Information

Erhalten PCR-Amplifikation beim Annealing höher als Tm!

Erhalten PCR-Amplifikation beim Annealing höher als Tm!


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ich amplifiziere ein Gen, bei dem ich in einer Gradienten-PCR eine Amplifikation bei einer Annealing-Temperatur erhalte, die etwa 5 Grad (67) höher ist als Tm (62,5)? Was ist hier falsch? Außerdem erhalte ich ein sehr starkes, intensives Band bei falscher Größe für alle Temperaturen, die unter Tm getestet wurden. Bitte hilfe


Es ist sehr üblich, dass das Tempern bei einer höheren als der vorhergesagten Tm erfolgt. Wenn dies in Ihrem Fall ein Problem darstellt, insbesondere wenn Sie bei niedrigeren Temperaturen ein Fehl-Annealing bekommen, ziehen Sie die Verwendung von Touchdown-PCR in Betracht, um eine optimale Temperatur zu finden. Oder ganz pragmatisch, wenn Sie beim Primer-Design flexibel sind, bestellen Sie einfach einen Satz Primer und probieren Sie alle aus. Primer sind heute billig, und Sie werden oft ein Set finden, das funktioniert, selbst wenn die Designprogramme behaupten, dass dies nicht der Fall ist.


Die Tm von Primern würde nicht viel über die PCR-Bedingungen aussagen. Wenn Sie unspezifische Bänder erhalten, lohnt es sich, eine höhere Temperatur auszuprobieren.

Ihr Temp-Versuch liegt bereits in der Nähe der zu verlängernden Temperatur, sodass Shuttle-PCR verfügbar ist. Die Shuttle-PCR hat nur 2 Schritte: 94 bis 96 Grad für das Schmelzen der DNA und 68 bis 74 Grad für das Anlagern und Verlängern zusammen.

Vielleicht möchten Sie DMSO oder Betain hinzufügen. Sie könnten dazu beitragen, Fehlglühungen zu reduzieren. Wenn die unspezifischen Banden kleiner und länger als die erwarteten Banden sind, können längere bzw. kürzere Verlängerungszeiten zu besseren Ergebnissen führen.

Und denken Sie daran, dass auch das Primer-Design wichtig ist. Überprüfen Sie, ob sich Sequenzen in Ihrem Template wiederholen, und vermeiden Sie es, Primer aus solchen Sequenzen zu entwerfen.


In Bezug auf eine höhere Annealing-Temperatur als Tm verwende ich oft T7-Primer, von denen Tm 48,3 Grad beträgt. Der Primer funktioniert gut bei 55 Grad Annealing-Temperatur. Normalerweise sind Primer in PCR-Reaktionsgefäßen im Überschuss vorhanden, wodurch das chemische Gleichgewicht in Richtung Annealing verschoben wird. Das ist, was ich spekuliere.


Die TM der Grundierung wird auch von der Salzkonzentration Ihrer Mischung beeinflusst. Versuchen Sie den PCR-Gradienten? Oder Sie versuchen die Berechnung von Tm und berücksichtigen die Salzkonzentration. http://www.biophp.org/minitools/melting_temperature/demo.php


Touchdown-PCR: Ein Primer und einige Tipps

Als ich zum ersten Mal von Touchdown-PCR hörte, dachte ich an ein landendes Flugzeug, was, wie sich herausstellte, keine schlechte Art ist, darüber nachzudenken.

Aber trotz ihrer Anfälligkeit für Analogien und schreckliche Wortspiele (siehe Titel) ist die Touch-down-PCR (TD-PCR), eine sehr nützliche Technik zur Verbesserung der PCR-Amplifikationsspezifität, schwieriger, als es auf den ersten Blick erscheinen mag. In diesem Artikel werde ich daher eine Einführung in die Touchdown-PCR (TD-PCR) sowie einige Tipps und Referenzen zur Perfektionierung geben.


QPCR und RT-qPCR

Quantitative Endpunkt-PCR

PCR und RT-PCR werden im Allgemeinen in einem qualitativen Format verwendet, um biologische Proben zu bewerten. Eine Vielzahl von Anwendungen, wie die Bestimmung der Viruslast, die Messung von Reaktionen auf therapeutische Mittel und die Charakterisierung der Genexpression, würden jedoch durch die quantitative Bestimmung der Zielhäufigkeit verbessert. Theoretisch sollte dies angesichts der exponentiellen Natur der PCR leicht zu erreichen sein, da zwischen der Anzahl der Amplifikationszyklen und dem Logarithmus der Anzahl der Moleküle ein linearer Zusammenhang besteht. In der Praxis wird die Amplifikationseffizienz jedoch aufgrund von Verunreinigungen (Inhibitoren), kompetitiven Reaktionen, Substraterschöpfung, Polymerase-Inaktivierung und Target-Reannealing verringert. Mit zunehmender Zyklenzahl nimmt die Amplifikationseffizienz ab, was schließlich zu einem Plateaueffekt führt.

