Information

Wechselwirkung geladener Triphosphate mit der ATP-Bindungsregion in Proteinen

Wechselwirkung geladener Triphosphate mit der ATP-Bindungsregion in Proteinen


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

DNA-Histon-Wechselwirkungen beinhalten positiv geladene Aminosäureseitenkettengruppen, die das negativ geladene Phosphat des Zucker-Phosphat-Rückgrats neutralisieren. Gilt das gleiche für ATP-Bindungsstellen auf Proteinen?

Bei den meisten Modellen, die ich gesehen habe, sieht es so aus, als ob die Base, Adenin, an der Bindung beteiligt ist. Aber das Triphosphat scheint sich spezifisch an positiv geladene Seitenketten zu binden. Ich habe ein bisschen gegoogelt, aber ich konnte keine wirklichen Modelle finden, die dies darstellen. Weiß jemand ob das so ist?


Zusammenfassung

Viele Proteine, die die Nukleotidtriphosphate ATP und GTP binden, haben ein evolutionär konserviertes Motiv – die P-Schleife – das den Phosphatanteil des Moleküls bindet. Dies hat die Sequenz GXXXXGKS/T. Obwohl das konservierte basische Lysin (K) mit zwei der positiv geladenen Phosphateinheiten wechselwirkt, sind andere Wechselwirkungen mit Mg2+ Ionen (mit denen NTPs immer komplexiert sind) und eher polare als geladene Aminosäurereste und das Polypeptidrückgrat.

Detaillierte Abbildung

Obwohl nach ATP gefragt wird, habe ich das GTP-bindende Protein H-ras S. 21 als Illustration, weil das Papier von Pai et al. seine Beschreibung gibt vollständige Details der Wechselwirkungen der Phosphate an, die für ATP und GTP im Wesentlichen gleich sind. (Viele andere Veröffentlichungen neigen dazu, nur Banddiagramme des Proteins zu zeigen.) Beachten Sie auch, dass die Kristallstruktur notwendigerweise ein Komplex mit dem GTP-Analogon GppNp war. (GppNp wird im Gegensatz zu GTP selbst nicht schnell hydrolysiert.)

In diesem Fall hat die evolutionär konservierte P-Schleife, die das Phosphat bindet, die Sequenz:

Gly Ala Gly Gly Val Gly Lys Ser 10 11 12 13 14 15 16 17

Eine dreidimensionale Darstellung der Phosphatbindungsregion ist unten gezeigt. Der linke Rahmen zeigt die P-Schleife und die Reste Thr35 und Asp57 ohne das Nukleotid. Der rechte Rahmen ist der gleiche, jedoch mit GppNp und einem Magnesiumion, und nur die konservierten Reste der P-Schleife sind markiert.

[Eigene Arbeit basierend auf Abb.6 der Arbeit von Pai et al. unter Verwendung der Jmol-Software und der Proteindatenbankdatei 5p21.pdb.]

Ein zweidimensionales Schema der Wechselwirkungen ist unten gezeigt. Die Seitenkettenwechselwirkungen (und die des Magnesiumions) sind als rot gepunktete Linien dargestellt, während diejenigen des Rückgrats schwarz dargestellt sind. Die konservierten Reste der P-Schleife sind durch blauen Text gekennzeichnet.

[Vereinfachte Neuzeichnung eines Teils von Abb. 5 des Artikels von Pai et al., ohne Wasserwechselwirkungen und interatomare Abstände.]

Reflexionen

Obwohl positiv geladene basische Aminosäureseitenketten an der Neutralisierung der negativen Ladungen von Nukleinsäuren und Nukleotidphosphaten beteiligt sind, sind sie nicht das einzige Mittel dazu, und im Fall der NTPs sind sie nicht das Hauptmittel. Magnesiumionen und polare Reste (einschließlich des Proteinrückgrats +ve NH-Gruppen) können eine wichtige Rolle spielen. Meiner Meinung nach spiegelt dies zwei Dinge wider. Erstens ist das Leben dynamisch; Daher werden bei Enzymen häufig schwächere Wechselwirkungen bevorzugt, da sie leicht gebrochen und hergestellt werden können. (NDP muss nach der Hydrolyse aus dem Enzym freigesetzt werden.) Zweitens und spekulativer wird angenommen, dass die P-Schleife sehr alt ist, da sie in einer Vielzahl von konservierten NTP-bindenden Proteinen gefunden wird. Es wurde eine spezifische Rückgratkonformation identifiziert, die diese Interaktion erleichtert. Es könnte entstanden sein, bevor alle 20 (ish) Proteine, die durch den genetischen Code spezifiziert sind, entstanden waren, wenn das Proteinrückgrat eine größere Rolle bei der Interaktion mit kleinen Molekülen hätte spielen können. (Dies wurde auch für Rückgrat-NH-Gruppen vorgeschlagen, die δ+ve-Schwefel in Eisen-Schwefel-Clustern binden.)


ATP-bindender Kassettentransporter

Die ATP-bindende Kassettentransporter (ABC-Transporter) sind eine Transportsystem-Superfamilie, die eine der größten und möglicherweise eine der ältesten Genfamilien ist. Es ist in allen existierenden Stämmen vertreten, von Prokaryoten bis hin zum Menschen. [1] [2] [3]

ABC-Transporter bestehen oft aus mehreren Untereinheiten, von denen eine oder zwei Transmembranproteine ​​und eine oder zwei membranassoziierte AAA-ATPasen sind. Die ATPase-Untereinheiten nutzen die Energie der Adenosintriphosphat (ATP)-Bindung und Hydrolyse, um die Energie bereitzustellen, die für die Translokation von Substraten durch Membranen entweder für die Aufnahme oder den Export des Substrats benötigt wird.

Die meisten Aufnahmesysteme haben auch einen extrazytoplasmatischen Rezeptor, ein Bindungsprotein für gelöste Stoffe. Einige homologe ATPasen funktionieren in nicht-transportbezogenen Prozessen wie der Translation von RNA und der DNA-Reparatur. [4] [5] ABC-Transporter werden aufgrund der Ähnlichkeiten in der Sequenz und Organisation ihrer ATP-bindenden Kassetten (ABC)-Domänen als eine ABC-Superfamilie angesehen, obwohl sich die integralen Membranproteine ​​anscheinend mehrere Male unabhängig entwickelt haben, und umfassen somit verschiedene Proteinfamilien. [6] Wie die ABC-Exporteure ist es möglich, dass sich auch die integralen Membranproteine ​​von ABC-Aufnahmesystemen aufgrund ihrer hochaufgelösten dreidimensionalen Strukturen mindestens dreimal unabhängig voneinander entwickelt haben. [7] ABC-Aufnahmeträger nehmen eine Vielzahl von Nährstoffen, biosynthetischen Vorläufern, Spurenmetallen und Vitaminen auf, während Exporteure Lipide, Sterole, Medikamente und eine Vielzahl von primären und sekundären Metaboliten transportieren. Einige dieser Exporteure beim Menschen sind an Tumorresistenz, Mukoviszidose und einer Reihe anderer erblicher Erkrankungen des Menschen beteiligt. Eine hohe Expression der Gene, die einige dieser Exporteure kodieren, sowohl in prokaryontischen als auch eukaryontischen Organismen (einschließlich des Menschen) führt zur Entwicklung von Resistenzen gegen mehrere Medikamente wie Antibiotika und Antikrebsmittel.

Hunderte von ABC-Transportern wurden sowohl von Prokaryoten als auch von Eukaryoten charakterisiert. [8] ABC-Gene sind für viele Prozesse in der Zelle essentiell, und Mutationen in menschlichen Genen verursachen oder tragen zu mehreren genetischen Erkrankungen des Menschen bei. [9] Beim Menschen wurden 48 ABC-Gene beschrieben. Von diesen wurden viele charakterisiert und in kausalem Zusammenhang mit Erkrankungen des Menschen wie Mukoviszidose, Adrenoleukodystrophie, Stargardt-Krankheit, arzneimittelresistenten Tumoren, Dubin-Johnson-Syndrom, Byler-Krankheit, progressiver familiärer intrahepatischer Cholestase, X-chromosomaler Sideroblasten Anämie, Ataxie und persistierende und hyperinsulimenische Hypoglykämie. [8] ABC-Transporter sind auch an multipler Arzneimittelresistenz beteiligt, und so wurden einige von ihnen erstmals identifiziert. Wenn die ABC-Transportproteine ​​in Krebszellen überexprimiert werden, können sie Krebsmedikamente exportieren und Tumore resistent machen. [10]


Materialen und Methoden

Herstellung von vernetzenden Substraten

Das Plasmid pET21b-pS-protA, das das pS-protA-Präprotein codiert, wurde wie zuvor beschrieben konstruiert (Schnell und Blobel, 1993). Das pFd-protA-1 codierende Plasmid pET21b-pFd-protA-1 wurde durch PCR-gerichtete Mutagenese von pET-pFd-protA (Ma et al., 1996) mit Primern erzeugt, die die folgenden Veränderungen in die pFd-codierende Region einführten: a Methionin zu einer Cysteinumwandlung an Position −1 und einer Glutamat-Phenylalanin-Insertion an Position +4. Der Rest der pFd-protA-1-Sequenz war mit pFd-protA identisch (Ma et al., 1996). Das Plasmid pET21b-pS-protA-1, das für pS-protA-1 kodiert, wurde durch PCR-gerichtete Mutagenese von pET21b-pS-protA erzeugt, um das Cystein an Position –1 in Serin zu ändern. Der Rest der pS-protA-1-Sequenz war mit pS-protA identisch. Das Plasmid pET21b-pS-protA-2, das für pS-protA-2 kodiert, wurde durch PCR-gerichtete Mutagenese von pET21b-pS-protA-1 mit Primern erzeugt, die die folgenden Änderungen einführten: eine Umwandlung von Valin in Glutamat an Position +39 und die Eliminierung von das Cystein an Position +41. Der Rest der pS-protA-2-Sequenz war mit pS-protA-1 identisch.

Die Polypeptide pS-protA, pS-protA-1, pS-protA-2 und pFd-protA-1 wurden in Escherichia coli BL21 (DE3) mit COOH-terminalen Erweiterungen von sechs Histidinresten. Die Präproteine ​​wurden aus Extrakten durch Affinitätschromatographie auf einer Nickel-Chelat-Matrix gemäß den Empfehlungen des Lieferanten (Novagen, Inc., Madison, WI) gereinigt.

Die Iodierung des heterobifunktionellen Vernetzungsreagenzes, n-[4[(P-azidosalicylamido)butyl]-3'(2-pyridyldithio)propionamid (APDP Pierce, Inc., Rockford, IL) und die Kopplung von [ 125 I]APDP an Präproteine ​​wurden wie zuvor beschrieben durchgeführt (Ma et al., 1996). Das Molverhältnis von [ 125 I]APDP zu Cysteinresten für jedes Präprotein betrug bei allen Kupplungsreaktionen 1,5:1. Die vernetzenden Substrate wurden bei –80°C in 0,1 M NaHCO . gelagert3, pH 9,0, enthaltend 8 M Harnstoff.

Chloroplastenisolierung und -subfraktionierung

Intakte Chloroplasten wurden aus 10- bis 14-d-alten Erbsenkeimlingen isoliert (Pisum sativum Variante Green Arrow) durch Homogenisierung und Percoll-Silicagel-Gradientenzentrifugation, wie zuvor beschrieben (Pain und Blobel, 1987). Isolierte Chloroplasten wurden in 50 mM Hepes-KOH, pH 7,7, 0,33 M Sorbitol (HS-Puffer) auf eine Konzentration entsprechend 2 bis 3 mg Chlorophyll/ml resuspendiert.

Um Chloroplastenhüllenmembranen herzustellen, wurden intakte Chloroplasten unter hypertonischen Bedingungen lysiert und durch Differentialzentrifugation, wie von Keegstra und Yousif (1986) beschrieben, in lösliche Fraktionen und Membranfraktionen getrennt. Die Gesamtmembranfraktion wurde in Hüll- und Thylakoidmembranfraktionen durch Flotation in lineare Saccharosegradienten, wie zuvor beschrieben (Schnell et al., 1994), getrennt.

Vorläuferbindungs- und Vernetzungsreaktionen

Isolierte intakte Chloroplasten wurden in HS-Puffer, der 50 mM KOAc, 4 mM MgOAc (Importpuffer) enthielt, in Gegenwart von 400 nM Nigericin für 15 min bei 26°C im Dunkeln inkubiert, um ihnen endogenes ATP zu entziehen. Alle Bindungsreaktionen wurden im Dunkeln unter Verwendung von Chloroplasten durchgeführt, die 2 mg Chlorophyll in einem Reaktionsvolumen von 1 ml entsprechen. Für die Bindung des Vorläufers in Abwesenheit von ATP (energieunabhängige Bindung) wurden während der ATP-Abreicherungsreaktion 20 U Apyrase (Sigma Chemical Co., St. Louis, MO) zu der Chloroplastensuspension gegeben. Für die Bindung des Vorläufers in Gegenwart von ATP (Early Import Intermediate) wurden ATP-abgereicherte Chloroplasten in Gegenwart von 0,1 mM MgATP und 0,1 mM MgGTP 5 min bei 26°C inkubiert. Für die Importreaktionen wurden ATP-abgereicherte Chloroplasten in Gegenwart von 2 mM MgATP für 5 min bei 26°C inkubiert. Nach den Vorbehandlungen wurde Harnstoff-denaturiertes Präprotein bis zu einer Endkonzentration von 200 nM zugegeben und die Inkubation wurde für 10 min (energieunabhängige Bindung und frühes Importzwischenprodukt) oder 20 min (spätes Importstadium) bei 26°C fortgesetzt. Die Chloroplasten wurden in die untere Hälfte einer Glas-Petrischale auf Eis überführt und von oben mit einem Chromato-vu-Transilluminator (UVP, Inc., Upland, CA) bei 312 nm im Abstand von 5 cm für 20 min unter konstantem Schütteln bestrahlt . Die Thermolysin-Behandlung von intakten Chloroplasten wurde wie zuvor beschrieben (Cline et al., 1984) unter Verwendung von 0,1 mg Thermolysin/ml für 30 Minuten auf Eis durchgeführt. Die Chloroplasten wurden durch Zentrifugation für 30 s bei 6.000 . gesammelt g in einer Mikrozentrifuge, subfraktioniert wie oben beschrieben, und die Hüllfraktionen wurden durch SDS-PAGE analysiert.

Probenanalyse und Quantifizierung

Alle vernetzten Proben wurden durch SDS-PAGE auf 12% Polyacrylamidgelen aufgelöst. Die radioaktiven Signale in getrockneten Gelen wurden unter Verwendung eines Phosphorimager SI (Molecular Dynamics, Inc., Sunnyvale, CA) mit dem IPLab-Programm zur wissenschaftlichen Gel-Bildverarbeitung Version 1.5c (Signal Analytics, Wien, VA) erfasst und quantifiziert. Alle Bilder von radioaktiven Gelen wurden mit der IP-Labgel-Software aufgenommen. Bildetiketten wurden unter Verwendung der Software Canvas Version 2.1 (Deneba Systems, Inc., Miami, FL) hinzugefügt, und die Bilder wurden auf einem XLS 8600 PS-Drucker (Kodak, Rochester, NY) gedruckt.


Materialen und Methoden

Klonierung von Fusionsproteinen und zielgerichtete Mutagenese

Die kodierende Sequenz des menschlichen HMGA1a wurde aus 2 µl revers transkribierter HepG2-RNA unter Verwendung der Primer 5' ATGAGTGAGTCGAGCTCGAAGTCCAGC 3' und 5' ACTGCTCCTCCTCCGAGGACTCC 3' (Interactiva) PCR-amplifiziert. Dieses und alle anderen PCR-Produkte wurden durch TOPO™TA-Klonierung gemäß den Anweisungen des Herstellers (Invitrogen) subkloniert. Die HMGA1-cDNA war dann ÖkoRI inseriert in oder pEGFPN1 (Clontech).

Die ortsgerichtete Mutagenese von humanem HMGA1a wurde im Wesentlichen wie im QuickChange® Site-Directed Mutagenesis Kit Protocol (Stratagene) beschrieben durchgeführt. Für die Mutation der hHMGA1a-Phosphorylierungsstellen wurden Alanin-Codon-Substitutionen an den Nukleotiden eingeführt, die für die Aminosäure Threonin an den Positionen 21 (T21A), 53 (T53A) und 78 (T78A) der hHMGA1a-Proteinsequenz kodieren, wie an anderer Stelle berichtet (Siino et al. , 1995).

AT-Hook-Punktmutationen wurden durch Glycin-Substitution des Arginin-Codons nach dem zentralen Glycin-Codon des konservierten AT-Hook-Motivs PRGRP an den Positionen 28 (R28G), 60 (R60G) und 86 (R86G) eingeführt. Die folgenden Primer (Thermo Hybaid) wurden jeweils in den PCR-Reaktionen verwendet: R28G 5′ CGGGGCCGGGGCGGGCCGCGCAAGCAG 3′ R28G Reverse 5′ CTGCTTGCGCGGCCCGCCCCGGCCCCG 3′ R60G 5′ CCTAAGAGACTCTCGGGGCGGACCAAAGGGAAGC 3′ R60G Reverse 5′ GGCCTTCCG Reverse 5′ GGCGACTGCCGCCAGACGGAAAG 3 R60G Reverse 5′ GGCGACTG 5′ CTCCAGTTTTTTGGGTCCGCCCCTTGGTTTCCTTCC 3′. Kombinationen von Mutationen wurden sequentiell hergestellt. Abgeleitete Klone wurden durch Sequenzierung verifiziert.

Transfektion und Zellbehandlungen

HepG2-Zellen wurden unter Verwendung von Effekten (Quiagen) und 400 ng Plasmid-DNA, wie vom Hersteller angegeben, vorübergehend transfiziert. Transfizierte Zellen wurden über Nacht bei 37 °C und 5 % CO . auf Deckgläsern gezüchtet2 bis 50% Konfluenz. Die Transfektionsrate betrug mindestens 50 %, routinemäßig jedoch mehr als etwa 60 %. Die Expression von HMGA1a-GFP beeinträchtigte das Zellwachstum über mehrere Zellzyklen nicht. Zur Chromatinacetylierung wurden die Zellen mit 500 ng/ml Trichostatin A (TSA, Calbiochem) 2 Stunden lang inkubiert. Roscovitin (25 µM, Calbiochem) wurde 4 Stunden inkubiert. Ein zelldurchlässiger spezifischer Inhibitor für Proteinkinase C, Myristoyl-Phe-Ala-Arg-Lys-Gly-Ala-Leu-Arg-Gln-OH (ICN Biomedicals), wurde bei 10 &mgr;g/ml 4 Stunden lang verwendet.

