kolinear, so dass die Nukleotide 1 bis 3 der Aminosäure 1 entsprechen, die Nukleotide 4 bis 6 der Aminosäure 2 entsprechen, und so weiter.

Der genetische Code ist entartet und universell

Angesichts der unterschiedlichen Anzahl von „Buchstaben“ in der mRNA und Protein-„Alphabeten“ vermuteten Wissenschaftler, dass Kombinationen von Nukleotiden einzelnen Aminosäuren entsprachen. Nukleotid-Dubletts würden nicht ausreichen, um jede Aminosäure zu spezifizieren, da es nur 16 mögliche Kombinationen aus zwei Nukleotiden gibt (4 2 ). Im Gegensatz dazu gibt es 64 mögliche Nukleotidtripletts (4 3 ), was weit mehr ist als die Anzahl der Aminosäuren. Wissenschaftler stellten die Theorie auf, dass Aminosäuren durch Nukleotidtripletts kodiert werden und dass der genetische Code degenerieren. Mit anderen Worten, eine gegebene Aminosäure könnte von mehr als einem Nukleotidtriplett kodiert werden. Dies wurde später experimentell bestätigt. Francis Crick und Sydney Brenner verwendeten das chemische Mutagen Proflavin, um ein, zwei oder drei Nukleotide in das Gen eines Virus einzufügen. Wenn ein oder zwei Nukleotide eingefügt wurden, wurde die Proteinsynthese vollständig aufgehoben. Wenn drei Nukleotide eingefügt wurden, war das Protein synthetisiert und funktionsfähig. Dies zeigte, dass drei Nukleotide jede Aminosäure spezifizieren. Diese Nukleotidtripletts heißen Codons. Die Insertion von ein oder zwei Nukleotiden veränderte das Triplett vollständig Leserahmen, wodurch die Nachricht für jede nachfolgende Aminosäure geändert wird ([Link]). Obwohl die Insertion von drei Nukleotiden die Insertion einer zusätzlichen Aminosäure während der Translation verursachte, wurde die Integrität des Rests des Proteins aufrechterhalten.

Wissenschaftler haben den genetischen Code sorgfältig gelöst, indem sie synthetische mRNAs in vitro übersetzten und die von ihnen angegebenen Proteine ​​sequenzierten ([Link]).

Zusätzlich zum Anfügen einer spezifischen Aminosäure an eine Polypeptidkette beenden drei der 64 Codons die Proteinsynthese und setzen das Polypeptid aus der Translationsmaschinerie frei. Diese Drillinge heißen Unsinn-Codonsoder Stoppcodons. Ein weiteres Codon, AUG, hat ebenfalls eine besondere Funktion. Neben der Spezifizierung der Aminosäure Methionin dient sie auch als Startcodon zur Initiierung der Translation. Der Leserahmen für die Translation wird durch das AUG-Startcodon nahe dem 5'-Ende der mRNA gesetzt.

Der genetische Code ist universell. Mit wenigen Ausnahmen verwenden praktisch alle Arten den gleichen genetischen Code für die Proteinsynthese. Die Konservierung von Codons bedeutet, dass eine gereinigte mRNA, die das Globinprotein in Pferden kodiert, auf eine Tulpenzelle übertragen werden könnte, und die Tulpe würde Pferdeglobin synthetisieren. Dass es nur einen genetischen Code gibt, ist ein starker Beweis dafür, dass alles Leben auf der Erde einen gemeinsamen Ursprung hat, insbesondere wenn man bedenkt, dass es etwa 10 84 mögliche Kombinationen von 20 Aminosäuren und 64 Triplett-Codons gibt.

Transkribieren Sie ein Gen und übersetzen Sie es mithilfe komplementärer Paarung und des genetischen Codes an dieser Stelle in ein Protein.

Es wird angenommen, dass Degeneration ein zellulärer Mechanismus ist, um die negativen Auswirkungen zufälliger Mutationen zu reduzieren. Codons, die dieselbe Aminosäure spezifizieren, unterscheiden sich typischerweise nur durch ein Nukleotid. Außerdem werden Aminosäuren mit chemisch ähnlichen Seitenketten durch ähnliche Codons kodiert. Diese Nuance des genetischen Codes stellt sicher, dass eine Einzelnukleotid-Substitutionsmutation entweder dieselbe Aminosäure spezifizieren kann, aber keine Wirkung hat oder eine ähnliche Aminosäure spezifiziert, wodurch verhindert wird, dass das Protein vollständig funktionsunfähig wird.