Live-Cell-Imaging und FRAP-Analysen

Für die Bildgebung von lebenden Zellen wurden Zellen auf Deckgläsern gezüchtet, die auf einer Objektträgerkammer mit Kulturmedium angebracht wurden. Die Zellen wurden innerhalb der folgenden 20-30 Minuten bei Raumtemperatur mit einem Leica TCS-SP analysiert. FRAP-Experimente bei 37 °C, 5 % CO2 zeigten nun Unterschiede in der Erholungskinetik im Vergleich zu denen, die bei Raumtemperatur erhalten wurden (nicht gezeigt). Zellen wurden mit der 488-nm-Laserlinie für GFP eines Ar/Kr-Lasers analysiert (488 nm: 18 mW Nennleistung, Pinhole-Einstellung bei 1 568 nm: 17 mW Nennleistung, Pinhole-Einstellung bei 1, ×40 Neofluar-Objektiv, NA 1.25). Zum Bleichen wurde ein einzelner Scan aufgenommen, gefolgt von einem einzelnen Bleichimpuls von 1 Sekunde unter Verwendung eines Flecks mit einem Radius von ungefähr 1 µm ohne Bildgebung. Für die Bildgebung wurde die Laserleistung auf 4% der Bleichintensität abgeschwächt. Einzelschnittbilder wurden dann in Intervallen von 1 Sekunde (20 Bilder), Intervallen von 2 Sekunden (10 Bilder), Intervallen von 5 Sekunden (10 Bilder) und in Intervallen von 10 Sekunden (20 Bilder) aufgenommen. Um Chromosomenbewegungen in mitotischen Zellen zu reduzieren, wurden FRAP-Experimente in Gegenwart von 10 μM Taxol durchgeführt. Der durchschnittliche Fluoreszenzverlust während der Bildgebung betrug 2-3%. FRAP-Wiederherstellungskurven wurden nach Phair und Misteli (Phair und Misteli, 2000) aus vom Hintergrund subtrahierten Bildern erzeugt. Die quantitativen Werte repräsentieren Durchschnittswerte von mindestens 10 Zellen aus drei unabhängigen Experimenten. Als Standards verwendeten wir GFP, H3-GFP und fixierte Zellen. Aufgrund des Beitrags des elektronischen Rauschens im Detektorsystem wurden einige Wiederfindungen beobachtet, die größer als 100% waren. Studenten T-Test wurde verwendet, um die statistische Signifikanz der Ergebnisse zu bestimmen.

Fluoreszenzmikroskopie und native Chromosomenspreads

Zur DNA-Gegenfärbung mit Hoechst 33258 wurden transfizierte Zellen kurz mit 0,1 % Triton 1 Minute permeabilisiert und dann in 2 % Formaldehyd in PBS 10 Minuten bei Raumtemperatur fixiert. Die Zellen wurden dann mit 100 &mgr;l 0,1% Triton X-100 in PBS für 10 Minuten bei Raumtemperatur permeabilisiert und Hoechst 33258 wurde in einer Endkonzentration von 500 ng/ml zugegeben. Die Zellen wurden gewaschen und wie beschrieben in Mowiol montiert (Hock et al., 1998). Hoechst-gefärbte Zellen wurden mit einem konfokalen Laser-Scanning-Mikroskop unter Verwendung der 364 nm Laserlinie eines Kr/Ar-Lasers (Zeiss 510) oder auf einem Zeiss Axiophot, ausgestattet mit einem Pixera-Digitalsystem, untersucht. Das Immunfluoreszenzverfahren an formaldehydfixierten Zellen war im Wesentlichen wie zuvor beschrieben (Hock et al., 1998). Primäre Antikörper, die für Immunfluoreszenzexperimente verwendet wurden, waren Anti-HMGA1 (Geschenk von Ray Reeves), Anti-sc35 (Verdünnung 1:2000 Sigma) und Anti-Histon H1 (Verdünnung 1:20 ICN). Die Verbreitung der nativen Chromosomen erfolgte im Wesentlichen wie beschrieben (Christensen et al., 2002).

DNA-Färbung, Transkription und Salzextraktion in situ

Für die in situ-DNA-Färbung mit Hoechst wurden transfizierte Zellen mit 0,05% Triton X-100 in PBS mit 10 &mgr;g/ml Hoechst permeabilisiert. Die Zellen wurden 2–5 Minuten inkubiert und sofort überwacht. Längere Exposition gegenüber Hoechst führte zur Verdrängung von HMGA1a-GFP.

In-situ-Run-on-Transkription wurde wie zuvor beschrieben durchgeführt (Hock et al., 1998). Nach dem BrUTP-Einbau wurden die Zellen wie oben beschrieben fixiert und permeabilisiert. Eingebautes BrUTP wurde unter Verwendung von anti-BrdUTP (Roche, Mannheim, 1:25 verdünnt) nachgewiesen. Optische Schnitte wurden mit einem Leica TCS-SP unter Verwendung des ×40 Neofluar-Ölimmersionsobjektivs (N.A. 1,25) mit einer Lochblende von 0,8 und AOTF für 488 nm bei 35 % und AOTF für 568 nm bei 50 % aufgenommen. Fluoreszenzsignale von GFP und Texas-Rot wurden gleichzeitig aufgezeichnet. Parallel dazu wurden dichromatische Bilder aufgenommen. Es wurde kein Übersprechen beobachtet.

Für die in situ-Salzextraktion wurden auf Deckgläsern gewachsene Zellen zweimal in PBS gewaschen und in 3 ml Zytoskelettpuffer [CSK 100 mM NaCl, 300 mM Saccharose, 10 mM Pipes, pH 6,8, 3 mM MgCl . inkubiert2, 0,5% Triton X-100, 1 mM PMSF, Leupetin, Pepstatin, Bestatin und RNasin (MBI)] für 10 Minuten bei 4°C.CSK wurde durch Pipettieren entfernt und die Zellen wurden in 2% Formaldehyd fixiert oder weiter zur Salzextraktion in 3 ml CSK mit 350 mM NaCl für 5 Minuten bei 4°C inkubiert oder mit DNase I in Verdauungspuffer [wie CSK aber mit 50 mM NaCl und 20 U/ml RNasin (MBI) und 200 U/ml DNase I (Roche)] für 30 Minuten bei Raumtemperatur. Die Zellen wurden dann fixiert und für Immunfluoreszenzanalysen wie oben beschrieben verarbeitet.

Elektronenmikroskopie

Die Lokalisierung von HMGA1a-GFP auf ultrastruktureller Ebene wurde im Wesentlichen wie zuvor beschrieben (Hock et al., 1998) unter Verwendung von monoklonalen Antikörpern gegen GFP (Roche) in einer Konzentration von 3 µg/ml und sekundären Antikörpern, die an 12 nm Goldpartikel gekoppelt sind (Dianova, verdünnt 1 :10).

Western Blot-Analysen und Salzextraktion von Proteinen

Um die Salzextraktionseigenschaften von HMGA1a-GFP-Fusionsproteinen zu testen, wurden HepG2-Zellen mit humanem HMGA1a-GFP oder GFP als Kontrolle transfiziert, zweimal mit PBS gewaschen und dann mit PBS mit 0,5% Triton X-100 oder PBS mit 350 mM Salz inkubiert und 0,5% Triton X-100 für 10 Minuten bei Raumtemperatur. Überstände wurden gesammelt und solubilisiert. Proteine ​​wurden mit eiskaltem Aceton ausgefällt. Die ausgefällten Proteine ​​wurden zweimal mit 70 % Aceton gewaschen, luftgetrocknet und in SDS-Probenpuffer resuspendiert.

SDS-PAGE und Übertragung auf Nitrocellulose wurden wie zuvor beschrieben durchgeführt (Hock et al., 1998). Die Verdünnung der primären Antikörper für Immunoblots betrug 0,2 µg/ml für Anti-GFP (Roche), 0,5 µg/ml für Anti-HMGA1a (Santa Cruz), 0,3 µg/ml Anti-pep2 (Hock et al., 1998). Der gegen Aktin gerichtete monoklonale Antikörper (Gonsior et al., 1999) wurde in einer Verdünnung von 1:1000 verwendet. Die Blockierung und Inkubation wurde in 5% fettfreier Trockenmilch/TBS für 1 Stunde bei Raumtemperatur durchgeführt, mit Ausnahme des HMGA1-Antikörpers, wo die Blockierung in TBS plus 0,1% Tween-20 erfolgte. Waschen und Nachweis wurde wie beschrieben durchgeführt.


Materialen und Methoden

Tierhaltung.

Diese Studie wurde vom Institutional Animal Care and Use Committee der University of Washington überprüft und genehmigt. Männliche, 36 bis 37 Monate alte CB6F1 (BL/6: BalbC)-Mäuse wurden von der gealterten Mauskolonie des National Institute of Aging erhalten. Alle Mäuse wurden in einem 14/10 Hell/Dunkel-Zyklus bei 21°C gehalten und erhielten vor oder nach experimentellen Verfahren Standard-Mausfutter und Wasser ad libitum ohne Abweichung. Die Tiere wurden durch zervikale Dislokation ohne Betäubung getötet.

Gewebeextraktion, mitochondriale Isolierung und SS-31-Behandlung.

Am Tag der Tiertötung wurde das Herz (120 bis 150 mg Nassgewicht) reseziert. Das ganze Herz wurde auf Eis in einem Glas-Dounce-Homogenisator in 2 ml eiskaltem Atmungspuffer (RB, 1 mM EGTA, 5 mM MgCl2, 105 mM K-MES, 30 mM KCl, 10 mM KH .) homogenisiert2Bestellung4, pH 7,1). Die Homogenate wurden 10 min bei 800 × zentrifugiert g bei 4 °C. Die Überstände wurden gesammelt und 15 min bei 8.000 bis 10.000 × zentrifugiert g bei 4 °C. Nach Entfernung des Überstands wurde das Pellet in Isolationsmedium resuspendiert. Das Pellet wurde 15 min bei 8.000 bis 10.000 × zentrifugiert g bei 4 °C und in Isolationsmedium resuspendiert. Mitochondriale Pellets wurden in neue Zentrifugenröhrchen aufgetrennt und mit 200 &mgr;l RB, 10 mM Pyruvat und 2 mM Malat verdünnt. Den Mitochondrien wurde entweder Elamipretid oder 2 µl Kochsalzlösung zugesetzt und 1 h bei Raumtemperatur unter leichtem Schütteln inkubiert.

Ex-vivo- und In-vivo-Funktionsassays.

Mitochondriale Atmung und H2Ö2 Die Produktion wurde in Mitochondrien untersucht, die aus jungen (5 bis 7 Monate alten) und alten (36 bis 37 Monate alten) Mäuseherzen oder Gastrocnemius-Muskeln isoliert wurden, wie oben beschrieben, entweder in Gegenwart oder Abwesenheit von 10 μM bSS-31 , unter Verwendung eines Oxygraph 2K Dual-Repirometers/Fluorometers (Oroboros Instruments). Um die In-vivo-ADP-Sensitivität zu bewerten, haben wir Daten von Siegel et al. (30). Mitochondriales Superoxid wurde durch das Verhältnis von mitoSOX zu mitoTrackerGreen unter Verwendung von Leica SP8X konfokaler Mikroskopie quantifiziert. Weitere Details zu diesen Assays finden Sie in SI-Anhang, SI-Materialien und -Methoden.

Vernetzungsreaktion.

Der Vernetzer Amid-DP-NHP (Synthese beschrieben in SI-Anhang, SI-Materialien und -Methoden) wurde in einer Endkonzentration von 10 mM (aus einer 270 mM Stammlösung) zu Mitochondrien, die mit bSS-31 inkubiert wurden, zugegeben. Das Reaktionsgemisch wurde 30 min bei Raumtemperatur bei 800 U/min gemischt. Insgesamt wurden fünf vernetzte Proben erzeugt, einschließlich vier biologischer Replikate von Mausherz-Mitochondrien, die mit bSS-31 inkubiert wurden, und einer negativen Kontrollprobe, zu der kein bSS-31 hinzugefügt wurde. Nach der Vernetzung wurden die Proben bei –80 °C eingefroren.

Vernetzte mitochondriale Probenvorbereitung.

Vernetzte mitochondriale Proben wurden mit 8 M Harnstoff in 0,1 M NH . lysiert4HCO3. Das extrahierte Protein wurde mit Trypsin verdaut und die vernetzten bSS-31-Peptide wurden mit monomerem Avidin angereichert, wie im Detail in beschrieben SI-Anhang, SI-Methoden und Materialien.

LC-MS-Analyse von vernetzten Peptidpaaren.

Die Proben wurden durch LC-MS unter Verwendung von zwei Methoden analysiert, die für die Analyse von vernetzten Peptidpaaren entwickelt wurden, nämlich ReACT (33) und Mango (34). Die ReACT-Analyse wurde auf einem Velos-FTICR (Fourier-Transform-Ionen-Zyklotron-Resonanz)-Massenspektrometer in Verbindung mit einem Waters nanoAcquity UPLC (Ultra Performance Liquid Chromatography) durchgeführt.

Die Proben wurden von Mango unter Verwendung eines Thermo Q-exactive plus Massenspektrometers in Verbindung mit einem Thermo Easy nLC analysiert. Sehen SI-Anhang, SI-Materialien und -Methoden für Details zu LC-MS.

Datenanalyse.

LC-MS-Datendateien im .RAW-Format wurden mit dem ReADW-Tool in der Trans Proteomic Pipeline-Softwaresuite in das .mzXML-Format konvertiert (93). Comet (94) wurde verwendet, um die .mzXML-Dateien gegen die Mitocarta 2-Datenbank (39) zu durchsuchen, die sowohl Vorwärts- als auch Rückwärtsproteinsequenzen (2.084 Gesamtsequenzen) zusammen mit der Hinzufügung der Sequenz für bSS-31 (Biotin-D-Arg- Dimethyl-Tyr-Lys-Phe-NH2). Details siehe SI-Anhang, SI-Materialien und -Methoden.

Molekulares Docking.

Ein molekulares Modell für bSS-31 wurde mit Avogadro (v. 1.2.0) unter Verwendung einer molekularmechanischen Konformersuche von 1.000 Konformeren gefolgt von geometrischer Optimierung erstellt. PatchDock (35) wurde verwendet, um das Modell von bSS-31 mit Strukturmodellen in der PDB für mit bSS-31 interagierende Proteine ​​anzudocken (AATM = PDB: 3pdb, ADT c-state = PDB: 2c3e, ADT m-state = PDB: 6gci , ATPA/ATPB = PDB: 5ARA, QCR2/QCR6 = PDB: 1sqp, NDUA4 = PDB: 5z62, ECHA = PDB: 6dv2, IDHP = PDB: 5h3f und KCRS = PDB: 1crk). Clustal Omega (36) wurde verwendet, um jedes Mausprotein mit homologen Strukturen anderer Spezies auszurichten. Für jedes Protein wurden die 10 am besten bewerteten angedockten Modelle von PatchDock heruntergeladen und die Interaktionsschnittstelle mit bSS-31 wurde als die Aminosäurereste innerhalb von 5 des Oberflächenvolumens definiert, die die Atompositionen von bSS-31 einkapseln.

Datenverfügbarkeit.

Alle in diesem Artikel vorgestellten biotinylierten SS-31-Quervernetzungsdaten sind in der Datenbank XLinkDB verfügbar unter: xlinkdb.gs.washington.edu/xlinkdb/BiotinylatedSS31_Bruce.php. Die LC-MS-Daten wurden im PRIDE-Archiv (https://www.ebi.ac.uk/pride/archive) mit der Zugangs-Nr. PXD019484.


Ein struktureller Überblick über menschliche DDX-Helikasen, die an der COV-Interaktion beteiligt sind

Humane DDX-Helikasen gehören zur DEAD-Box-Proteinfamilie, der größten Familie der Superfamilie 2 (SF2)-Helikasen (Byrd und Raney, 2012). Sie teilen sich einen hochkonservierten Helikase-Kern, der aus zwei RecA-ähnlichen Domänen (D1 und D2) besteht, die über eine flexible Linker-Region verbunden sind (Hilbert et al., 2009). Diese beiden Domänen, auch als DEAD-Domäne und Helikase-Domäne bekannt, sind durch das Vorhandensein von neun konservierten Motiven Q, 1, 1a, 1b, II, III, IV, V und VI sowie dem gemeinsamen Tetrapeptid (Asp-Glu -Ala-Asp) in Motiv II (Abbildung 5A). In vielen DEAD-Box-Helikasen sind die D1D2-Domänen mit unterschiedlichen flankierenden Regionen oder Hilfsdomänen verknüpft, deren Länge von wenigen bis zu mehreren hundert Aminosäuren reicht (Rudolph und Klostermeier, 2015). Diese variablen N-terminalen und C-terminalen Domänen tragen zur funktionellen Vielfalt dieser Proteinfamilie bei und lenken einzelne Helikasen über Protein- oder RNA-Interaktion oder durch Modulieren der Aktivität des Helikasekerns zu ihren Zielen (Del Campo und Lambowitz, 2009 Mallam et al., 2011 Ferrage et al., 2012 Rudolph und Klostermeier, 2015). Strukturstudien zu DDX-Helikasen, die in den Tabellen 2, 3 berichtet werden, konzentrieren sich hauptsächlich auf den Helikase-Kern oder isolierte Hilfsdomänen mit wenigen Strukturen von Volllängen-Helikasen. Dennoch liefert der konservierte Fleck im Kern der Helikasen wichtige Erkenntnisse über ihre Aktivität. In DDX-Proteinen sind die beiden RecA-ähnlichen Domänen sowohl für die RNA-Bindung als auch für die ATP-Hydrolyse verantwortlich (Hilbert et al., 2009). Insbesondere sind die konservierten Motive Q, I (P-Schleife), II und VI an der ATP-Bindung beteiligt und das Hydrolysemotiv III ist für die Kopplung der NTP-Hydrolyse an die Nukleinsäure-Entwindung verantwortlich, und die Motive Ia, Ib, IV und V sind an . beteiligt RNA-Bindung (Abbildung 5) (Hilbert et al., 2009).

Abbildung 5. (A) Typische Domänenorganisation von DDX-Helikasen. Die Motive sind entsprechend ihrer Hauptfunktion eingefärbt (rot, ATP-Bindung und Hydrolyse gelb, Koordination zwischen NTP- und RNA-Bindungsstellen blau, RNA-Bindung). (B) Cartoon-Darstellung, die Domänenbewegungen in DDX-Helikasen bei RNA-Bindung des DEAD-Box-Proteins eIF4AIII ohne RNA (links) und im Komplex mit RNA (rechts) zeigt. Ein RNA-Fragment und AMPPNP sind in Stickdarstellung in Grün bzw. in Cyan dargestellt.

Tabelle 2. Strukturelle Ähnlichkeit von SARS-CoV-2 Nsp13 mit humanen DDX-Helikasen, wie von DALI berechnet.


Energetische Umverteilung in der Allosterie zur Ausführung der Proteinfunktion

Eine Störung an einer Stelle des Proteins könnte eine Wirkung an einer entfernten Stelle hervorrufen. Dieses wichtige biologische Phänomen, das als „allosterischer Effekt“ bezeichnet wird, ist für die Proteinregulation und die Zellsignalisierung essentiell und spielt eine wichtige Rolle bei der Zellfunktion. Seine grundlegende funktionelle Bedeutung hat zahlreiche Arbeiten inspiriert, die darauf abzielen, die Funktionsweise der Allosterie zu verstehen. Allosterie kann große oder unbeobachtete, subtile (hauptsächlich Seitenketten-) Konformationsänderungen beinhalten (1). Konformationsänderungen werden durch die Enthalpie getrieben. Der Begriff „dynamische Allosterie“ wurde in den frühen 1980er Jahren von Cooper und Dryden geprägt, um Allosterie „auch ohne makromolekulare Konformationsänderung“ zu beschreiben (2). Cooper und Dryden argumentierten, dass die dynamische Allosterie in erster Linie ein Entropieeffekt ist. In den letzten 20 Jahren wurden jedoch zahlreiche Arbeiten veröffentlicht, bei denen die „dynamische Allosterie“ als Hinweis auf das völlige Fehlen von Konformationsänderungen angenommen wurde, da die Autoren solche Änderungen nicht beobachteten (1). Wichtig ist, dass die „dynamische Allosterie“ ohne beobachtbare Konformationsänderungen immer noch von einer Populationsverschiebung zwischen zwei „verschiedenen“ Zuständen beherrscht wird, in denen eine neue energetische Umverteilung, die für den allosterischen (funktionellen) Zustand günstig ist, entweder von Entropie, Enthalpie oder beidem dominiert wird. Nur wenige Studien hinterfragten, ob die Enthalpie auch bei der dynamischen Allosterie eine Rolle spielt (1). In PNAS demonstrieren Kumawat und Chakrabarty (3), dass die Enthalpie tatsächlich sogar bei der dynamischen Allosterie eine Rolle spielt, indem sie bei Störung interne Energien, insbesondere elektrostatische Wechselwirkungsenergien, zwischen den Resten umverteilt (Abb. 1).

Das Schema der elektrostatischen Basis der dynamischen Allosterie im PDZ3-Domänenprotein. Dynamische Allosterie weist keine signifikante Konformationsänderung auf. Bei der Bindung des Peptids (CRIPT) gibt es keine signifikante Enthalpieänderung, aber Kumawat und Chakrabarty (3) berichteten über eine Umverteilung der elektrostatischen Energien. Eine solche Umverteilung kann sich auf andere PDZ-Domänen ausbreiten, damit die Proteine ​​ihre Funktion ausführen können.

Elektrostatik ist ein etablierter Player in der Funktion. Vor Jahrzehnten haben Warshel (4) und Warshel et al. (5) demonstrierte seine entscheidende Rolle bei der Proteinkatalyse und Perutz (6) bei der Allosterie. Kürzlich wurde über Umlagerungen elektrostatischer Netzwerke für konformativ gesteuerte Allosterie berichtet (7, 8). Der Bericht über versteckte elektrostatische Wechselwirkungen in der dynamischen Allosterie in PNAS (3) argumentiert, dass die Umverteilung der elektrostatischen Wechselwirkungsenergie in allosterischen Proteinen mit oder ohne signifikante Konformationsänderung universell sein könnte.

Proteine ​​nutzen die Umverteilung elektrostatischer Wechselwirkungsenergien, um ihre Funktionen auszuführen. Myosin, ein Motorprotein, bindet beispielsweise an das negativ geladene ATP, das das elektrostatische Bindungsnetzwerk umverteilt, wodurch die Ladung der Aktinbindungsstelle verändert wird, was zur Dissoziation von Myosin von Aktin führt (7). Somit verteilt Myosin die elektrostatische Wechselwirkungsenergie in der Allosterie um, um seine Funktion der Dissoziation von Aktin auszuführen.

Das PDZ-Domänenprotein ist ein bekanntes Zellsignalprotein. Die Hauptfunktionen von PDZ-Domänen umfassen die Erkennung der ungeordneten C-terminalen Peptidmotive von Hunderten von Rezeptoren und Ionenkanalproteinen, die Dimerisierung mit anderen modularen Domänen und die Phospholipidbindung. Als dynamischer Regulator der Zellsignalisierung kann die PDZ-Funktion allosterisch moduliert werden (9). Im PDZ3-Domänenprotein befindet sich die Peptiderkennungsstelle in der hydrophoben β2-α2-Region. Mutationen von distalen Resten an der PDZ3-Domäne oder Deletion der distalen α3-Helix (10) beeinflussen allosterisch die Bindungsaffinität an der Erkennungsstelle, ohne eine signifikante Konformationsänderung zu verursachen. Im Gegensatz dazu verändert die Bindung des Peptids an der Erkennungsstelle die Dynamik der PDZ3-Domäne, wenn auch immer noch ohne große Konformationsänderung. Kumawat und Chakrabarty (3) zeigen mit Hilfe von Molekulardynamiksimulationen und Analyse der Proteinwechselwirkungsenergie, dass die Störung der Bindung eines Peptids in der β2-α2-Region zur Seitenkettenumlagerung bestimmter geladener Reste führt, um neue günstige elektrostatische Wechselwirkungen zu bilden . Dadurch werden einige der zuvor günstigen elektrostatischen Wechselwirkungen im ungebundenen Zustand ungünstig. Wie bei einem Dominoeffekt treten zusätzliche Seitenkettenumlagerungen auf, um diesen energetischen Stress freizusetzen, wodurch das elektrostatische und Wasserstoffbrückennetzwerk, insbesondere in den N- und C-terminalen Regionen, in Übereinstimmung mit den bekannten allosterischen Zentren verändert wird. Wie wirkt sich diese energetische Umverteilung auf die Funktion von PDZ3 aus? PDZ-Domänen sind normalerweise auf der Proteinkette sequentiell. Die energetische Umverteilung in einer PDZ-Domäne kann sich durch ein Allo-Netzwerk (11) zu einer zweiten PDZ-Domäne ausbreiten und so die Zellsignalisierung beeinflussen. Es ist schwierig, diese dramatische Energieumverteilung in Experimenten nachzuweisen, da die energetische Umverteilung die gesamte interaktive Energie aufgrund der Aufhebung der günstigen und ungünstigen Wechselwirkungen nicht ändert.

Kumawat und Chakrabarty (3) demonstrierten die verborgene elektrostatische Basis des PDZ3-Domänenproteins und stellten die Frage, ob die Umverteilung der elektrostatischen Wechselwirkung ein gemeinsames Merkmal von „dynamikgetriebenen“ allosterischen Proteinen mit geringer Konformationsänderung ist oder ob es ein einzigartiges Merkmal von . ist das PDZ3-Domänenprotein. PDZ3 erkennt das Peptid durch seine hydrophobe Tasche, aber ein positiv geladener Rest, K5, initiiert die Neuordnung des H-Brücken-Netzwerks, was zu Änderungen der elektrostatischen Wechselwirkungsenergien führt (3). Es stellt sich die Frage, ob der geladene Rest an der Bindungsgrenzfläche entscheidend für die Umverteilung der elektrostatischen Wechselwirkungsenergie ist. Beispielsweise wurde das cAMP-Katabolit-Aktivatorprotein (CAP) als ein klassisches dynamikgetriebenes allosterisches Protein angesehen. Die Bindung eines cAMP an CAP verringert die Bindungsaffinität für ein zweites cAMP allosterisch. Obwohl jedoch NMR das Fehlen einer Konformationsänderung nahelegte, deuteten nachfolgende cAMP-CAP-Kristallstrukturen (12, 13) darauf hin, dass große Konformationsänderungen für seine DNA-Bindungsfunktion notwendig sind ( 14). Interessanterweise können Mutationen von CAP, um seinen Kontakt mit cAMP zu reduzieren, diese negative allosterische Kooperativität verstärken (15). Beachten Sie, dass geladene Reste an der Interaktionsschnittstelle zwischen CAP und cAMP beteiligt sind. Man kann dann spekulieren, dass diese geladenen Reste, die durch Bindung gestört werden, eine Umverteilung der internen elektrostatischen Wechselwirkungsenergie auslösen und somit eine Rolle bei der allosterischen CAP-Funktion spielen. Es wurde auch vorgeschlagen, dass Proteinkinasen dynamikgetriebene allosterische Proteine ​​sind (16), bei denen die Allosterie durch einen dynamischen hydrophoben Kern orchestriert wird (17). Wie beim Schmetterlingseffekt kann eine einzelne Mutation bei Krebs die gesamte Zelle umbauen (18). Interessanterweise beinhalten viele der häufigen Krebsmutationen geladene Reste, wie die BRAF V600E-Krebsmutation. Dies wirft die Frage auf, ob diese Mutationen geladener Reste eine Umverteilung der inneren Energien innerhalb des Proteins und zwischen Proteinen durch Allo-Netzwerk (11)-Verschiebungen der Seitenketten auslösen, was teilweise den Schmetterlingseffekt bei Krebs erklären könnte.

Elektrostatische Wechselwirkungen sind nicht die einzige Quelle für die energetische Umverteilung. Kumawat und Chakrabarty (3) berichten, dass sowohl Van-de-Waals-Wechselwirkungen als auch H-Brücken-Netzwerke in gewissem Maße an der energetischen Umverteilung beteiligt sind. Die Energie eines Proteins repräsentiert alle potentiellen lokalen und weitreichenden Wechselwirkungen innerhalb und zwischen Resten. In einem Protein können multiple Aminosäureinteraktionsnetzwerke identifiziert werden, um verschiedene Interaktionen zu beschreiben (19). Bei einer Störung könnten ein oder mehrere Aminosäurewechselwirkungsnetzwerke in unterschiedlichem Ausmaß verändert werden und die Energie könnte umverteilt werden. Das Protein ist kein isoliertes System, sondern interagiert mit seiner Umgebung, einschließlich Wassermolekülen. Kumawat und Chakrabarty (3) stellten für bestimmte Reste eine signifikante lokale Änderung der Solvatationsumgebung fest, was darauf hindeutet, dass die energetische Umverteilung nicht nur innerhalb oder zwischen Proteinen stattfindet, sondern auch Protein-Wasser-Wechselwirkungen zur energetischen Umverteilung beitragen.

Wie können wir die elektrostatische Basis und die dynamische Basis in der dynamischen Allosterie vereinen? Frühere Studien haben die Entropie als treibende Kraft in der dynamischen Allosterie vorangetrieben. Kürzlich deuteten einige computergestützte und experimentelle Berichte darauf hin, dass das Prinzip von La Châtelier hinter der dynamischen Allosterie stehen könnte. Kalescky et al. (20, 21) berichteten, dass eine Verringerung der lokalen Entropie durch Erhöhung der Starrheit einzelner Reste von PDZ-Domänenproteinen oft zu einer Erhöhung der globalen Konfigurationsentropie führt. Kürzlich haben biophysikalische Experimente von Law et al.(22) zeigten, dass das Volumen des PDZ3-Domänenproteins mit der lokalen internen Bewegung gekoppelt ist, nach dem Prinzip von La Châtelier. Interessanterweise verringert die Deletion der α3-Helix an der distalen Stelle die Bindungsaffinität, erhöht jedoch das Proteinvolumen und die Entropie. Vom Standpunkt der energetischen Umverteilung löst der Verlust lokaler Entropie die Umverteilung der globalen Entropie aus, um den lokalen Entropieverlust auszugleichen. Somit kann die dynamische Allosterie auch als Umverteilung der Entropie angesehen werden. Die Anordnung der Seitenketten, um die Populationsverschiebung der Aminosäurenetzwerke (elektrostatische, H-verbrückte Netzwerke usw.) zu erreichen, ist jedoch ein Ergebnis der Seitenkettendynamik. Daher können wir die Enthalpie- und Entropiebasis der dynamischen und konformativen Allosterie durch Energieumverteilung vereinen und vorschlagen, dass die allosterische Funktion durch die interne Energieumverteilung bei Störung externer Energie ausgeführt werden kann. Die Beobachtungen von Kumawat und Chakrabarty (3) sind daher wichtig, um aktuelle Ansichten neu zu fokussieren. Anstatt Allosterie als entropisch oder dynamisch zu klassifizieren, argumentieren sie, dass sie für das PDZ3-Domänenprotein im Hinblick auf die interne Umverteilung und Populationsverschiebung spezifischer elektrostatischer Wechselwirkungen betrachtet werden sollte. Zukünftige Studien sollten die Allgemeingültigkeit dieser Ergebnisse und ihrer Vorhersagen für die Zellsignalübertragung und die Wirkstoffforschung untersuchen.