Was hat mehr DNA: Eine Kiwi oder eine Erdbeere?

Frage: Würden Kiwis und Erdbeeren, die ungefähr gleich groß sind ([link]), auch ungefähr die gleiche Menge an DNA haben?

Hintergrund: Gene werden auf Chromosomen getragen und bestehen aus DNA. Alle Säugetiere sind diploid, das heißt, sie haben zwei Kopien jedes Chromosoms. Allerdings sind nicht alle Pflanzen diploid. Die gewöhnliche Erdbeere ist oktoploid (8n) und die kultivierte Kiwi ist hexaploid (6n). Untersuchen Sie die Gesamtzahl der Chromosomen in den Zellen jeder dieser Früchte und überlegen Sie, wie diese mit der DNA-Menge in den Zellkernen dieser Früchte korrespondieren könnte. Lesen Sie mehr über die Technik der DNA-Isolierung, um zu verstehen, wie jeder Schritt des Isolierungsprotokolls zur Freisetzung und Präzipitation von DNA beiträgt.

Hypothese: Stellen Sie eine Hypothese auf, ob Sie bei ähnlich großen Erdbeeren und Kiwis einen Unterschied in der DNA-Menge feststellen könnten. Welche Frucht würde Ihrer Meinung nach mehr DNA liefern?

Testen Sie Ihre Hypothese: Isolieren Sie die DNA von einer Erdbeere und einer Kiwi, die ähnlich groß sind. Führen Sie das Experiment mindestens dreifach für jede Frucht durch.

  1. Bereiten Sie eine Flasche DNA-Extraktionspuffer aus 900 ml Wasser, 50 ml Geschirrspülmittel und zwei Teelöffeln Kochsalz vor. Mischen Sie durch Umkehren (verschließen Sie es und drehen Sie es ein paar Mal auf den Kopf).
  2. Mahlen Sie eine Erdbeere und eine Kiwis von Hand in einer Plastiktüte oder mit einem Mörser und Stößel oder mit einer Metallschüssel und dem Ende eines stumpfen Instruments. Mahlen Sie mindestens zwei Minuten pro Frucht.
  3. 10 ml des DNA-Extraktionspuffers zu jeder Frucht geben und mindestens eine Minute lang gut mischen.
  4. Entfernen Sie Zelltrümmer, indem Sie jede Fruchtmischung durch ein Käsetuch oder ein poröses Tuch filtern und in einen Trichter in ein Reagenzglas oder einen geeigneten Behälter geben.
  5. Gießen Sie eiskaltes Ethanol oder Isopropanol (Reinigungsalkohol) in das Reagenzglas. Sie sollten weiße, ausgefällte DNA beobachten.
  6. Sammeln Sie die DNA von jeder Frucht, indem Sie sie um separate Glasstäbe wickeln.

Notieren Sie Ihre Beobachtungen: Da Sie das DNA-Volumen nicht quantitativ messen, können Sie für jeden Versuch aufzeichnen, ob die beiden Früchte die gleiche oder unterschiedliche DNA-Mengen produzierten, wie mit dem Auge beobachtet. Wenn die eine oder andere Frucht merklich mehr DNA produziert hat, notieren Sie dies ebenfalls. Stellen Sie fest, ob Ihre Beobachtungen mit mehreren Stücken jeder Frucht übereinstimmen.

Analysieren Sie Ihre Daten: Haben Sie einen offensichtlichen Unterschied in der Menge an DNA festgestellt, die von jeder Frucht produziert wird? Waren Ihre Ergebnisse reproduzierbar?

Schlussfolgerungen ziehen: Können Sie aus dem, was Sie über die Anzahl der Chromosomen in jeder Frucht wissen, den Schluss ziehen, dass die Chromosomenzahl notwendigerweise mit der DNA-Menge korreliert? Können Sie Nachteile bei diesem Verfahren erkennen? Wenn Sie Zugang zu einem Labor hätten, wie könnten Sie Ihren Vergleich standardisieren und quantitativer gestalten?