Teil 2: GTPase-Reaktionen und Krankheiten

00:00:00.14 Hallo. Mein Name ist Fred Wittinghofer.
00:00:02.18 Ich bin emeritierter Gruppenleiter am Max-Planck-Institut für molekulare Physiologie in Dortmund, Deutschland.
00:00:11.08 Und das ist mein zweites Seminar
00:00:14.01 und im ersten habe ich dir die molekularen Schalter vorgestellt, die GTP-bindende Proteine ​​oder G-Proteine ​​genannt werden.
00:00:21.15 Und in diesem zweiten Teil werde ich mich mehr auf einen bestimmten Aspekt unserer Forschung konzentrieren, nämlich
00:00:28.20 beschäftigt sich mit dem Mechanismus von GTPase-Reaktionen und wie sie zu verschiedenen Krankheiten führen.
00:00:34.09 Und ich werde mich natürlich hauptsächlich auf Ras-ähnliche Proteine ​​konzentrieren, über die ich in meinem ersten Seminar gesprochen habe.
00:00:42.23 Also noch einmal kurz der mechanistische Zyklus für diese Proteine:
00:00:49.25 Sie kommen in zwei Geschmacksrichtungen, diese Proteine, den GDP-gebundenen und den GTP-gebundenen Zustand.
00:00:55.13 Sie haben Nukleotide sehr fest gebunden.
00:00:58.03 Sie brauchen einen Guanin-Nukleotid-Austauschfaktor, um GDP für GTP . freizusetzen
00:01:03.23 weil in der Zelle mehr GTP als BIP vorhanden ist.
00:01:06.11 Deshalb wird das Protein mit GTP beladen, sobald das BIP ausgeschaltet ist.
00:01:10.06 Sie haben einen Downstream-Effekt in der GTP-gebundenen Form, die mit einigen Partnerproteinen interagiert.
00:01:15.10 Und damit der Schalter wieder ausgeschaltet wird, hast du die GTPase-Reaktion
00:01:20.27 wobei das Protein GTP in GDP und Pi aufspaltet.
00:01:24.29 Und diese Reaktion ist sehr langsam und wird von Proteinen katalysiert, die als GTPase Activating Proteins bezeichnet werden
00:01:31.06, was natürlich das Wichtigste sein wird, über das wir sprechen werden.
00:01:36.24 Wir reden also wirklich über eine wirklich grundlegende biochemische Reaktion
00:01:43.23 nämlich die Hydrolyse von Phosphoanhydriden und sie ähnelt der Hydrolyse von Phosphoestern.
00:01:53.08 Wenn Sie beispielsweise phosphorylierte Proteine ​​haben, die an Threonin, Serin oder Tyrosin phosphoryliert sind,
00:01:57.24 Sie haben einen ähnlichen nukleophilen Angriff auf das Phosphat durch Wasser.
00:02:05.04 Und offensichtlich haben die Leute viel über diese Reaktion gesprochen, weil es eine sehr
00:02:12.15 langsame Reaktion, da die Phosphate stark negativ geladen sind
00:02:19.16 und die Annäherung eines Nukleophils, zum Beispiel eines Wassers, das auch teilweise negativ geladen ist,
00:02:25.06 ist sehr, sehr unbeliebt. Und deshalb ist diese Reaktion normalerweise sehr langsam.
00:02:30.25 Also obwohl die Reaktion Energie liefert,
00:02:33.17 es ist sehr langsam, weil man die sehr hohe Aktivierungsenergie überwinden muss
00:02:38.16, was davon abhängt, was ich Ihnen gerade erzählt habe - die negativen Vorwürfe.
00:02:42.04 Und je höher die Aktivierungsenergie ist, kennst du vielleicht aus deinen biophysikalischen Kursen,
00:02:46.13 dass je höher die Aktivierungsenergie, desto langsamer die Reaktion,
00:02:51.00, da die Reaktionsgeschwindigkeit direkt proportional zur Aktivierungsenergie ist.
00:02:54.18 Die Natur nutzt also Enzyme, um die Übergangszustandsenergie zu senken
00:03:00.27 und beschleunigen dadurch die Reaktion.
00:03:03.15 Und es gibt einen interessanten Artikel, auf den ich meine Schüler die ganze Zeit aufmerksam mache
00:03:07.21 von Francis Westheimer, der vor vielen Jahren einen Artikel geschrieben hat:
00:03:12.01 Warum die Natur Phosphate wählt.
00:03:13.25 Weil Chemiker niemals Phosphat als Abgangsgruppe verwenden
00:03:17.13 aber in der Biologie ist es eine sehr häufige Abgangsgruppe
00:03:21.16 Also, nur wegen diesem Zweck hier, wegen dem, was ich hier gezeigt habe
00:03:26.17 die Phosphoanhydridbindung oder die Phosphoesterbindung ist kinetisch stabil
00:03:32.06 mit anderen Worten, Sie können Ihr ATP oder GTP in Wasser haben und es bleibt für immer oder hydrolysiert sehr langsam.
00:03:39.22 Aber thermodynamisch ist es grundsätzlich instabil.
00:03:43.00 Wenn Sie ein Enzym verwenden, senkt es die Aktivierungsenergie – Sie können diese Reaktion sehr schnell durchführen.
00:03:47.14 Das ist also ein interessanter Artikel, den ich dir empfehlen würde zu lesen.
00:03:50.27 Deshalb ist zum Beispiel die DNA stabil und deshalb ist ATP eine so wunderbare Energiequelle
00:03:57.12, weil es im Prinzip Energie liefert, aber in wässriger Lösung stabil ist.
00:04:03.28 Beginnen wir also zunächst mit Ras und seiner GAP-vermittelten GTPase-Reaktion, denn
00:04:10.25 das ist wirklich das Paradigma für viele Dinge, die danach entwickelt wurden.
00:04:15.24 Das ist also das molekulare Ras. Es ist eine Banddarstellung der Struktur
00:04:21.29 der G-Domäne von Ras.
00:04:24.16 Sie sehen seine Herzform, weil.
00:04:27.17 offensichtlich gefällt es uns sehr gut und wir haben die Struktur in Hiedelberg gelöst.
00:04:32.00 Die Anzeige der Stadt Hiedelberg, Ich hab mein Herz in Hiedelberg verloren
00:04:36.04 das heißt, ich habe mein Herz in Hiedelberg verloren.
00:04:37.27 Aber der wichtigste Grund, warum es herzförmig ist, ist, weil
00:04:41.13 Leute nennen es das schlagende Herz der Signalübertragung.
00:04:44.06 Und damit eines der wichtigsten Moleküle, das reguliert
00:04:48.14 wichtige Signaltransduktionsprozesse wie Wachstum, Differenzierung und manchmal sogar Apoptose.
00:04:54.17 Und Sie wissen wahrscheinlich ein wenig über den Signalübertragungsprozess, weil
00:04:59.07 jedes Lehrbuch hat diese Version, eines der Paradigmen der Signalübertragungskette
00:05:04.01 wobei z. B. ein Wachstumsfaktor an die Zellmembran bindet
00:05:08.27 und bindet an seinen Wachstumsfaktor-Rezeptor RTK (Rezeptor-Tyrosin-Kinase)
00:05:14.22 wobei diese phosphoryliert wird. Es rekrutiert den Tauschfaktor SoS
00:05:19.04, was dann Ras in der GDP-gebundenen Form aktiviert.
00:05:22.16 Und dann interagiert Ras mit der nachgeschalteten Komponente, der Raf-Kinase
00:05:26.15 Dies ist die Startkinase für das sogenannte MAP-Kinase-Modul.
00:05:30.24 Dort aktiviert eine Kinase die nächste nachgeschaltete Kinase, die als MAP-Kinase-Kinase-Kinase bezeichnet wird.
00:05:36.29 MAP-Kinase-Kinase-Kinase aktiviert die MAP-Kinase-Kinase und das aktiviert die MAP-Kinase
00:05:40.28, die dann in den Zellkern gelangt und die Transkription aktiviert.
00:05:45.03 Dies ist also eine sehr vereinfachte Version dessen, was Ras tatsächlich tut.
00:05:48.16 und dies ist die erste, die entdeckt wurde (die erste Signalübertragung).
00:05:54.15 Aber jetzt wird es immer komplizierter.
00:05:57.26 Dies ist noch eine sehr vereinfachte Version, aber sie zeigt es Ihnen bereits
00:06:00.27 Das Wichtigste an der Signalübertragung über Ras ist, dass viele vorgeschaltete Komponenten kommen und Ras aktivieren.
00:06:09.18 Es sind entweder Tyrosinkinase-Rezeptoren oder G-Protein-gekoppelte Rezeptoren
00:06:13.09 oder T-Zell-Rezeptoren. Alle können Ras aktivieren.
00:06:16.08 Und dann kann Ras stromabwärts viele Komponenten aktivieren, nicht nur Raf-Kinase
00:06:20.18, sondern auch ein Molekül namens Ral GEF, PI(3)-Kinase, PLC-Epsilon und andere.
00:06:26.22 Und sie vermitteln eine Reihe von Signalübertragungsreaktionen
00:06:32.12 die irgendwie irgendwo integriert sind, sagen wir im Nukleus,
00:06:38.00 durch einen Transkriptionsfaktor und initiieren, wenn die Schwelle stimmt, wenn die Anzahl der Reaktionen stimmt,
00:06:46.15 es löst eine zelluläre Reaktion aus, die Proliferation oder Differenzierung oder was auch immer sein kann.
00:06:52.03 Und ich werde auf keinen Aspekt eingehen, weil ich mich auf die Abschaltreaktion konzentrieren möchte.
00:06:57.28 Die Abschaltreaktion ist also wieder das Schema, das Sie jetzt schon oft gesehen haben
00:07:03.25 aber was in Ras passiert ist auch ein Onkogen
00:07:06.26 ein Onkogen, das zwei Arten von Mutationen aufweist, entweder das Glycin 12 ist zu einer anderen Aminosäure mutiert
00:07:13.10 oder Glutamin 61 zu einer anderen Aminosäure mutiert.
00:07:16.21 Und was dies biochemisch bewirkt, ist, dass es die GAP-vermittelte GTPase-Reaktion blockiert.
00:07:23.21 Damit Sie sich vorstellen können, was passiert, haben Sie die Rückkehr in den inaktiven Zustand blockiert
00:07:29.13 und deshalb sammelst du jetzt Ras in der GTP-gebundenen Form.
00:07:33.09 Sie benötigen keine Upstream-Signalisierung mehr, da sich Ras bereits im GTP-gebundenen Zustand befindet.
00:07:39.03 Und jetzt hat es eine Wirkung, die nicht mehr reguliert wird und deshalb zu Krebs führt.
00:07:44.14 Also diese einfachen Mutationen. und deshalb natürlich als Strukturbiochemiker
00:07:49.23 Es ist ein sehr interessantes Projekt, die Frage zu stellen:
00:07:52.00 Wie kann es sein, dass eine einzelne Punktmutation so dramatische Folgen hat?
00:07:58.19 Und es ist auch. offensichtlich, da Ras das häufigste Onkogen ist.
00:08:02.28 Etwa 25% der Menschen, die mit einem Tumor in die Klinik kommen,
00:08:09.07 sie haben eine Ras-Mutation, eine von denen, die ich dir gezeigt habe. Zumindest sind dies die häufigsten.
00:08:15 Uhr Offensichtlich arbeitet also auch jedes Pharmaunternehmen daran, den Ras-Signalweg zu hemmen
00:08:20.29 und Ras-Signalisierung zur Behandlung von Ras-vermittelten Krebsarten.
00:08:25.28 Und es gibt viele Ansätze, die man sich vorstellen kann.
00:08:30.17 Ich habe hier nur ein paar angedeutet. Denken Sie zum Beispiel an Ras. ist farnesyliert
00:08:36.25 am C-terminalen Cystein und es gibt ein Enzym namens Farnesyltransferase, das diese Reaktion vermittelt.
00:08:44.18 Es gibt Farnesyltransferase-Hemmer, die gerade in der Klinik auf ihre Wirksamkeit getestet werden.
00:08:50.00 Man könnte aber auch daran denken, vielleicht die Interaktion mit nachgeschalteten Effektoren zu hemmen.
00:08:54.15 Dies ist zum Beispiel eine von uns ermittelte Struktur: der Komplex zwischen Ras und Raf-Kinase (oder einem Teil der Raf-Kinase).
00:09:00.10 Oder Sie können es sich vorstellen. und daran arbeiten wir noch.
00:09:04.21 Unser Traumansatz ist. Das grundlegende Merkmal von onkogenem Ras ist, dass es GTP nicht hydrolysieren kann.
00:09:12.09 Können wir darüber nachdenken, kleine Moleküle herzustellen, die die GTP-Hydrolyse auf onkogenem Ras induzieren?
00:09:18.21 Dies ist wahrscheinlich ein Traumprojekt und wir arbeiten noch daran, es machbar zu machen.
00:09:25.05 Aber ich werde Ihnen im Rahmen meines Seminarvortrags zeigen, warum wir es immer noch für möglich halten
00:09:32.23 ist, dass die Chemie nicht so schwierig sein sollte.
00:09:36.14 Und ich hoffe, dass ich dich überzeugen kann und du mich in diesem Punkt am Ende begleiten wirst.
00:09:40.26 Wir sprechen hier also von einem nukleophilen Angriff von Wasser auf das Gammaphosphat von GTP
00:09:49.03 von RasGAP vermittelt und es erzeugt Ras-BIP und Pi. Eine einfache biochemische Reaktion
00:09:56.09 aber wenn es nicht funktioniert, hat es sehr drastische Folgen, nämlich Krebs.
00:10:00.21 Also erst einmal (Und das Bild hast du auch schon einige Male gesehen.
00:10:05.24 Dies ist immer meine Einführungsfolie)
00:10:08.09 sind die beiden Aminosäuren, die am häufigsten mutiert sind
00:10:13.16 (beide) in onkogenen Versionen von Ras sind sie sehr nahe am aktiven Zentrum.
00:10:18.07 Sie sehen also das Nukleotid hier: das ist das Gammaphosphat
00:10:22.07 Und Sie sehen, das ist Glutamin 61 und das ist Glycin 12 sind sehr nah am aktiven Zentrum
00:10:28.10 offensichtlich, wie Sie wahrscheinlich vorhergesagt oder gedacht haben,
00:10:32.06 ist, dass sie irgendwie an der GTPase-Reaktion beteiligt sind.
00:10:35.22 Nun zeigen wir Ihnen natürlich, was sie tatsächlich tun und warum die Mutation zu einer Blockade der GTP-Hydrolyse führt.
00:10:43.08 Und Sie können hier auch eine Oberflächendarstellung des aktiven Zentrums von Ras sehen
00:10:49.12 wenn diese GTP. also sitzt es. es ist an die Oberfläche gebunden
00:10:53.26 und Sie sehen, dass das Gamma-Phosphat immer noch von außen zugänglich ist
00:10:57.03 und das wird im Zusammenhang mit dem, worüber ich sprechen werde, wichtig sein
00:11:01.12 und Sie sehen auch, ich habe letztes Mal darüber gesprochen, dass Magnesium wichtig ist.
00:11:05.20 Wenn kein Magnesium in der Nähe ist, haben Sie auch keine GTP-Hydrolysereaktion.
00:11:09.24 Wie immer in einem Säugetiergenom gibt es also nicht nur ein RasGAP, sondern 12 oder 13.
00:11:19.08 Und ich habe hier einige davon angegeben.
00:11:24.06 Und Sie sehen, sie alle enthalten eine bestimmte Domäne von etwa 330 Resten.
00:11:28.09 Dies ist die RasGAP-Domäne, die selbst in der Lage ist, die schnelle GTP-Hydrolysereaktion zu initiieren.
00:11:36.17 Und Sie sehen, dass all diese Proteine ​​aus verschiedenen Domänen bestehen.
00:11:43.03 Und einige sind ähnlich, andere sehr unterschiedlich.
00:11:45.20 Und sie regulieren offensichtlich Ras in verschiedenen Kontexten der Zelle
00:11:50.04 aufgrund ihrer unterschiedlichen Domänen, die sie zusätzlich haben.
00:11:53.15 Und ich werde über einen sprechen, den ersten RasGAP, der von Frank McCormick entdeckt wurde, nämlich P120GAP.
00:12:02.06 Und ich werde später über NF1 sprechen
00:12:05.05, was ein weiteres wichtiges Element für die Tumorbildung ist, da es ein Tumorsuppressorgen ist.
00:12:12.04 Zunächst einmal, und noch einmal, um Sie daran zu erinnern, ist die intrinsische GTP-Hydrolyse sehr langsam.
00:12:17.23 Aber wenn Sie das GTPase-aktivierende Protein hinzufügen, ist es schnell.
00:12:21.08 Also, was ich hier gemacht habe, ist radioaktives GTP (zum Beispiel mit Gamma-Kennzeichnung)
00:12:25.27 und dann messe ich die Produktion von Pi über die Zeit.
00:12:29.26 Sehen Sie, da unten ist diese Reaktion (bei Zimmertemperatur) fast vernachlässigbar.
00:12:35.14 Ohne GAP findet bei Raumtemperatur fast keine Hydrolyse von normalem Ras statt.
00:12:40.12 Und wenn Sie jetzt eine bestimmte Menge RasGAP hinzufügen, sehen Sie, dass es sehr schnell reagiert.
00:12:44.23 Viel viel schneller.
00:12:46.04 Und unter Grenzbedingungen ist es tatsächlich eine 10^5-fache Stimulation dieser Reaktion.
00:12:53.10 So wollen wir es also sehen.
00:12:57.05 Wir wollen analysieren, wie GAP diese schnelle GTP-Hydrolyse-Reaktion vermittelt.
00:13:03.14 Sie fragen sich also zunächst natürlich: Was könnte der Mechanismus der Hydrolyse sein?
00:13:10.11 und welcher Schritt wird von GAP katalysiert?
00:13:14.02 Man kann sich Ras-GTP im Prinzip als schnelles GTP-Hydrolyse-Enzym vorstellen
00:13:20.14, aber es muss durch eine Isomerisierungsreaktion in einen GTPase-kompetenten Zustand gelangen.
00:13:26.15 Und das ist sehr langsam und wird durch GAP katalysiert.
00:13:28.29 Oder Sie könnten denken, dass die eigentliche Spaltungsreaktion von GTP zu GDP Pi
00:13:35.02 ist sehr langsam und wird durch GAP katalysiert.
00:13:38.01 Oder man könnte sogar denken, dass das alles noch sehr schnell geht
00:13:41.09, aber die Freisetzung von Pi zum Produkt ist sehr langsam und wird durch GAP katalysiert.
00:13:47.08 Wenn Sie sich zum Beispiel erinnern, von der Hydrolyse von ATP auf Myosin gehört zu haben,
00:13:53.26 Myosin ist zum Beispiel eine sehr schnelle GTPase, aber die Pi-Freisetzung ist sehr langsam
00:13:59.00 und muss durch Aktin katalysiert werden.
00:14:01.04 Also, mit anderen Worten, was ist der eigentliche Schritt, der in diesem speziellen Fall von GAP katalysiert wird?
00:14:07.10 Und ich sollte sagen, dass es die Spaltungsreaktion selbst ist
00:14:11.12, der Hauptangriffspunkt des GTPase-aktivierenden Proteins
00:14:16.21 und das nur in Gegenwart von GAP die anderen Reaktionen
00:14:20.18 werden zumindest teilweise ratenbegrenzend, zumindest die Pi-Version.
00:14:24.10 Und das zeige ich dir später auch.
00:14:27.29 Und obwohl ich Ihnen das schon einmal gezeigt habe, werde ich es noch einmal wiederholen.
00:14:32.12 Also, was wir in unseren Studien, in denen wir Biochemie mit fluoreszierenden Nukleotiden betreiben, viel verwenden,
00:14:38.20 verwenden wir ein Mant- oder mGDP- oder mGTP-Analog
00:14:42.29, wo Sie auf der Ribose eine fluoreszierende Reportergruppe haben.
00:14:46.24 Das wäre also entweder Desoxy-Ribose oder Ribose und an die Ribose, die du gebunden hast
00:14:52.17 diese Esterbindungen, die Mant-Gruppe, die sehr empfindlich auf die Umgebung reagiert, in der sie sitzt.
00:14:59.19 Und deshalb gibt es immer sehr schöne bauliche Veränderungen, wie ich gleich zeigen werde.
00:15:07.10 Wir haben Stop-Flow verwendet, um schnelle Reaktionen zu messen, weil die GTPase-Reaktion,
00:15:13.29, das ohne GAP langsam ist, wird sehr schnell
00:15:17.15 und um es im Detail zu analysieren, müssen wir die Stop-Flow-Kinetik verwenden.
00:15:21.16 Also, was Sie zum Beispiel tun werden: Sie haben Ras mit dem Label
00:15:25.10 mant-GTP (also die fluoreszierende Version von GTP)
00:15:28.16 und du hast GAP und du hast sie zusammen in eine fluoreszierende Detektionsküvette geschossen
00:15:34.02 und du hast den Stopflow hier oben, um
00:15:37.17 Stellen Sie sicher, dass Sie nur eine bestimmte Menge Flüssigkeit aus diesen beiden Spritzen in Ihre Reaktionskammer geben.
00:15:44.07 Wenn wir also diese beiden Dinge zusammen gedreht haben, sehen wir, dass es da ist
00:15:50.09 eine fluoreszierende Zunahme, wenn Sie Ras-mantGTP verwenden und eine Abnahme.
00:15:54.09 Der Anstieg ist wiederum sehr schnell.
00:15:56.25 Das bedeutet, dass die beiden Proteine ​​einen Komplex bilden.
00:15:58.27 Und dann dissoziiert der Komplex mit der Zeit, weil Neurofibromin nach der Hydrolyse nicht mehr an Ras bindet.
00:16:07.18 Und das alles ist, wie man sieht, nach einer Sekunde vorbei.
00:16:10.09 Also sehr schnelle Phosphotransferreaktion in Gegenwart von sättigenden Mengen an GAP.
00:16:15.07 Und als Kontrolle verwenden wir Ras gebunden an ein Analog, GppNHp,
00:16:21.25 wo du zwischen dem Beta- und dem Gamma-Phosphat eine NH-Gruppe hast
00:16:25.16 die nicht mehr hydrolysiert werden können und jetzt auch einen sehr schnellen Anstieg haben
00:16:30.17 (das ist eine Komplexbildung), aber keine Dissoziation, da diese nicht hydrolysiert werden kann.
00:16:35.05 Das ist also auch der Beweis, dass die Dissoziation auf GTP-Hydrolyse zurückzuführen ist.
00:16:40.21 So kann man fragen: "Bei dieser Reaktion hier, was auf GAP, was auf GAP zurückbleibt,
00:16:50.01 sind an der Vermittlung dieser schnellen GTP-Hydrolyse-Reaktion beteiligt, dieser 10^5-fachen Stimulation der Reaktion?"
00:16:58.17 Und offensichtlich haben Sie sich überlegt, welche Reste, welche Aminosäuren diese Aufgabe erfüllen könnten.
00:17:03.16 Oder ist es mehr als eine Aminosäure?
00:17:05.16 Und als guter Kandidat dachten wir an ein Arginin
00:17:08.16 denn wenn man sich ein anderes G-Protein anschaut, G-alpha-Protein (von den heterotrimeren G-Proteinen)
00:17:15.02 es ist bekannt, dass das aus zwei Domänen besteht
00:17:18.25 also ist diese blaue Domäne die G-Domäne und das rote Zeug hier ist eine spiralförmige Extradomäne.
00:17:24.21 Aber in dieser helikalen Domäne haben Sie ein Arginin, das genau im aktiven Zentrum sitzt
00:17:29.24 und es hat sich gezeigt, dass Arginin für die Reaktion wichtig ist.
00:17:33.29 Und das hat sich in einem sehr alten Experiment gezeigt
00:17:37.20 weil es einen bakteriellen Erreger namens Vibrio cholera gibt, der Cholera induziert
00:17:45.29 und was es bewirkt, ist, dass es dieses Arginin auf diesem G-alpha-Protein modifiziert.
00:17:51.16 Sie haben NAD und das Cholera-Toxin überträgt ADP-Ribose auf
00:17:58.03 ein Arginin von G-alpha, das hier gezeigt wird. Das ist eigentlich aus dem Lehrbuch hier.
00:18:02.26 Das ist also eine sehr alte Reaktion. Es war vor vielen, vielen Jahren analysiert worden.
00:18:07.10 Und es zeigt sich, wenn du diese Reaktion ausführst, wenn du blockierst
00:18:10.16 die GTPase-Reaktion auf G-alpha-Protein, es gibt keine GTP-Hydrolyse mehr
00:18:16.10 und das Protein produziert nun zyklisches AMP,
00:18:19.14 öffnet es Kanäle (cyclische AMP-gesteuerte Ionenkanäle) und dann bekommt man all diese Symptome der Cholera.
00:18:26.19 Die Frage ist also wieder: Wäre Arginin ein guter Kandidat?
00:18:29.29 Also haben wir in allen RasGAPs, die ich dir gezeigt habe, nach konserviertem Arginin gesucht
00:18:33.24 und tatsächlich haben wir mehrere gefunden, die meisten haben keinen Unterschied gemacht.
00:18:38.06 Aber es gab nur ein Arginin, das mutiert das folgende Reaktionsmuster zeigt.
00:18:43.19 Sie haben also wieder in der grünen Version (das ist die Wildtyp-Version)
00:18:47.23 schnelle Zunahme durch Komplexbildung, schnelle Abnahme durch Dissoziation nach GTP-Hydrolyse.
00:18:53.16 Und bei diesen Mutanten hier mutierte Arginin entweder zu Lysin oder Alanin
00:18:58.11 oder zu was du es mutieren möchtest,
00:19:00.03 die Reaktion nimmt wieder zu, aber dann bleibt sie oben, keinerlei Hydrolyse.
00:19:06.13 Oder zumindest unter diesen Umständen bis zu einer Sekunde keine Hydrolyse.
00:19:10.16 Was Ihnen offensichtlich schon sagt, dass dieses Arginin für die Reaktion essentiell sein muss.
00:19:18.02 Soweit so gut. Die Biochemie war klar
00:19:21.09 aber offensichtlich wissen Sie nicht wirklich, was Arginin in diesem Zusammenhang macht.
00:19:24.05 Sie denken, Sie haben eine Idee, dass es in die aktive Site gehen könnte
00:19:28.02 aber auch hier müssen wir warten, bis die Struktur uns wirklich sagt, was sie tut.
00:19:33.21 Zunächst möchte ich Ihnen jedoch ein weiteres wichtiges Konzept zur Analyse von Phosphotransferreaktionen vorstellen.
00:19:40.12 Und das mit Aluminiumfluorid-Komplexen.
00:19:43.02 Sie fragen sich vielleicht, warum so ein anorganisches Molekül wichtig ist
00:19:47.14 aber es stellt sich heraus, dass wenn man sich die Natur des Übergangszustandes ansieht,
00:19:51.20 also wäre GTP von Wasser angegriffen.
00:19:55.18 Du hast einen Übergangszustand, in dem das Phosphat jetzt ein triginales, flaches Ding macht
00:20:00.26 wobei der nukleophile Sauerstoff und der Sauerstoff der Abgangsgruppe auf der anderen Seite
00:20:08.22 sind die axialen Liganden dieses fünffach koordinierten Phosphats
00:20:12.11 und dieser Übergangszustand kann entweder sehr eng sein (was dann als assoziativ bezeichnet wird)
00:20:18.16 oder sehr locker je nach Abstand hier zwischen Phosphat und den beiden axialen Liganden.
00:20:25.26 Und dann haben Sie wieder tetragonales Phosphat (dieses Pi-freie Phosphat).
00:20:32.08 Und es stellt sich heraus, dass Aluminiumfluorid
00:20:36.05 (der Abstand zwischen Aluminium und Fluorid ist sehr ähnlich zu
00:20:39.23 zwischen Phosphat und Sauerstoff und sie sind auch stark elektronennegativ)
00:20:44.26, dass dies eine sehr gute Nachahmung des Übergangszustands der Phosphotransferreaktion ist.
00:20:51.02 Das einzige Problem war, dass während zum Beispiel Kinesin oder Myosin oder
00:20:56.28 viele andere Phosphotransferenzyme verwenden Aluminiumfluorid als Nachahmung des
00:21:02.07 Gamma-Phosphat im Übergangszustand,
00:21:04.17 Ras oder Rho und all diese Ras-ähnlichen Proteine ​​haben das nie gezeigt.
00:21:08.25 Hier sehen Sie das Experiment.
00:21:11.19 Sie nehmen Ras-mantGDP (es hat ein bestimmtes Fluoreszenzemissionsspektrum mit einem Maximum bei etwa 440)
00:21:19.03 und jetzt fügst du den GAP hinzu und mit einem ändert sich überhaupt nichts am Spektrum.
00:21:24.12 Also passiert nichts.
00:21:25.11 Aber wenn Sie jetzt Aluminiumfluorid hinzufügen, sehen Sie, dass Sie jetzt zuerst eine Blauverschiebung bekommen
00:21:31.00 und dann eine Erhöhung der Absorption.
00:21:37.11 Das bedeutet, dass es einen trimeren Komplex zwischen Ras, NF1 und Aluminiumfluorid gibt
00:21:42.07 wo das Aluminiumfluorid in der Gammaphosphat-Bindungsstelle sitzt.
00:21:47.10 Und das war sehr hilfreich.
00:21:48.25 und übrigens, wenn man das jetzt bei onkogenen Mutanten macht
00:21:52.02, von dem wir wissen, dass es GTP nicht hydrolysiert und das gleiche Experiment durchführt,
00:21:55.15 Sehen Sie, in Gegenwart von Aluminiumfluorid und Ras gibt es keine fluoreszierende Veränderung.
00:22:00.06 Und jetzt fügen Sie NF1 hinzu und die Fluoreszenz nimmt nicht zu
00:22:04.12, weil Sie eine Mutation (Q61L) haben, die nicht hydrolysiert.
00:22:08.13 Sie können auch eine Mutation von NF1 nehmen, zum Beispiel mit der Arginin-Mutation,
00:22:13.22 und wieder würde sich nichts ändern.
00:22:16.05 Mit anderen Worten, was diese Experimente uns wieder sagen, ist, dass Ras in einem unvollständigen Phospho-Transfer-Enzym ist.
00:22:22.22 Es braucht die Anwesenheit einer GAP, um wie ein Phospho-Transfer-Enzym auszusehen
00:22:28.05 und wenn es eine Mutation gibt, die die GTPase-Reaktion blockiert, entweder auf Ras oder auf NF1,
00:22:33.22 bekommen wir auch keinen Aluminiumfluoridkomplex.
00:22:37.09 Also natürlich ist das alles schön in Bezug auf Biochemie
00:22:42.00 aber was die GTPase-Reaktion wirklich vermittelt, die schnelle,
00:22:47.22 Wir denken, dass dies nur durch einen Blick auf die Struktur des Ras- und RasGAP-Komplexes verifiziert werden kann.
00:22:55.29 Dies wird hier gezeigt. Das war also das Paradigma für die Analyse dieser Art von Reaktion.
00:23:02.06 Sie sehen also zum Beispiel in Rot Ras und unten in Grün die RasGAP-Domäne (P120 GAP).
00:23:09.13 Und was Sie dann hier sehen. wenn du ganz genau hinschaust
00:23:12.04 Sie sehen, dass ein Rückstand von GAP in das aktive Zentrum gelangt.
00:23:17.14 Das sieht man, wenn es zurückkommt. das siehst du gleich dort.
00:23:21.01 Es gibt einen Argininrest, der in das aktive Zentrum von Ras . zeigt
00:23:26.04 und was es tut, wird auf der nächsten Folie gezeigt.
00:23:29.06 Zunächst einmal zeigt diese Folie, dass das Aluminiumfluorid wirklich das flache Dreieck ist
00:23:34.00, die zwischen der Abgangsgruppe und dem nukleophilen Wasser sitzt.
00:23:38.07 Es gibt also eine Nachahmung des Übergangszustands.
00:23:39.28 Und Sie sehen dann auch, was die Rückstände sind, die eine schnelle GTP-Hydrolyse vermitteln.
00:23:45.17 Das wäre also das Phosphat,
00:23:48.14 also denken wir jetzt, wenn wir Aluminiumfluorid wegnehmen und
00:23:52.06 Überlege, wie der wirkliche Übergangszustand aussehen würde
00:23:55.06 du hast das nukleophile Wasser und du hast den Übergangszustand
00:23:58.29 wo sie an das Gammaphosphat gebunden sind
00:24:00.25 und das Glutamin fixiert das Wasser relativ zum Phosphat
00:24:05.07 durch eine Akzeptor- und eine Wasserstoffbrücken-Donor-Wechselwirkung.
00:24:09.17 Und das Arginin (was wir Arginin-Finger nennen) stabilisiert sich zuallererst
00:24:13.29 die Position dieses Glutamins und es liefert auch diese positive Ladung
00:24:18.03 der Aminogruppe, um Ladungen im Gammaphosphat zu neutralisieren.
00:24:22.28 Das sind also die beiden Reste, die für die Reaktion wirklich entscheidend sind
00:24:27.08 Glutamin 61 von Ras und der Argininfinger von RasGAP.
00:24:32.05 Und das erklärt zum Beispiel schon, warum Mutationen von Glutamin 61 im onkogenen Ras
00:24:37.19 die Hydrolysereaktion durcheinander bringen, weil Sie sich vorstellen können, wenn Sie zum Beispiel
00:24:42.09 ein Leucin oder was auch immer hier, wenn man diese Art von Interaktionen hier nicht machen kann.
00:24:47.00 Jede Mutation von Glutamin 61 ist also onkogen, weil es ein direkter katalytischer Rest ist.
00:24:53.16 Die Struktur erklärt also auch, warum Mutationen von Glycin 12 onkogen sind.
00:24:58.22 Und das ist auch hier auf dieser Folie gut zu sehen.
00:25:02.04 Sie haben Glycin 12, das, wenn es zu einem Rest mutiert wird, es zu einem Onkogen macht.
00:25:06.25 Und dann sehen Sie, dass Aluminiumfluorid dieses flache Dreieck ist.
00:25:11.08 Sie sehen dort Glutamin 61 und hier unten den Argininfinger.
00:25:16.09 Und sie sind alle sehr nah beieinander, angezeigt durch diese blauen gestrichelten Linien
00:25:20.04, was darauf hinweist, dass dies fast VanDerWaals-Entfernung ist.
00:25:24.04 Und wenn Sie nun zum Beispiel Glycin zur kleinstmöglichen Aminosäure mutieren,
00:25:28.11 es wäre Alanin, du siehst, es würde sofort all diese Reste im aktiven Zentrum durcheinander bringen.
00:25:34.01 Aus sterischen Gründen kann es also keine anderen Rückstände geben
00:25:36.24 im aktiven Zentrum im Übergangszustand außer Glycin.
00:25:43.08 Die Botschaft von all dem war offensichtlich, dass es ein Arginin gibt
00:25:49.00, das wir den Argininfinger nennen, der den Auslöser für die GTPase-Reaktion drückt.
00:25:54.00 Ohne ist es sehr langsam und damit wird es 10^5 mal schneller.
00:26:01.01 Wir haben es auch benutzt. also um auf die frage zurückzukommen: was ist jetzt die ratenbegrenzung im gesamten prozess?
00:26:07.00 Der wichtigste Regulierungsschritt der intrinsischen GTP-Hydrolyse ist also der sehr langsame chemische Schritt, die langsame Hydrolyse.
00:26:14.29 Aber mit einer anderen Technik finden wir das jetzt heraus
00:26:17.25 Es gibt einen weiteren Schritt, der teilweise die Geschwindigkeit begrenzt, und ich werde Ihnen das in einer Minute zeigen.
00:26:23.29 Wir verwenden also zeitaufgelöste Fourier-Transformations-Infrarotspektroskopie.
00:26:28.10 Und damit erreichen wir fast atomare Auflösung.
00:26:33.11 Wir können Atome im aktiven Zentrum auf einer Millisekunden-Zeitskala betrachten.
00:26:37.27 Wenn Sie also ein Infrarotspektrum eines Proteins sehen, das Amid I- und Amid II-Banden aufweist,
00:26:47.20 Das sind keine sehr strukturierten Informationen, da es sich um eine Mischung aus Informationen zu handelt
00:26:54.26 Alpha-Helices, Beta-Sheets und so weiter und man kann nicht viele Details aus einem solchen Bild herausnehmen.
00:27:02.26 Aber wir beobachten, um zu reagieren. Nehmen wir an, ein Protein geht von A nach B
00:27:09.05 beobachten wir das unterschiedliche Spektrum, das zumindest auf dieser Absorptionsskala
00:27:16.19 zeigt keinen großen Unterschied, aber wenn man genauer hinschaut.
00:27:20.15 Sie sehen also, dass die Absorption dort 0,0 beträgt und die Absorption hier unten 0,02 beträgt.
00:27:25.14, also sehen wir sehr kleine, aber sehr reproduzierbare Änderungen
00:27:29.21 im Verlauf der Reaktion, wenn A zu B geht.
00:27:33.02 Und wir sehen negative Spitzen, die bedeuten, dass A verschwindet, und wir sehen positive Spitzen, wenn B auftaucht.
00:27:40.22 So können wir Dinge beobachten, die verloren gehen und Dinge, die auftauchen
00:27:43.29 im Verlauf der Reaktion und wir können diese per FTIR verfolgen.
00:27:49.25 Und wenn ja. Also müssen wir zuerst die Reaktion zu einem bestimmten Zeitpunkt auslösen
00:27:56.25, um strukturelle Veränderungen der zweiten Zeitskala zu beobachten.
00:28:03.04 Und dafür verwenden wir wieder ein anderes Analog
00:28:07.00 und das andere Analog ist eingesperrtes GTP, das von Roger Goody entwickelt wurde
00:28:10.22 der ein Kollege von mir im Institut ist.
00:28:14.05 Und diese eingesperrte GTP wird auf dem Gammaphosphat durch die sogenannte Käfiggruppe blockiert.
00:28:20.22 Es erlaubt also keine Hydrolyse, aber jetzt kannst du mit einem Lichtblitz diese Käfiggruppe abspalten
00:28:26.21 und jetzt haben Sie Ras-GTP, das dann zu GDP und Pi hydrolysieren kann.
00:28:31.19 Wenn Sie das mit Ras ohne GAP machen,
00:28:39.11 Sie sehen, dass Sie einen haben. Sie sehen zum Beispiel die Absorption.
00:28:44.22 Also jede Absorption, die Sie vom Infrarot kennen, zeigt eine atomare Schwingung in den Bindungen.
00:28:51.09 Sie sehen zum Beispiel Vibrationen für die
00:28:53.15 Alpha, Beta, Gamma, die gegen Ende abnehmen und nach 2 Stunden, 5 Minuten Null werden.
00:29:00.29 Also das Differenzspektrum (subtrahiere das Endspektrum vom Startspektrum)
00:29:06.16 und dann sieht man nur die Veränderungen, die während der Reaktion auftreten.
00:29:11.23 Und das ist ganz normal. Es gibt einen einzigen exponentiellen Zerfall, wenn Ras GTP hydrolysiert.
00:29:18.21 Keine große Sache.
00:29:20.15 Aber interessant ist, dass wenn man die GAP-vermittelte Reaktion analysiert
00:29:24.26, weil Sie jetzt keinen einzigen exponentiellen Zerfall sehen, sondern plötzlich Zwischenstufen erscheinen.
00:29:30.14 Sie sehen Gipfel, die auf- und absteigen und der wichtigste ist
00:29:35.04, angezeigt durch diese Nummer 1113. Dies ist die Häufigkeit für diese spezielle Änderung.
00:29:39.28 Also muss man natürlich analysieren, was jede Band macht, wozu sie gehört.
00:29:47.06 Also, was machen wir der Reihe nach. Wir haben diese Techniken entwickelt
00:29:52.17 oder unsere Kollegen an der Uni Bochum, mit denen wir zusammenarbeiten
00:29:56.03 Sie haben Techniken entwickelt, um herauszufinden, was jede Bandbreite ist,
00:30:01.01 was ist jede Frequenz. Extinktionsänderung. woran liegt es.
00:30:03.28 Zum Beispiel stellen Sie für GTP fest, dass eine Extinktionsänderung bevorsteht
00:30:10.13 eine Geschwindigkeitskonstante k2. k1 ist also die Photoisomerisierung, k2 ist eine Reaktion und k3 ist die nächste.
00:30:17.18 Und wenn Sie das tun, erhalten Sie mit k3 eine Zunahme und eine Abnahme.
00:30:21.12 Und dann gibt es noch eine Zwischenstufe, die um 1113 Uhr ansteht.
00:30:26.12 Es kommt mit k2 und zerfällt mit k3.
00:30:30.01 Mit k3 kommt kostenloses Pi. Aus all dem können wir natürlich schließen
00:30:35.18 dass es hier ein Pi-Intermediat mit dieser Absorptionsfrequenz gibt, 1113 cm^-1
00:30:44.02, das mit der Geschwindigkeitskonstanten k2 erscheint und mit einer Geschwindigkeitskonstanten k3 abklingt.
00:30:50.03 Mit anderen Worten, die Veröffentlichung von Pi wird jetzt sichtbar.
00:30:54.25 Wir sehen also Hydrolyse, wenn dieser Pi-Peak auftaucht.
00:30:58.21 Und wir sehen den Verfall, wenn er verschwindet.
00:31:01.01 Und das sehen Sie hier zum Beispiel in Echtzeit.
00:31:03.25 Die Absorption ändert sich also mit der Geschwindigkeitskonstanten k2. das Schema siehst du hier:
00:31:09.05 Ras, wenn es im eingeschalteten Zustand ist, geht in den Pi-Zustand über und Sie sehen, dass es ein proteingebundenes Pi gibt
00:31:17.13 das kommt und die Pi-Band geht im Laufe der Reaktion unter.
00:31:21.20 Und das wird mehrmals wiederholt.
00:31:23.07 Und Sie auch, damit ein Arginin-Finger in die Reaktionskammer ein- und ausgeht.
00:31:30.00 Damit wir nicht nur Proteinbanden folgen können,
00:31:32.16 können wir die Phosphatbanden mit atomarer Auflösung im Millisekundenbereich verfolgen.
00:31:40.26 Und das sagt uns jetzt alle zusammen, das ist die Botschaft von all dem,
00:31:46.01 dass Sie zwar eine hohe Aktivierungsenergie für die intrinsische Hydrolysereaktion von 92 kJ/mol . haben
00:31:54.01 du trennst jetzt die Reaktion in zwei Teilreaktionen,
00:31:57.16 die eine geringere Aktivierungsenergie haben und deshalb so viel schneller machen.
00:32:01.08 Sie haben also die erste Aktivierungsenergie für die Spaltungsreaktion. was zu Ras-BIP-Pi führt.
00:32:08.03 Und Sie haben den zweiten Schritt, in dem Sie die Veröffentlichung von Pi haben und jetzt haben Sie das Produkt.
00:32:12.14 Das ist also wieder ein allgemeines Thema der Enzymologie
00:32:15.12 dass eine enzymkatalysierte Reaktion die Aktivierungsenergie senkt
00:32:20.00 nicht nur eine Reaktion absenken, sondern auch in Teilschritte unterteilen
00:32:24.28 von denen jeder eine andere Aktivierungsenergie hat.
00:32:29.22 Und hier sehen Sie, dass diese Aktivierungsenergie 59 kcal/mol und 66 beträgt, was bedeutet
00:32:36.04, dass dies etwas höher ist und deshalb der teilweise geschwindigkeitsbegrenzende Schritt der Gesamtreaktion ist.
00:32:45.12 Also lass mich dir jetzt geben. das war also Ras und wie es zur Tumorbildung führt
00:32:50.14 und wir haben im Detail analysiert, wie das auch auf biophysikalischer Ebene funktioniert
00:32:55.02 aber lassen Sie mich jetzt darauf zurückkommen, warum bestimmte GTPase-Reaktionen, wenn sie nicht funktionieren,
00:33:03.00 wie sie zu verschiedenen Arten von Krankheiten führen.
00:33:05.20 Neurofibromatose ist eine davon.
00:33:07.27 Ich habe Ihnen bereits gezeigt, dass Neurofibromin, das Genprodukt des Gens, ein Ras GAP ist.
00:33:15.09 Und es gibt eine Krankheit namens Neurofibromatose Typ I. Es ist das, was die Leute Kaffee-au-lait-Flecken auf der Haut haben,
00:33:22.21 manchmal kleine Tumoren auf der Haut, die manchmal ziemlich groß und sehr entstellend sein können
00:33:28.16, die durch eine Mutation oder Deletion des Neurofibromatose-Gens verursacht werden.
00:33:35.21 Und als wir zum Beispiel am Mechanismus der GTP-Hydrolyse von GAP und NF1 arbeiteten,
00:33:43.00 kam ein Kollege von der Charite-Klinik in Berlin zu uns und sagte uns, dass er das hatte
00:33:48.03 eine Patientin, die im Alter von 35 Jahren verstirbt und sie hat drei dort oben angegebene Söhne
00:33:55.20 die auch die Krankheit haben. Und er analysierte das Blut des Patienten und dann den Tumor selbst.
00:34:04.22 Er hat herausgefunden, dass es eine Mutation in der Sequenz von Neurofibrobromin gibt
00:34:11.29 wo das Arginin zu Prolin mutiert ist. Sie sehen, dass dort unten Arginin zu Prolin mutiert ist.
00:34:17.13 Und das würde ich dir natürlich nicht sagen, wenn es nicht das katalytische Arginin wäre.
00:34:21.19 Es stellt sich also heraus, dass sie eine Mutation im katalytischen Arginin haben
00:34:25.23 und wenn du jetzt die GTPase-Reaktion machst, die ich dir vorher gezeigt habe,
00:34:30.09 Sie sehen, mit normalem NF1 haben Sie hier die blaue Kurve,
00:34:37.17 bedeutet eine Zunahme der Fluoreszenz und eine Abnahme mit Hydrolyse
00:34:43.03 und jetzt, wenn Sie diese Mutation nehmen, R zu P, haben Sie eine Zunahme, was eine komplexe Bildung bedeutet
00:34:48.03 aber keine Hydrolyse und es gibt einen anderen Patienten, den wir inzwischen analysiert haben
00:34:53.16 wieder Arginin zu allem anderen, Q in diesem speziellen Fall,
00:34:58.09 führt zu einer Blockierung seiner Fähigkeit, GTP auf Ras zu hydrolysieren.
00:35:02.17 Die Mutation des essentiellen Arginins führt also zur Krankheit Neurofibromatose.
00:35:08.16 Außerdem sollte ich darauf hinweisen, dass es viele andere Mutationen in Neurofibromin gibt
00:35:13.22, die auch die Krankheit verursachen, die bei vielen verschiedenen Patienten phänotypisch sehr unterschiedlich ist.
00:35:20.26 Lassen Sie mich Ihnen jetzt ein anderes System vorstellen, das ist
00:35:24.06 interessant sowohl aus biochemischer Sicht als auch aus Sicht einer anderen Krankheit
00:35:29.11 zu dem ich zu gegebener Zeit kommen werde.
00:35:33.03 Ich werde also über ein Molekül namens Rap sprechen, das offensichtlich ein verwandtes RasGAP hat.
00:35:40.16 Und Rap ist ein enges Homolog von Ras und der Name leitet sich von ab
00:35:44.05 die Tatsache, dass es sehr homolog zu Ras ist, weil Rap für Ras Proximate steht.
00:35:49.07 Obwohl es als enges Homolog von Ras galt, macht es etwas ganz anderes.
00:35:55.14 Es hat offensichtlich den gleichen Zyklus zwischen BIP und GTP. Es funktioniert also als molekularer Schalter.
00:36:02.00 Aber es hat nicht mit Proliferation wie Ras oder Differenzierung zu tun, sondern eher
00:36:06.10 Es ist an der Integrinaktivierung oder der Thrombozytenaktivierung oder anderen Dingen beteiligt.
00:36:11.19 Die Biologie von Rap ist also völlig anders.
00:36:14.17 Warum die Biochemie so interessant ist, ist, dass Rap das einzige Homolog ist
00:36:22.12 oder das einzige Mitglied der Ras-Superfamilie, das kein Glutamin in der Position hat
00:36:27.18, wobei Glutamin 61 von Ras an der GTP-Hydrolyse beteiligt ist.
00:36:33.01 Es fehlt also der Rückstand, den wir für die absolut entscheidende GTP-Hydrolyse hielten, und hier ist er nicht da.
00:36:39.18 Und natürlich stellt sich die Frage, warum das so ist und wie RapGAP
00:36:42.25 Dann arbeite an diesem System und wie stimuliert es die Reaktion.
00:36:48.29 Lassen Sie mich Ihnen also zunächst die RapGAPs vorstellen.
00:36:52.24 Hier sind fünf von ihnen angegeben, aber es gibt noch mehr im menschlichen Genom
00:36:57.23, aber diese fünf RapGAPs enthalten alle eine hochhomologe Domäne