Abschnittszusammenfassung

Der genetische Code bezieht sich auf das DNA-Alphabet (A, T, C, G), das RNA-Alphabet (A, U, C, G) und das Polypeptid-Alphabet (20 Aminosäuren). Das zentrale Dogma beschreibt den Fluss der genetischen Information in der Zelle von den Genen über die mRNA zu den Proteinen. Gene werden verwendet, um mRNA durch den Transkriptionsprozess herzustellen mRNA wird verwendet, um Proteine ​​durch den Translationsprozess zu synthetisieren. Der genetische Code ist degeneriert, weil 64 Triplett-Codons in der mRNA nur 20 Aminosäuren und drei Nonsense-Codons spezifizieren. Fast jede Spezies auf dem Planeten verwendet den gleichen genetischen Code.

Rezensionsfragen

Die AUC- und AUA-Codons in mRNA spezifizieren beide Isoleucin. Welche Eigenschaft des genetischen Codes erklärt dies?


Freie Antwort

Stellen Sie sich vor, es gäbe 200 statt 20 häufig vorkommende Aminosäuren. Was wäre die kürzeste mögliche Codonlänge, wenn Sie wissen, was Sie über den genetischen Code wissen? Erklären.

Für 200 häufig vorkommende Aminosäuren müssten Codons, die aus vier Nukleotidtypen bestehen, mindestens vier Nukleotide lang sein, denn 4 4 = 256. In diesem Fall gäbe es viel weniger Degeneration.

Diskutieren Sie, wie die Degeneration des genetischen Codes Zellen robuster gegenüber Mutationen macht.

Codons, die dieselbe Aminosäure spezifizieren, unterscheiden sich typischerweise nur durch ein Nukleotid. Außerdem werden Aminosäuren mit chemisch ähnlichen Seitenketten durch ähnliche Codons kodiert. Diese Nuance des genetischen Codes stellt sicher, dass eine Einzelnukleotid-Substitutionsmutation entweder dieselbe Aminosäure spezifizieren kann und keine Wirkung hat oder eine ähnliche Aminosäure spezifizieren kann, wodurch verhindert wird, dass das Protein vollständig funktionsunfähig wird.

Ein Wissenschaftler, der mRNA sequenziert, identifiziert den folgenden Strang: CUAUGUGUCGUAACAGCCGAUGACCCG

Welche Sequenz der Aminosäurekette bildet diese mRNA, wenn sie translatiert wird?

Der erste Schritt zum Schreiben der Aminosäuresequenz besteht darin, das Startcodon AUG zu finden. Dann wird die Nukleotidsequenz in Tripletts aufgetrennt: CU AUG UGU CGU AAC AGC CGA UGA. Wir stoppen die Translation bei UGA, weil dieses Triplett ein Stoppcodon kodiert. Wenn wir diese Codons in Aminosäuren umwandeln, wird die Sequenz zu Met Cys Arg Asn Ser Arg.


Entartung des genetischen Codes

Cricks Arbeit deutete auch darauf hin, dass der genetische Code degenerieren. Dieser Ausdruck ist keine moralische Anklage. Es bedeutet einfach, dass jedes der 64 Tripletts eine bestimmte Bedeutung innerhalb des Codes haben muss, so dass zumindest einige Aminosäuren durch zwei oder mehr verschiedene Tripletts spezifiziert werden müssen. Wenn nur 20 Tripletts verwendet werden (wobei die anderen 44 Nonsense sind, da sie für keine Aminosäure kodieren), dann kann erwartet werden, dass die meisten Frameshift-Mutationen Nonsense-Wörter produzieren, was vermutlich den Proteinbildungsprozess stoppt. Wenn dies der Fall wäre, würde die Unterdrückung von Frameshift-Mutationen selten, wenn überhaupt, funktionieren. Wenn jedoch alle Tripletts eine Aminosäure angeben, würden die geänderten Wörter einfach dazu führen, dass falsche Aminosäuren in das Protein eingefügt werden. Daher argumentierte Crick, dass viele oder alle Aminosäuren mehrere verschiedene Namen im Basenpaar-Code haben müssen, diese Hypothese wurde später biochemisch bestätigt.

BOTSCHAFT

Die Diskussion bis hierher zeigt, dass

Drei Basen kodieren für eine Aminosäure. Diese Tripletts werden als Codons bezeichnet.

Der Code wird von einem festen Startpunkt gelesen und bis zum Ende der Codiersequenz fortgesetzt. Wir wissen dies, weil eine einzelne Frameshift-Mutation irgendwo in der kodierenden Sequenz das Codon-Alignment für den Rest der Sequenz verändert.