00:37:04.02 was hier durch die hellblaue und die dunkelblaue Färbung angezeigt wird
00:37:08.09 wo das hellblaue Zeug etwas anders ist als das dunkelblaue.
00:37:12.05 Und ich werde das erklären, wenn wir uns die Struktur ansehen.
00:37:13.21 Auch hier ist die Domänenorganisation all dieser fünf RapGAPs etwas anders.
00:37:17.25 Das bedeutet, dass sie ihre Arbeit wahrscheinlich in einem anderen biologischen Kontext erledigen.
00:37:23.04 Der Grund, warum es auch interessant ist, ist, dass die dunkelblaue Homologieregion ist
00:37:28.10 auch in einem Protein namens Tuberin konserviert
00:37:30.17, was für eine Krankheit steht, über die ich am Ende sprechen werde.
00:37:34.03 Deshalb war es auch interessant, sich diese Reaktion anzusehen.
00:37:37.06 Und der dritte Grund, warum es interessant ist, sich diese Reaktion anzusehen, ist auf der nächsten Folie angegeben.
00:37:42.19 Aber bevor Sie das tun, lassen Sie mich Ihnen zuerst zeigen, dass wir wieder einen Stopped-Flow-Fluoreszenz-Assay machen.
00:37:48.23 Wir haben ein System entwickelt, mit dem wir diese Reaktion biochemisch betrachten können
00:37:53.12 und analysieren Mutationen und Reaktionsgeschwindigkeit und so weiter.
00:37:58.13 Also hier haben wir wieder Rap-GTP, das mit RapGAP interagiert
00:38:03.20 Sie erhalten einen großen, schnellen Fluoreszenzanstieg, der auf die Komplexbildung zurückzuführen ist
00:38:07.28 und eine Abnahme aufgrund von GTP-Hydrolyse und Dissoziation des Produkts.
00:38:12.25 Und nach einer Sekunde ist alles wieder vorbei.
00:38:16.03 während die ganze Reaktion ohne RapGAP Stunden dauern würde.
00:38:19.25 Mit anderen Worten, wir haben wieder 10^5 Stimulation der Reaktion.
00:38:23.15 Das ist aber auch biochemisch und mechanistisch ein interessantes System,
00:38:29.09 ist, dass es eine Reihe von konservierten Argininen in RapGAPs gibt und offensichtlich
00:38:35.00 Wir dachten, dass einer von ihnen daran beteiligt sein würde, dem System einen Argininfinger zur Verfügung zu stellen.
00:38:39.06 Tatsächlich haben wir sie alle zu Alanin mutiert
00:38:42.06 und keiner von ihnen hat einen dramatischen Einfluss auf die Aktivität, wie man hier sehen kann.
00:38:48.02 Die schlimmste Reaktion liegt also immer noch bei 0,5/Sekunde.
00:38:52.02 Mit anderen Worten, es gibt keinen dramatischen Effekt, wenn Sie eines der Arginine mutieren
00:38:55.29, was es unwahrscheinlich macht, dass ein Argininfinger an der Reaktion beteiligt ist.
00:39:00.23 Also die beiden Reste, intrinsisches Glutamin und der Argininfinger in trans
00:39:09.04 das ist Ras und Rho und andere machen die wichtige Katalyse nicht hier in diesem System.
00:39:17.05 Das heißt, die Chemie muss ganz anders sein.
00:39:21.15 Also haben wir uns noch einmal die FTIR des Systems angesehen und
00:39:26.07 es zeigt im Grunde die gleichen Merkmale, obwohl ihre Strukturen etwas anders sind.
00:39:31.16 Die grundlegenden Merkmale sind, dass es ein Pi-Zwischenprodukt gibt, dessen Abnahme die Geschwindigkeit begrenzt
00:39:37.23 für die Reaktion und obwohl sie chemisch etwas anders ist,
00:39:41.27 wie die verschiedenen Absorptionsspektren zeigen, ist es tatsächlich ein kinetisch wichtigstes Zwischenprodukt.
00:39:50.11 Aber was war interessant, und wir fanden in diesem speziellen Fall, im Fall RapGAP,
00:39:56.10 und wurde inzwischen auch in anderen Systemen gefunden,
00:39:58.27 ist, dass die GTPase-Reaktion reversibel ist,
00:40:01.29, was irgendwie verrückt klingt, weil es eine Abwärtsreaktion ist.
00:40:05.06 Wenn Sie GDP und Pi und das ganze System nehmen, würden Sie niemals GTP erstellen.
00:40:09.22 Aber was passiert, wenn Sie die Reaktion analysieren, indem Sie
00:40:13.05 unter Verwendung von O18-Wasser anstelle von normalem Wasser, was durch diesen schwarzen Punkt angezeigt wird,
00:40:17.23 Sie würden erwarten, dass Sie bei der Reaktion Hydrolyse bekommen und dann GDP und Pi
00:40:23.27, bei dem ein Phosphat als O18-Sauerstoff gekennzeichnet ist, und ein Sauerstoff, der als O18-Sauerstoff gekennzeichnet ist.
00:40:30.12 Aber anstatt einen Pi mit einem O18-Sauerstoff zu bekommen, bekommt man einen Pi mit zwei O18-Sauerstoff,
00:40:36.24 mit drei O18-Sauerstoffen und mit vier O18-Sauerstoffen, wie hier durch eine Massenspektroskopie analysiert.
00:40:42.11 Sie sehen, wo Sie all diese vier Produkte bekommen, analysiert durch Massenspektroskopie.
00:40:49.27 Also, wie passiert das?
00:40:51.09 Es passiert also, weil du auf dem Protein dieses langlebige Zwischenprodukt hast
00:40:56.00 mit GDP und Pi, sitzen in der aktiven Site, bevor Sie in ein Produkt einsteigen, das auch kann
00:41:03.10 Führen Sie eine Rückreaktion durch, um GTP mit einem Sauerstoff jetzt auf dem Gammaphosphat herzustellen.
00:41:08.15 Reagiert es nun erneut mit O18-Wasser, wird ein zweites O18 in das Produkt eingearbeitet.
00:41:15.27 Und wenn es noch einmal passiert, ein drittes und ein viertes.
00:41:18.16 Obwohl die Gesamtreaktion bergab geht,
00:41:22.12 auf das Enzym bekommen Sie eine Rückreaktion.
00:41:24.15 Und du kannst es nie bekommen, wenn Pi veröffentlicht ist
00:41:28.21 weil dann die Aktivierungsenergie für die Rückreaktion zu hoch ist.
00:41:33.18 Also haben wir auch die Struktur von RapGAP gelöst.
00:41:37.06 Dies ist eine Zwei-Domain-Struktur, wobei eine Domain, die Sie jetzt links sehen,
00:41:44.07 ist die katalytische Domäne – die dunkelblaue Region im Homologiediagramm, das ich dir gezeigt habe
00:41:49.01 und das hellblaue Zeug ist die Dimerisierungsdomäne, die für die Katalyse nicht wichtig ist
00:41:53.08 aber ist da, um das Protein zu dimerisieren
00:41:56.18 aus irgendeinem Grund, den wir wirklich nicht kennen.
00:42:00.13 Bei der Analyse der katalytischen Domäne fragen Sie sich natürlich:
00:42:03.10 Was sind die konservierten Reste und welche davon spielen eine wichtige Rolle in der Katalyse?
00:42:08.04 Die violette Helix, die ich hier angedeutet habe, ist die am besten erhaltene Region.
00:42:12.00 Es ist also wahrscheinlich, dass Reste dieser Helix irgendwie an der Katalyse beteiligt sind.
00:42:18.05 Und tatsächlich kann man viele davon mutieren und man sieht gewisse Effekte.
00:42:21.12 Aber der dramatischste Effekt tritt ein, wenn du mutierst
00:42:25.01 N290, also ein Asparagin, sitzt auf dieser katalytischen Helix.
00:42:29.08 Wenn Sie das mutieren, erhalten Sie das folgende Ergebnis.
00:42:33.00 Wir nennen es übrigens den Asn-Daumen, um den Arginin-Finger zu verändern.
00:42:39.03 Es ist also ein Asn-Daumen und Sie werden gleich sehen, warum wir ihn Asn-Daumen nennen.
00:42:44.26 Wenn Sie sich also zunächst die Mutation ansehen, von der ich gesprochen habe,
00:42:48.27 Wenn Sie also die N290A-Mutation nehmen und die Reaktion analysieren, indem Sie erneut
00:42:55.09 dieser fluoreszierende Stopped-Flow-Assay, sehen Sie, dass Wildtyp einen Komplex bildet
00:43:00.25 und zerfällt dann in Produkt,
00:43:02.26 die Mutation macht hier einen Komplex, dieser ist übrigens noch enger als im Wildtyp-Fall,
00:43:09.15 aber es gibt absolut keine Hydrolyse.
00:43:11.07 Die Reaktion geht weiter und weiter. Es bleibt dort oben und geht nie unter.
00:43:14.21 Wenn Sie dagegen eine Mutation wie H287 zu Alanin vornehmen,
00:43:20.22 Sie sehen, dass es keine Komplexbildung gibt, weil die Fluoreszenz hier unten bleibt.
00:43:24.04 Diese Reaktion ist also tot, weil sie nicht binden kann
00:43:27.08 aber die rote Reaktion ist in Ordnung, weil wir denken, dass dies der wichtige katalytische Rückstand ist.
00:43:32.12 Wir denken, dass wir nur die Biochemie betrachten.
00:43:35.15 Um zu wissen, was es tut, müssen wir natürlich noch einmal die Struktur lösen,
00:43:38.26 was wir getan haben. Dies ist der Rap-RapGAP-Komplex.
00:43:43.15 Und du siehst hier das rote und das grüne Zeug ist RapGAP und das blaue Zeug ist Rap.
00:43:49.20 Und Sie sehen GTP. Aber was man auch sieht, wenn man es im Detail betrachtet,
00:43:54.02 ist, dass es wieder etwas gibt, das von der roten katalytischen Domäne von RapGAP
00:43:59.06 in das aktive Zentrum und das ist ein Asparagin.
00:44:01.17 Offensichtlich ist es der Asparagin, über den ich gesprochen habe.
00:44:04.20, die in die aktive Seite von Rap stößt. Deshalb nennen wir es den Asn-Thumb
00:44:08.28 in Bezug auf den Arginin-Finger in den anderen Systemen.
00:44:12.27 Und wenn man sich genau anschaut, was an der aktiven Stelle passiert,
00:44:17.02 und wenn Sie es mit drei anderen Strukturen des Ras-Proteins und ihren verwandten GAPs vergleichen,
00:44:26.19 mit Ran und RanGAP, Ras und RasGAP und Rho und RhoGAP,
00:44:31.18 wobei Rho und RhoGAP von Rittinger et al. und die anderen Strukturen sind von uns,
00:44:35.14 Sie sehen, dass die anderen drei, diese drei Strukturen hier,
00:44:40.12 haben ein Glutamin, das zum katalytischen Wasser zeigt,
00:44:44.29 welches das hier angegebene Gammaphosphat angreift,
00:44:47.09 das ist das Aluminiumfluorid,
00:44:50.01 ein Übergangszustand, der das übertragene Gammaphosphat nachahmt.
00:44:54.08 Und die rote Struktur hier hat statt des Glutamins 61 ein Threonin
00:45:00.19, das vom aktiven Zentrum wegzeigt, hat nichts mit Katalyse zu tun.
00:45:04.01 Stattdessen sieht man, dass die violette Helix hier dieses Asparagin einfügt
00:45:09.19 in das aktive Zentrum genau dort, wo die anderen das Glutamin haben.
00:45:14.23 Also die Unterschiede hier: Die drei anderen Strukturen haben ein Glutamin, das in cis
00:45:19.29 und Rap und RapGAP haben ein Asparagin in Trans
00:45:23.17, die das gleiche tut, nämlich das katalytische Wasser zu stabilisieren.
00:45:30.04 Und wenn man sich die Oberfläche des Proteins anschaut,
00:45:34.01 Dies ist die Rap-Oberfläche, die als Oberflächendarstellung angezeigt wird,
00:45:39.07 und dazu kommt nur noch die Helix von RapGAP.
00:45:43.09 Es sitzt auf der Oberfläche und fügt dieses Asparagin in das aktive Zentrum ein.
00:45:48.13 Das Gammaphosphat ragt also aus diesem Loch heraus.
00:45:50.08 Und alles, was RapGAP wirklich tut, ist, dass es dieses Asn auf der Helix hat, es bringt es in die aktive Seite,
00:45:57.17 und das allein scheint zumindest im chemischen Sinne zu sein,
00:46:03.03 verantwortlich für die Stimulierung der GTPase-Reaktion um das 10^5-fache
00:46:07.10, denn wenn du das Ding mutierst, bindet es immer noch gut, aber es gibt absolut keine Hydrolyse.
00:46:11.22 Das lässt uns noch einmal über die Zukunft der Entwicklung von Anti-Ras-Medikamenten nachdenken.
00:46:18.02 Wenn man nur einen solchen Rest in das aktive Zentrum einfügt,
00:46:22.11 aus chemischer Sicht sollte es machbar sein,
00:46:24.24 aber wir müssen natürlich Moleküle entwickeln, die richtig binden
00:46:28.12 auf die Oberfläche, was nicht so einfach ist und wir denken immer noch, dass wir es schaffen könnten.
00:46:35.15 Dies ist noch einmal darauf zurückzukommen.
00:46:38.00 Als Ansatz für das Ziel von Anti-Krebs-Medikamenten
00:46:42.03 suchen wir nach Molekülen, die die Hydrolyse von onkogenem Ras induzieren.
00:46:46.20 Und von dem, was wir bei RapGAP beobachtet haben, denken wir, dass wir hoffen, dass es möglich ist.
00:46:54.26 Und der dritte Grund für die Arbeit mit dem Rap-RapGAP-System ist das
00:47:03.05 es hängt mit einer Krankheit namens Tuberöse Sklerose zusammen, einem gutartigen Tumor.
00:47:06.19 Menschen kommen mit Hamartomen in vielen Organen ins Haus.
00:47:09.16 Aber das offensichtlichste Merkmal und woher der Name kommt, ist das
00:47:14.07 Menschen haben, wenn sie eine NMR des Gehirns machen, sie haben
00:47:16.29 diese sklerotischen, knollenartigen Dinge im Gehirn, die man im NMR des Gehirns sieht.
00:47:24.17 Die Leute haben Mutationen in zwei Proteinen namens Tuberin und Hamartin.
00:47:30.22 Und Tuberin hat, wie ich dir zuvor gezeigt habe, eine hohe Homologie
00:47:34.22 zu RapGAP in dieser dunkelblauen Region, das bedeutet die katalytische Region.
00:47:39.07 Und wenn Sie jetzt zum Beispiel schauen, wo Patientenmutationen bei Tuberöse Sklerose,
00:47:44.23 in Tuberin, wo sie vorkommen.
00:47:47.00 Und dies ist ein Alignment verschiedener RapGAP-Sequenzen und sie stimmen mit der Tuberin-Sequenz überein.
00:47:53.27 Sie sehen, dass die am höchsten konservierte Region wieder
00:47:57.09 dieses Ding hier (das rote Zeug), wo du die katalytische Helix hast.
00:48:01.08 Und eine der Mutationen bei einem Patienten mit Tuberöser Sklerose
00:48:04.22 (und viele haben tatsächlich diese Mutation) ist eingeschaltet
00:48:07.06 dieses Asparagin, von dem wir wissen, dass es der wichtige katalytische Rückstand ist.
00:48:11.08 Das ist also eine andere Version von dem, was wir zuvor gesehen haben
00:48:14.21 Bei der Krankheit Tuberöse Sklerose ist ein wichtiger Katalysatorrest mutiert.
00:48:21.19 Also lass mich dir in den letzten fünf Minuten einfach eine andere Krankheit geben,
00:48:25.22 nur um sicherzustellen, dass es nicht nur das Ras- und Rap-System ist,
00:48:28.28, dass es viele Krankheiten gibt, bei denen die Unfähigkeit, GTP zu hydrolysieren, zu sehr vielen verschiedenen Krankheiten führt.
00:48:35.07 Das ist also Retinitis pigmentosa.
00:48:38.28 Menschen haben Pigmente auf der Netzhaut. Daher kommt der Name.
00:48:42.28 Und sie verlieren das Sehvermögen, sie verlieren das periphere Sehvermögen.
00:48:47.00 Dies ist also eine normale Person, die dieses Gebäude sieht, und dies ist ein Patient mit der Krankheit
00:48:52.15, der immer mehr seine periphere Sicht verliert.
00:48:56.00 Und verliert dann das volle Sehvermögen, nachdem sich die Krankheit vollständig entwickelt hat.
00:49:01.19 Und es gibt eine Reihe von Genen, die bei Retinitis pigmentosa mutiert sind
00:49:06.12 die heißen RP12x und was auch immer.
00:49:09.28 Und es gibt ein Formular namens RP2.
00:49:13.03 Es ist eine X-chromosomale Krankheit, bei der Menschen Mutationen in vielen Punktmutationen in einem Protein haben.
00:49:21.16 Wir haben die Struktur des Proteins bestimmt, das so aussieht.
00:49:24.24 Dies ist eine Beta-Helix-Domäne und dies ist eine andere Domäne.
00:49:27.20 Und Sie sehen viele der Mutationen, die Sie dann analysieren.
00:49:31.06 Sie finden heraus, dass die meisten Mutationen
00:49:37.16 bestimmen oder vermasseln wahrscheinlich die Struktur, weil sie drinnen sind
00:49:41.24 der hydrophobe Kern des Proteins und das könnte man sich vorstellen
00:49:45.04 sie tun nichts an der Katalyse oder der Interaktion dieses Proteins.
00:49:50.19 Aber es gibt ein paar Mutationen, die hier zum Beispiel angezeigt werden,
00:49:54.01 E138G oder R118 zu H, K oder C. Diese Rückstände zeigen also in Lösung.
00:50:03.27 Man könnte also meinen, dass sie etwas Wichtiges für die Interaktion des Proteins tun
00:50:08.20 oder in etwas - dass sie an dem beteiligt sind, was diese Proteine ​​normalerweise tun.
00:50:14.20 Also haben wir wieder die Struktur des Komplexes zwischen Arl3 gelöst.
00:50:19.13 Wir wussten also, dass RP2 mit Arl3 interagiert, einem anderen Ras-ähnlichen Protein.
00:50:24.26 Es heißt Arl, weil es ein Arf-verwandtes Protein ist.
00:50:28.04 Und wir haben die Struktur davon gelöst. Sie sehen also, dass dieses Zeug hier das RP2 in Lila ist.
00:50:37.25 Und Sie sehen in Grün Arl3 in einer GTP-gebundenen Form.
00:50:41.25 Und was Sie dann sehen, wenn Sie noch einmal ganz genau hinsehen,
00:50:44.26 Sie sehen, dass hier ein Rest von RP2 vorhanden ist, der in das aktive Zentrum der Arl weist.
00:50:52.10 Man wusste also nicht, was RP2 macht, aber als wir die Struktur gelöst haben,
00:50:55.17 wir konnten sofort sehen, dass es nach einer Lücke riecht, weil
00:50:59.18 Es setzt einen Arginin-Finger in das aktive Zentrum des anderen Proteins.
00:51:05.08 Und wenn Sie sich die aktive Site im Detail ansehen, sehen Sie, dass dies wieder das BIP ist.
00:51:10.28 das ist Aluminiumfluorid, das ist Glutamin von Arl3,
00:51:15.14 und dies sind drei Reste von RP2--Q116, R118, E138.
00:51:21.26 Und offensichtlich sind all diese Rückstände bei Retinitis pigmentosa mutiert.
00:51:27.15 Und Sie können sehen, dass das Arginin dasselbe tut, was Sie jetzt schon oft gesehen haben.
00:51:32.22 Und es wird durch diese anderen Reste und alle drei Reste stabilisiert, wenn sie mutiert sind,
00:51:38.10 bringt die GAP-Aktivität von RP2 durcheinander.
00:51:41.26 Hier hat uns die Struktur also wirklich gesagt, was das Protein macht.
00:51:44.19 Es gab keine Ahnung von der Funktion und die Struktur sagte uns genau, dass dies eine Lücke für Arl3 ist.
00:51:53.17 Lassen Sie mich nun zu den Schlussfolgerungen aus dem kommen, was ich Ihnen erzählt habe.
00:52:00.12 Zuallererst vielleicht Schlussfolgerungen über Ras selbst, weil es das wichtigste Onkogen ist.
00:52:06.14 Es ist ein unvollständiges Enzym, es kann GTP nicht sehr schnell hydrolysieren.
00:52:11.09 Aber dann kommt RasGAP, das den Schalter II und das Glutamin 61 stabilisiert,
00:52:16.10, welches das wichtige strukturelle katalytische Element ist und auch einen Argininfinger in das aktive Zentrum liefert.
00:52:23.04 Sie haben eine Gln1-Mutation – jede Mutation von Glutamin 61 ist ein Onkogen
00:52:28.29 weil es dann den katalytischen Rückstand (das System) verfehlt.
00:52:33.00 Sie haben Glycin-Mutanten, die sterisch beeinträchtigt sind, um die GTP-Hydrolyse durchzuführen.
00:52:38.21 Es gibt keine Möglichkeit, dass der Arginin-Finger
00:52:42.06 kann bei einer Mutation von Glycin 12 in die richtige Position gehen.
00:52:46.04 Ich habe Ihnen auch gezeigt, dass es ein stark gebundenes GDP-Pi-Zwischenprodukt gibt.
00:52:50.02 Und diese Pi-Version im System wird ratenbegrenzend.
00:52:54.28 Ohne GAP hingegen ist die chemische Spaltungsreaktion der geschwindigkeitsbestimmende Schritt.
00:53:00.23 Die zweite Schlussfolgerung – allgemeiner zur Ras-Superfamilie.
00:53:05.01 Ras-Proteine ​​sind alle unvollständige Enzyme.
00:53:07.20 Sie alle hydrolysieren GTP sehr, sehr langsam.
00:53:09.27 Sie haben verwandte GAPs.
00:53:12.02 Also jedes der Unterfamilienproteine ​​und manchmal sogar Proteine ​​innerhalb der Unterfamilie,
00:53:16.24 haben eine spezifische verwandte GAP, die für die schnelle GTP-Hydrolyse, für die Katalyse, benötigt wird.
00:53:22.17 Einige GAPs liefern einen Argininfinger
00:53:25.02 und ich habe dir jetzt viele verschiedene Beispiele gezeigt - Ras und Ran und Rho.
00:53:30.15 RabGAPs liefern ein Agrinin und ein Gln.
00:53:34.23 Einige GAPs bieten einen Asn-Daumen.
00:53:37.00 Ich habe dir das Beispiel von RapGAP gezeigt und Tuberin macht wahrscheinlich dasselbe.
00:53:41.03 Pi-Release ist sehr oft geschwindigkeitsbegrenzend.
00:53:44.10 Und was noch wichtiger ist, und das ist meine Botschaft für das ganze Gespräch,
00:53:47.19 ist, dass die gestörte GTPase-Reaktion an einer Reihe von Krankheiten beteiligt ist:
00:53:53.24 Krebs, Neurofibromatose, tuberöse Sklerose,
00:53:58.03 Retinitis pigmentosa und viele mehr, über die ich noch nicht gesprochen habe.
00:54:01.07 Vielen Dank für Ihre Aufmerksamkeit. Aber ich würde.
00:54:03.00 Bevor ich aufhöre, möchte ich zuerst den Leuten danken, die die Arbeit gemacht haben.
00:54:07.18 Die älteste Geschichte, von der ich dir erzählt habe, ist die von Ras und RasGAP.
00:54:11.22, die von drei Postdocs im Labor durchgeführt wurde, Reza Ahmadian, Klaus Scheffzek und Robert Mittal.
00:54:17.23 Die RapGAP-Geschichte stammt von den Studenten Oli Daumke, Astrid Kramer,
00:54:23.14 Partha Chakrabarti und Andrea Scrima.
00:54:26.18 Und die RP2-Geschichte stammt von Stefan Veltel und Karin Kuhnel.
00:54:32.04 Und viele der Filme, die ich dir gezeigt habe, stammen von Ingrid Vetter
00:54:36.20, der auch mein Kristallographie-Labor leitet.
00:54:38.15 Und sie war bei fast allen Projekten sehr, sehr hilfreich.
00:54:42.13 Und das haben wir. auf der FTIR haben wir Kooperationen mit
00:54:46.03 unsere Kollegen von der Uni Bochum Klaus Gerwert und Carsten Kotting.
00:54:51.03 Vielen Dank für Ihre Aufmerksamkeit.
00:54:52.10

  • Teil 1: GTP-bindende Proteine ​​als molekulare Schalter

Warum die Natur Phosphat wählte, um Proteine ​​zu modifizieren

Die vorteilhaften chemischen Eigenschaften der Phosphatester-Verknüpfung wurden früh in der Evolution ausgenutzt, um die Phosphatdiester-Verknüpfungen zu erzeugen, die benachbarte Basen in RNA und DNA verbinden (Westheimer 1987 Wissenschaft235, 1173–1178). Nach der Fixierung des genetischen Codes wurde eine weitere Anwendung der Phosphatestermodifikation gefunden, nämlich die reversible Phosphorylierung der drei Hydroxyaminosäuren Serin, Threonin und Tyrosin in Proteinen. Im Laufe der Evolution hat sich die Phosphorylierung aufgrund ihrer Vielseitigkeit und leichten Reversibilität als eine der prominentesten Arten posttranslationaler Modifikation herausgestellt. Phosphoaminosäuren, die durch Proteinphosphorylierung erzeugt werden, wirken als Neu chemische Einheiten, die keiner natürlichen Aminosäure ähneln, und bieten dadurch ein Mittel zur Diversifizierung der chemischen Natur von Proteinoberflächen. Eine proteingebundene Phosphatgruppe kann entweder intra- oder intermolekular Wasserstoffbrückenbindungen oder Salzbrücken bilden, wodurch stärkere Wasserstoffbrückenbindungen mit Arginin entstehen als mit Aspartat oder Glutamat. Die einzigartige Größe der Ionenhülle und die Ladungseigenschaften von kovalent gebundenem Phosphat ermöglichen eine spezifische und induzierbare Erkennung von Phosphoproteinen durch phosphospezifische Bindungsdomänen in anderen Proteinen, wodurch eine induzierbare Protein-Protein-Wechselwirkung gefördert wird. Auf diese Weise dient die Phosphorylierung als Schalter, der es Signaltransduktionsnetzwerken ermöglicht, Signale als Reaktion auf extrazelluläre Reize zu übertragen.

1. Phosphatester haben vorteilhafte chemische Eigenschaften für die Evolution des Lebens

Phosphathaltige Moleküle sind wesentliche Bestandteile aller lebenden Zellen. Was sind nun die besonderen Eigenschaften von Phosphat, die zu seiner Auswahl als Schlüsselbaustein in der Evolution selbstreplizierender Lebensformen geführt haben? Phosphor ist ein Element der Gruppe 15 und hat daher fünf Elektronen in seiner äußeren Hülle. Phosphor kann durch Abgabe seiner Elektronen fünf kovalente Bindungen eingehen, zum Beispiel durch Verbindung mit vier Sauerstoffatomen bildet Phosphor Orthophosphat, . Phosphat hat drei pKas (2,2, 7,2 (5,8 als Ester) und 12,4) und ist in Wasser sehr gut löslich und bildet eine große hydratisierte Ionenhülle. Phosphat ist chemisch vielseitig und kann mit Alkyl- und Arylhydroxygruppen Mono-, Di- und Triester sowie Säureanhydride bilden. Darüber hinaus kann Phosphor P-N- (Phosphoramidat-), P-S- (Phosphorothioat-) und P-C-(Phosphonat-)Bindungen bilden.