Der Code ist dahingehend degeneriert, dass einige Aminosäuren durch mehr als ein Codon spezifiziert werden.


Der genetische Code ist entartet und universell

Angesichts der unterschiedlichen Anzahl von „Buchstaben“ in der mRNA und Protein-„Alphabeten“ vermuteten Wissenschaftler, dass Kombinationen von Nukleotiden einzelnen Aminosäuren entsprachen. Nukleotid-Dubletts würden nicht ausreichen, um jede Aminosäure zu spezifizieren, da es nur 16 mögliche Kombinationen aus zwei Nukleotiden gibt (4 2 ). Im Gegensatz dazu gibt es 64 mögliche Nukleotidtripletts (4 3 ), was weit mehr ist als die Anzahl der Aminosäuren. Wissenschaftler stellten die Theorie auf, dass Aminosäuren durch Nukleotidtripletts kodiert werden und dass der genetische Code degeneriert ist. Mit anderen Worten, eine gegebene Aminosäure könnte von mehr als einem Nukleotidtriplett kodiert werden. Dies wurde später experimentell bestätigt. Francis Crick und Sydney Brenner verwendeten das chemische Mutagen Proflavin, um ein, zwei oder drei Nukleotide in das Gen eines Virus einzufügen. Wenn ein oder zwei Nukleotide eingefügt wurden, wurde die Proteinsynthese vollständig aufgehoben. Wenn drei Nukleotide eingefügt wurden, war das Protein synthetisiert und funktionsfähig. Dies zeigte, dass drei Nukleotide jede Aminosäure spezifizieren. Diese Nukleotidtripletts werden Codons genannt. Die Insertion von ein oder zwei Nukleotiden veränderte den Triplett-Leseraster vollständig und veränderte dadurch die Botschaft für jede nachfolgende Aminosäure ([Link]). Obwohl die Insertion von drei Nukleotiden die Insertion einer zusätzlichen Aminosäure während der Translation verursachte, wurde die Integrität des Rests des Proteins aufrechterhalten.

Wissenschaftler haben den genetischen Code sorgfältig gelöst, indem sie synthetische mRNAs in vitro übersetzten und die von ihnen angegebenen Proteine ​​sequenzierten ([Link]).

Zusätzlich zum Anfügen einer spezifischen Aminosäure an eine Polypeptidkette beenden drei der 64 Codons die Proteinsynthese und setzen das Polypeptid aus der Translationsmaschinerie frei. Diese Tripletts werden Nonsense-Codons oder Stop-Codons genannt. Ein weiteres Codon, AUG, hat ebenfalls eine besondere Funktion. Neben der Spezifizierung der Aminosäure Methionin dient sie auch als Startcodon zur Initiierung der Translation. Der Leserahmen für die Translation wird durch das AUG-Startcodon nahe dem 5′-Ende der mRNA gesetzt.

Der genetische Code ist universell. Mit wenigen Ausnahmen verwenden praktisch alle Arten den gleichen genetischen Code für die Proteinsynthese. Die Konservierung von Codons bedeutet, dass eine gereinigte mRNA, die das Globinprotein in Pferden kodiert, auf eine Tulpenzelle übertragen werden könnte, und die Tulpe würde Pferdeglobin synthetisieren. Dass es nur einen genetischen Code gibt, ist ein starker Beweis dafür, dass alles Leben auf der Erde einen gemeinsamen Ursprung hat, insbesondere wenn man bedenkt, dass es etwa 10 84 mögliche Kombinationen von 20 Aminosäuren und 64 Triplett-Codons gibt.

Transkribieren Sie ein Gen und übersetzen Sie es mithilfe komplementärer Paarung und des genetischen Codes an dieser Stelle in ein Protein.

Es wird angenommen, dass Degeneration ein zellulärer Mechanismus ist, um die negativen Auswirkungen zufälliger Mutationen zu reduzieren. Codons, die dieselbe Aminosäure spezifizieren, unterscheiden sich typischerweise nur durch ein Nukleotid. Außerdem werden Aminosäuren mit chemisch ähnlichen Seitenketten durch ähnliche Codons kodiert. Diese Nuance des genetischen Codes stellt sicher, dass eine Einzelnukleotid-Substitutionsmutation entweder dieselbe Aminosäure spezifizieren kann, aber keine Wirkung hat oder eine ähnliche Aminosäure spezifiziert, wodurch verhindert wird, dass das Protein vollständig funktionsunfähig wird.