Phosphatsalze kommen auf der Erde sehr häufig vor und waren aufgrund ihrer Wasserlöslichkeit während der Evolution des Lebens leicht verfügbar. Die Fähigkeit von Phosphat, bei Umgebungstemperaturen in Wasser stabile Ester und Anhydride zu bilden, machte es ideal für die Erzeugung biologischer Moleküle. Phosphatester und -anhydride dominieren in lebenden Organismen, aber Phosphoramidate, Phosphorothioate und Phosphonate kommen alle in der Natur vor. Phosphatester werden leicht unter physiologischen Bedingungen unter Verwendung von Adenosintriphosphat (ATP), einem Phosphatanhydrid, als Phosphatdonor und Enzymkatalysator gebildet. Einmal gebildet, sind Phosphatester in wässriger Lösung bei physiologischem pH chemisch stabil und werden dennoch leicht durch einen geeigneten Enzymkatalysator hydrolysiert, wodurch die ursprüngliche OH-Gruppe und das freie Phosphat regeneriert werden. In Zellen umfassen wichtige Phosphatester Nukleinsäuren und Phosphoproteine. Beispiele für biologische Phosphatanhydride sind ATP und PAPS (3'-Phosphoadenosin-5'-phosphosulfat). Obwohl Phosphat selten als Abgangsgruppe in chemischen Synthesen verwendet wird, ist es bei physiologischen Temperaturen in Gegenwart geeigneter enzymatischer Katalysatoren reaktiv. Aufgrund seiner drei pKas ist Phosphat bei pH 7, dem physiologischen intrazellulären pH, dianionisch. Somit weisen Phosphatmonoestergruppen eine volle negative Ladung und eine zweite negative Ladung auf, die je nach chemischem Kontext eine teilweise oder vollständige Ladung sein kann. Phosphatdiester behalten eine vollständige negative Ladung. Wichtig ist, dass, wenn zwei Nukleoside durch einen Phosphatdiester verbunden sind, das Phosphat immer noch vollständig ionisiert ist (pKa < 1), was eine negative Ladung bereitstellt, um Nukleinsäuren in Phospholipidmembranen zurückzuhalten und auch die Esterbindung vor Hydrolyse durch einen Angriff durch anionische Nukleophile zu schützen , wie OH − . Jedes Molekül mit einem Phosphatester, einschließlich phosphorylierter Proteine, hat dieselben Eigenschaften. Die enorme Stabilität von Phosphatestern in Wasser bei pH 7 (Phosphatmonoester haben eine geschätzte Halbwertszeit von 10 12 Jahren bei 25°C [1]) ermöglicht die Bildung sehr langer Polynukleotide, die trotz der großen Anzahl von bemerkenswert stabil sind Phosphatesterbindungen, ein Attribut, das für die langfristige Speicherung genetischer Informationen unerlässlich ist.

2. Die Energetik von Phosphorylierungs- und Dephosphorylierungsreaktionen

Die präbiotische Erzeugung von ATP und anderen Nukleosidtriphosphaten war der Schlüssel zur Bildung von Polynukleotiden und zur Kodierung genetischer Informationen. Die Auswahl von ATP als Hauptenergiespeicherverbindung bedeutete auch die leichte Verfügbarkeit aktivierter Phosphatgruppen für die Übertragung auf andere Moleküle. Aufgrund seiner Energiespeicherfunktion ist ATP in Zellen mit Konzentrationen von typischerweise 2 bis 4 mM sehr reichlich vorhanden. ATP ist bei physiologischem pH-Wert und Temperaturen in Wasser sehr gut löslich und relativ stabil und speichert dennoch erhebliche chemische Energie sowohl in seinen α-β- als auch in seinen β-γ-Phosphatanhydrid-Bindungen, die jeweils freie Hydrolyseenergien von etwa 8-12 kcal mol −1 . aufweisen , abhängig von den ionischen Bedingungen. Sowohl die α-β- als auch die β-γ-Anhydridbindungen können verwendet werden, um wichtige biologische Reaktionen anzutreiben. Allerdings sind solche Reaktionen in vielen Situationen prinzipiell reversibel, da auch Alkyl- und Arylhydroxyphosphatester eine relativ hohe freie Hydrolyseenergie aufweisen (ca. 8–10 kcal mol −1 ). Reaktionen, die eine Spaltung der α-β-Anhydridbindung beinhalten, wie die Polynukleotidsynthese, die Pyrophosphat erzeugen, werden durch die reichlich vorhandene Pyrophosphatase-Aktivität in den meisten Zellen irreversibel. Reaktionen, die eine Spaltung der β-γ-Anhydridbindung beinhalten, wie die Proteinphosphorylierung, werden weitgehend irreversibel, weil die Zellen ein sehr hohes ATP/Adenosindiphosphat (ADP)-Verhältnis aufrechterhalten.

Die Energetik der Phosphorylierung ist relativ ausgeglichen, da die Energie der Phosphatester-Bindung der der ATP-β-γ-Anhydrid-Bindung ähnelt. Tatsächlich reichen die Proteinkinase-Gleichgewichtskonstanten für die (Protein + ATP → P.protein + ADP)-Reaktion von 2 bis 50, und viele Proteinkinasen arbeiten leicht umgekehrt, um ein Phosphoprotein in Gegenwart von ADP zu dephosphorylieren und ATP zu erzeugen [2 –4]. So ist die Phosphorylierung in der Zelle vom hohen ATP/ADP-Verhältnis abhängig, das die Rückreaktion verhindert. Obwohl Phosphatester chemisch ziemlich stabil sind, können sie unter physiologischen Bedingungen leicht durch einen geeigneten Enzymkatalysator hydrolysiert werden. Die relativ hohe Energie von Phosphatmonoestern sorgt dafür, dass sie nach ihrer Hydrolyse nicht durch Reaktion mit freiem Phosphat durch Phosphorolyse wieder gebildet werden können, wodurch die Dephosphorylierung irreversibel wird.

3. Die Evolution der Proteinphosphorylierung

Die vorteilhaften chemischen Eigenschaften der Phosphatester-Verknüpfung wurden schon früh in der Evolution genutzt, wie die Phosphatdiester-Verknüpfung, die benachbarte Basen in RNA und DNA verbindet, veranschaulicht [5]. Nachdem der genetische Code für die 20 gebräuchlichen Aminosäuren festgelegt war, ergab sich eine zweite mögliche Anwendung für die Phosphatestermodifikation, nämlich die Phosphorylierung von Serin (Ser), Threonin (Thr) und Tyrosin (Tyr) Resten in Proteinen als Regulationsmechanismus. Während der Evolution wurde die Phosphorylierung aufgrund ihrer Vielseitigkeit und leichten Reversibilität zu einer der bekanntesten Arten der posttranslationalen Modifikation (PTM). Die Proteinphosphorylierung, die an neun von 20 Aminosäuren in Proteinen auftreten kann, wird unter physiologischen Bedingungen leicht von Proteinkinasen katalysiert, wobei ATP als Phosphatdonor verwendet wird (Guanosintriphosphat (GTP) und Phosphoenolpyruvat (PEP) können auch als Phosphat dienen Spender). Die Phosphorylierung lässt sich leicht durch enzymkatalysierte Hydrolyse durch Proteinphosphatasen rückgängig machen, die die Reaktionsgeschwindigkeit um das Vieltausendfache beschleunigen.

Die Phosphorylierung von Proteinen ist eine der häufigsten PTMs in Eukaryoten. Phosphatester von Ser, Thr und Tyr dominieren in Eukaryoten, aber die Phosphorylierung von sechs anderen Aminosäuren ist chemisch machbar (Arginin (Arg), Lysin (Lys), Histidin (His), Cystein (Cys), Aspartat (Asp) und Glutamin ( Glu)) und ist in vielen Fällen bekannt. Die Phosphorylierung von His, Lys und Arg, um „hochenergetische“ Phosphoramidatbindungen zu erzeugen, könnte unter präbiotischen Bedingungen wichtig gewesen sein. Tatsächlich wird Arg-Phosphat als Energiespeicherverbindung in Pflanzen verwendet. Phosphohistidin (P.His) ist chemisch instabil und hat in wässriger Lösung bei pH 7 eine relativ kurze Halbwertszeit, aber die His-Phosphorylierung wird in höheren Eukaryoten als Regulationsmechanismus verwendet [6]. Darüber hinaus wird P.His als Zwischenprodukt beim Phosphattransfer auf Proteine ​​durch eine Vielzahl von prokaryotischen Zweikomponenten-Signalsystemen verwendet, in denen ein katalytisches Biosensorprotein ein Reaktionsregulatorprotein auf einem Asp phosphoryliert und so ein Signal überträgt, normalerweise transduziert und extrazellulärer Input an der Membran zur Aktivierung eines Transkriptionsfaktors. In diesen Systemen treibt die hohe Energie der P.His-Phosphoramidat-Verknüpfung, die auf dem Biosensor als Reaktion auf die Signaleingabe erzeugt wird, die Kopplung des Phosphats an die β-COOH-Gruppe von Asp, wodurch eine gemischte Anhydrid-Verknüpfung gebildet wird.

4. Warum ist die Proteinphosphorylierung so wichtig?

Das entscheidende Merkmal von Phosphoaminosäuren in Proteinen ist, dass sie als Neu chemische Einheiten, die keiner natürlichen Aminosäure ähneln, und bieten dadurch ein Mittel zur Diversifizierung der chemischen Natur von Proteinoberflächen. Insbesondere die Phosphatgruppe mit ihrer großen hydratisierten Hülle und ihrer negativen Ladung größer als 1 unterscheidet sich chemisch deutlich von den einzigen negativ geladenen Aminosäuren Asp und Glu, deren Carboxylseitenketten nur eine einzige negative Ladung und eine kleinere hydratisierte Schale als Phosphat. Aus diesem Grund wurde vorgeschlagen, dass ein vicinales Paar von Asp- oder Glu-Resten als bessere phospomimetische Mutation dienen könnte als ein einzelnes Asp oder Glu, da dies eine lokale doppelte negative Ladung erzeugen würde [7].

Eine proteingebundene Phosphatgruppe kann entweder intra- oder intermolekular Wasserstoffbrückenbindungen oder Salzbrücken bilden. Insbesondere ist die Phosphatgruppe gut geeignet, um mit der Guanidinogruppe von Arg zu interagieren, die eine starre, planare Struktur hat, die bei physiologischem pH-Wert gerichtete Wasserstoffbrücken zu der doppelt geladenen Phosphatgruppe eingehen kann. Aufgrund der höheren negativen Ladungsdichte und der größeren hydratisierten Hülle bilden Phosphoaminosäuren stärkere und stabilere Wasserstoffbrücken und Salzbrücken als Asp oder Glu mit Arg [8]. Auf diese Weise kann ein einzelnes Phosphat entweder intra- oder intermolekulare Effekte ausüben. Proteinphosphate können sterisch oder ionisch wirken, um die Funktion oder die Wechselwirkung eines anderen Proteins oder kleinen Moleküls zu regulieren, oder häufiger eine Konformationsänderung innerhalb eines Proteinmonomers oder einen allosterischen Übergang innerhalb eines Proteinmultimers hervorzurufen. Die einzigartigen Größen- und Ladungseigenschaften von kovalent gebundenem Phosphat ermöglichen auch die spezifische und induzierbare Erkennung von Phosphoproteinen durch phosphospezifische Bindungsdomänen in anderen Proteinen, wodurch eine induzierbare Protein-Protein-Wechselwirkung gefördert wird. Tatsächlich ist die Fähigkeit eines Phosphats innerhalb eines spezifischen Sequenzkontexts, eine phosphoabhängige Bindungsstelle für ein anderes Protein zu erzeugen, wohl die wichtigste Funktion der Proteinphosphorylierung. Phosphorylierungsabhängige Proteininteraktionen sind entscheidend für die intrazelluläre Signalübertragung, aber Phosphorylierung kann auch eine Veränderung der subzellulären Position eines Proteins bewirken oder ein Phosphodegron erzeugen, was zu einem Ubiquitin-abhängigen Proteinabbau führt.

5. Warum wurde Phosphat anderen Molekülen für die Proteinmodifikation vorgezogen?

Mehrere Elemente in der Nähe von Phosphor im Periodensystem bilden Polyoxyanionen. Sulfat (Schwefel befindet sich neben Phosphor in Gruppe 16) kann auch Aryl- und aromatische Hydroxyester bilden, die eine hohe freie Hydrolyseenergie aufweisen, und es gibt Beispiele für Sulfatester in der Biologie, einschließlich sulfatierter Tyrs in sekretierten Proteinen. Die Energetik der Sulfatierung ist jedoch nicht so günstig, und Sulfat hat nur zwei ionisierbare Sauerstoffatome, die beide einen pKas-Wert unter pH 2 haben, was bedeutet, dass Sulfatmonoester immer eine einzelne negative Ladung behalten. Darüber hinaus fehlt Alkylsulfatdiestern nicht nur eine negative Ladung, sondern sie sind auch instabil und haben die unerwünschte Eigenschaft, biologische Moleküle (z. B. Methylmethansulfonat) zu alkylieren. Orthosilikat (Silizium ist neben Phosphor in Gruppe 14 enthalten) ist auf der Erde ebenfalls sehr reichlich vorhanden, aber sein niedrigster pKa beträgt 9,5, und seine Ester sind in wässriger Lösung extrem instabil.

Aus chemischer Sicht ist Arsenat die plausibelste Alternative zu Phosphat. Arsen gehört wie Phosphor zur Gruppe 15, und Arsenat (V) hat esterbildende Eigenschaften und pKas (2,1, 6,9 und 11,5) ähnlich denen von Phosphat. Arsenat kann wie Phosphat Mono-, Di- und Triester bilden. Arsenattriester und -diester sind jedoch in wässriger Lösung sehr instabil (die Halbwertszeit eines Arsenattriesters beträgt weniger als 0,02 s in Wasser bei pH 7 und Raumtemperatur, und Diester sind noch weniger stabil) [9]. Ebenso würde man erwarten, dass Nukleinsäurevorläufer, wie Adenosintriarsenat, sehr labil sind. Darüber hinaus hat Arsenat unerwünschte chemische Eigenschaften, einschließlich der Reaktion mit Cystein-Thiol-Gruppen. As(V) wird leicht durch freie Thiole reduziert, um As(III)-Trithiolate und oxidierte Dithiole zu erzeugen, was die Grundlage für die Arsen-Toxizität ist. Schließlich sind die As-O-Bindungslängen etwa 10 % länger als die P-O-Bindungslängen, und folglich ist der Radius von etwa 10 % größer als der von . Außerdem ist die negative Teilladung der P-O-Sauerstoffatome etwa 6 Prozent größer als bei As-O. Diese chemischen Unterschiede würden die Struktur und Eigenschaften von Makromolekülen unter Verwendung von Arsenatdiestern als Verknüpfungen verändern.

Aus diesen Gründen war ein kürzlich veröffentlichter Bericht überraschend, in dem behauptet wurde, dass ein aus Mono Lake in Kalifornien, USA, isoliertes Halobakterium Arsenat anstelle von Phosphat verwenden kann [10]. Es wird behauptet, dass Arsenat in DNA, RNA, Lipid und Protein (80% der Gesamtmenge) in diesem Organismus eingebaut wird, basierend auf der Markierung mit radioaktivem Arsenat und verschiedenen Arten von physikalischen Analysen. Die DNA-Analyse zeigte jedoch, dass noch Phosphat in der DNA von Zellen vorhanden war, die aus Zellen isoliert wurden, die in Arsenat-Medium ohne zugesetztes Phosphat gewachsen waren, vermutlich abgeleitet von verunreinigendem Phosphat in Chemikalien, die im Wachstumsmedium verwendet wurden. Es wurden keine direkten Beweise dafür vorgelegt, dass die DNA Arsenat-Diester-Bindungen aufweist oder dass Proteine ​​an Ser, Thr und Tyr arsenyliert sind.Eine weitere Analyse dieses Organismus ist erforderlich, um festzustellen, inwieweit Arsenat Phosphat ersetzen kann, um das Leben zu erhalten und Proteine ​​​​durch Veresterung zu modifizieren [9].

6. Coda

Die Phosphatgruppe hat besondere Eigenschaften, die ausgenutzt werden können, um kritische biologische Funktionen zu regulieren, wenn sie an Proteine ​​gebunden sind. Die Phosphatgruppe dient als Schalter zur Förderung induzierbarer Protein-Protein-Wechselwirkungen, wodurch Signaltransduktionsnetzwerke transiente Signale als Reaktion auf extrazelluläre Stimuli übertragen können. Phosphat besitzt nahezu ideale chemische Eigenschaften zur Bildung biologischer Polymere und insbesondere zur Modifizierung von Proteinen. Das Leben, wie wir es kennen, hätte sich ohne Phosphat nicht entwickeln können.


Danksagung

Die Autoren bedanken sich bei folgenden Personen und Institutionen:

Prof. Iliakis (Universitätsklinikum Essen, Essen, Deutschland) für die Bereitstellung der Daten für das DNA-Protein-Interaktionsexperiment (Abb. 6) Karsten Meyenberg und Prof. Ulf Diederichsen (Institut für Organische und Biomolekulare Chemie, Georg-August-Universität Göttingen, Göttingen, Deutschland), Geert van den Bogaart und Reinhard Jahn (Max-Planck-Institut für biophysikalische Chemie, Göttingen, Deutschland) für die Liposomenexperimente (Abb. 7) und Krishna Saxena (Johann Wolfgang Goethe-Universität, Frankfurt, Deutschland) für die p38-Inhibitor- und Tracer-Bindungsstudien (Feigen. 3 und 4). Die katalytische Untereinheit von PKA und der hitzestabile Inhibitor PKI waren freundliche Geschenke von F. W. Herberg (Universität Kassel, Kassel, Deutschland) und B. Zimmermann (Biaffin GmbH & Co KG, Kassel, Deutschland) (Abb. 5) unterstützt durch das EU-RP7-Verbundprojekt Affinity Proteome (Vertrag 222635).

Sergey Tarasov (NCI Frederick) wird für fruchtbare Diskussionen über biomolekulare Interaktionsstudien gedankt.

Die Experimente detailliert in Abb. 6 wurden am Institut für Medizinische Strahlenbiologie der Universität Duisburg-Essen, Essen, Deutschland, durchgeführt.

Die Arbeit wurde gefördert durch das Bundesministerium für Bildung und Forschung, Deutschland, Hightech-Strategie „KMU-Innovativ: Biotechnologie-Biochance“ (Fördernummer: FKZ 0315376).

Center for Nanoscience (CeNS) und die Nanosystems Initiative Munich (NIM) haben diese Arbeit unterstützt.


Schau das Video: Proteine - Bau u0026 Struktur einfach erklärt - Genetik u0026 Stoffwechselbiologie (Kann 2022).