Was hat mehr DNA: Eine Kiwi oder eine Erdbeere?

Frage: Würden Kiwis und Erdbeeren, die ungefähr gleich groß sind ([link]), auch ungefähr die gleiche Menge an DNA haben?

Hintergrund: Gene werden auf Chromosomen getragen und bestehen aus DNA. Alle Säugetiere sind diploid, das heißt, sie haben zwei Kopien jedes Chromosoms. Allerdings sind nicht alle Pflanzen diploid. Die gewöhnliche Erdbeere ist oktoploid (8n) und die kultivierte Kiwi ist hexaploid (6n). Untersuchen Sie die Gesamtzahl der Chromosomen in den Zellen jeder dieser Früchte und überlegen Sie, wie diese mit der DNA-Menge in den Zellkernen dieser Früchte korrespondieren könnte. Lesen Sie mehr über die Technik der DNA-Isolierung, um zu verstehen, wie jeder Schritt des Isolierungsprotokolls zur Freisetzung und Präzipitation von DNA beiträgt.

Hypothese: Stellen Sie eine Hypothese auf, ob Sie bei ähnlich großen Erdbeeren und Kiwis einen Unterschied in der DNA-Menge feststellen könnten. Welche Frucht würde Ihrer Meinung nach mehr DNA liefern?

Testen Sie Ihre Hypothese: Isolieren Sie die DNA von einer Erdbeere und einer Kiwi, die ähnlich groß sind. Führen Sie das Experiment mindestens dreifach für jede Frucht durch.

  1. Bereiten Sie eine Flasche DNA-Extraktionspuffer aus 900 ml Wasser, 50 ml Geschirrspülmittel und zwei Teelöffeln Kochsalz vor. Mischen Sie durch Umkehren (verschließen Sie es und drehen Sie es ein paar Mal auf den Kopf).
  2. Mahlen Sie eine Erdbeere und eine Kiwis von Hand in einer Plastiktüte oder mit einem Mörser und Stößel oder mit einer Metallschüssel und dem Ende eines stumpfen Instruments. Mahlen Sie mindestens zwei Minuten pro Frucht.
  3. 10 ml des DNA-Extraktionspuffers zu jeder Frucht geben und mindestens eine Minute lang gut mischen.
  4. Entfernen Sie Zelltrümmer, indem Sie jede Fruchtmischung durch ein Käsetuch oder ein poröses Tuch filtern und in einen Trichter in ein Reagenzglas oder einen geeigneten Behälter geben.
  5. Gießen Sie eiskaltes Ethanol oder Isopropanol (Reinigungsalkohol) in das Reagenzglas. Sie sollten weiße, ausgefällte DNA beobachten.
  6. Sammeln Sie die DNA von jeder Frucht, indem Sie sie um separate Glasstäbe wickeln.

Notieren Sie Ihre Beobachtungen: Da Sie das DNA-Volumen nicht quantitativ messen, können Sie für jeden Versuch aufzeichnen, ob die beiden Früchte die gleiche oder unterschiedliche DNA-Mengen produzierten, wie mit dem Auge beobachtet. Wenn die eine oder andere Frucht merklich mehr DNA produziert hat, notieren Sie dies ebenfalls. Stellen Sie fest, ob Ihre Beobachtungen mit mehreren Stücken jeder Frucht übereinstimmen.

Analysieren Sie Ihre Daten: Haben Sie einen offensichtlichen Unterschied in der Menge an DNA festgestellt, die von jeder Frucht produziert wird? Waren Ihre Ergebnisse reproduzierbar?

Schlussfolgerungen ziehen: Können Sie aus dem, was Sie über die Anzahl der Chromosomen in jeder Frucht wissen, den Schluss ziehen, dass die Chromosomenzahl notwendigerweise mit der DNA-Menge korreliert? Können Sie Nachteile bei diesem Verfahren erkennen? Wenn Sie Zugang zu einem Labor hätten, wie könnten Sie Ihren Vergleich standardisieren und quantitativer gestalten?


Merkmale des genetischen Codes

Drilling Natur

Ein Triplett-Code könnte einen genetischen Code für 64 verschiedene Kombinationen (4 x 4 x 4) genetischen Codes erstellen und viele Informationen im DNA-Molekül liefern, um die Platzierung aller 20 Aminosäuren zu spezifizieren. Als Experimente durchgeführt wurden, um den genetischen Code zu knacken, stellte sich heraus, dass es sich um einen Triplett-Code handelte. Diese drei Buchstabencodes von Nukleotiden (AUG, AAA usw.) werden Codons genannt.

Entartung

Der Code ist degeneriert, was bedeutet, dass dieselbe Aminosäure von mehr als einem Basentriplett kodiert wird. Beispielsweise haben die drei Aminosäuren Arginin, Alanin und Leucin jeweils sechs synonyme Codons.

Nicht überlappend

Der genetische Code ist nicht überlappend, d. h. die benachbarten Codons überlappen sich nicht. Ein nicht überlappender Code bedeutet, dass nicht derselbe Buchstabe für zwei verschiedene Codons verwendet wird. Mit anderen Worten, keine einzelne Base kann an der Bildung von mehr als einem Codon teilnehmen.

Kommalos

Es gibt kein Signal, um das Ende eines Codons und den Beginn des nächsten anzuzeigen. Der genetische Code ist kommalos (oder kommafrei).

Eindeutigkeit

Ein bestimmtes Codon kodiert immer für dieselbe Aminosäure. Während dieselbe Aminosäure von mehr als einem Codon codiert werden kann (der Code ist degeneriert), darf dasselbe Codon nicht für zwei oder mehr verschiedene Aminosäuren codieren (eindeutig).

Universalität

Der Code basiert zwar auf Arbeiten zum Bakterium Escherichia coli, ist aber auch für andere Organismen gültig. Dieses wichtige Merkmal des genetischen Codes wird seine Universalität genannt. Das bedeutet, dass in allen Lebensformen von einfachen Mikroorganismen bis hin zu komplexen, vielzelligen Organismen wie dem Menschen die gleichen Sequenzen von 3 Basen für die gleichen Aminosäuren kodieren.

Polarität

Der genetische Code hat Polarität, d. h. der Code wird immer in einer festen Richtung gelesen, d. h. in der Richtung 5′ → 3′.

Ketteninitiationscodons

Die Drillinge AUG und GUG spielen Doppelrollen in E coli. Wenn sie zwischen den beiden Enden eines Cistrons vorkommen (Zwischenposition), kodieren sie für die Aminosäuren Methionin und Valin jeweils in einer Zwischenposition im Proteinmolekül.

Kettenabbruchcodons

Die 3 Tripletts UAA, UAG, UGA kodieren für keine Aminosäure. Sie wurden ursprünglich als Nonsense-Codons beschrieben, im Gegensatz zu den restlichen 61 Codons, die als Sense-Codons bezeichnet werden


Abschnittszusammenfassung

Der genetische Code bezieht sich auf das DNA-Alphabet (A, T, C, G), das RNA-Alphabet (A, U, C, G) und das Polypeptid-Alphabet (20 Aminosäuren). Das zentrale Dogma beschreibt den Fluss der Erbinformation in der Zelle von den Genen über die mRNA zu den Proteinen. Gene werden verwendet, um mRNA durch den Transkriptionsprozess herzustellen mRNA wird verwendet, um Proteine ​​durch den Translationsprozess zu synthetisieren. Der genetische Code ist degeneriert, weil 64 Triplett-Codons in der mRNA nur 20 Aminosäuren und drei Nonsense-Codons spezifizieren. Die meisten Aminosäuren haben mehrere ähnliche Codons. Fast jede Spezies auf dem Planeten verwendet den gleichen genetischen Code.


Schau das Video: Proteinsyntese genetisk kode (Juni 2022).


Bemerkungen:

  1. Faeramar

    Es stimmt zu, es ist ein bemerkenswerter Satz

  2. Markus

    Ich kann viel über dieses Problem sprechen.

  3. Yvon

    Was kam in deinen Kopf?

  4. Mujas

    Did you come up with such an incomparable answer yourself?

  5. Jamall

    Bitte sagen Sie es mir - wo finde ich weitere Informationen zu diesem Thema?

  6. Maclaine

    Ich finde es seine Schuld.

  7. Hueil

    Interessanterweise habe ich gar nicht daran gedacht...

  8. Floyd

    Ich finde, dass Sie nicht Recht haben. Ich bin sicher. Wir werden diskutieren.



Eine Nachricht schreiben