Normalerweise erfordert die quantitative PCR, dass Messungen vor der Plateauphase durchgeführt werden, damit die Beziehung zwischen der Anzahl der Zyklen und den Molekülen relativ linear ist. Dieser Punkt muss aufgrund der zahlreichen Faktoren, die die Amplifikationseffizienz beeinflussen können, für verschiedene Reaktionen empirisch bestimmt werden. Da die Messung vor dem Reaktionsplateau erfolgt, verwendet die quantitative PCR weniger Amplifikationszyklen als die grundlegende PCR. Dies kann zu Problemen bei der Erkennung des Endprodukts führen, da weniger Produkt zu erkennen ist.

Um die Amplifikationseffizienz zu überwachen, sind viele Anwendungen so konzipiert, dass sie einen internen Standard in die PCR einschließen. Ein solcher Ansatz umfasst ein zweites Primerpaar, das für ein &ldquohousekeeping&rdquo-Gen (d. h. ein Gen, das unter den verglichenen Proben konstante Expressionsniveaus aufweist) in der Reaktion spezifisch ist (Gaudette und Crain, 1991, Murphy). et al. 1990). Die Amplifikation von Housekeeping-Genen bestätigt, dass die Zielnukleinsäure und die Reaktionskomponenten von akzeptabler Qualität waren, berücksichtigt jedoch keine Unterschiede in der Amplifikationseffizienz aufgrund von Unterschieden in der Produktgröße oder der Primer-Annealing-Effizienz zwischen dem internen Standard und dem quantifizierten Ziel.

Das Konzept der kompetitiven PCR und Variation der quantitativen PCR ist eine Reaktion auf diese Einschränkung. Bei der kompetitiven PCR wird der Reaktion eine bekannte Menge einer Kontrollmatrize zugesetzt. Diese Matrize wird unter Verwendung des gleichen Primerpaars wie das experimentelle Zielmolekül amplifiziert, liefert jedoch ein unterscheidbares Produkt (z. B. unterschiedliche Größe, Restriktionsverdaumuster usw.). Die Mengen an Kontrolle und Testprodukt werden nach der Amplifikation verglichen. Während diese Ansätze die Qualität der Zielnukleinsäure, der Pufferkomponenten und der Primer-Annealing-Effizienz kontrollieren, haben sie ihre eigenen Grenzen (Siebert und Larrick, 1993 McCulloch et al. 1995), einschließlich der Tatsache, dass viele von der endgültigen Analyse durch Elektrophorese abhängig sind.

Es existieren zahlreiche Fluoreszenz- und Festphasen-Assays, um die Menge des in jeder Reaktion erzeugten Amplifikationsprodukts zu messen, aber sie können oft nicht die interessierende amplifizierte DNA von unspezifischen Amplifikationsprodukten unterscheiden. Einige dieser Analysen beruhen auf Blotting-Techniken, die aufgrund der Effizienz des Nukleinsäuretransfers eine weitere Variable einführen, während andere Assays entwickelt wurden, um die Notwendigkeit einer Gelelektrophorese zu eliminieren und dennoch die erforderliche Spezifität bereitzustellen. Die Echtzeit-PCR, die die Möglichkeit bietet, die Ergebnisse jedes Amplifikationszyklus anzuzeigen, ist eine beliebte Methode, um die Notwendigkeit einer Analyse durch Elektrophorese zu überwinden.

Quantitative Real-Time-PCR

Die Verwendung von fluoreszenzmarkierten Oligonukleotidsonden oder Primern oder fluoreszierenden DNA-bindenden Farbstoffen zum Nachweis und zur Quantifizierung eines PCR-Produkts ermöglicht die Durchführung einer quantitativen PCR in Echtzeit. Speziell entwickelte Instrumente führen sowohl thermische Zyklen durch, um das Ziel zu amplifizieren, als auch Fluoreszenzdetektion, um die Ansammlung von PCR-Produkten zu überwachen. DNA-bindende Farbstoffe sind einfach anzuwenden, unterscheiden jedoch nicht zwischen spezifischen und unspezifischen PCR-Produkten und sind für Multiplex-Reaktionen nicht förderlich. Fluoreszierend markierte Nukleinsäuresonden haben den Vorteil, dass sie nur mit spezifischen PCR-Produkten reagieren, sie können jedoch teuer und schwierig zu entwerfen sein. Einige qPCR-Technologien verwenden fluoreszenzmarkierte PCR-Primer anstelle von Sonden.

Die Verwendung von fluoreszierenden DNA-bindenden Farbstoffen ist einer der einfachsten qPCR-Ansätze. Der Farbstoff wird einfach der Reaktion zugesetzt und die Fluoreszenz wird bei jedem PCR-Zyklus gemessen. Da die Fluoreszenz dieser Farbstoffe in Gegenwart von doppelsträngiger DNA dramatisch zunimmt, kann die DNA-Synthese als Zunahme des Fluoreszenzsignals verfolgt werden. Allerdings müssen oft Vorarbeiten geleistet werden, um sicherzustellen, dass die PCR-Bedingungen nur ein bestimmtes Produkt liefern. In nachfolgenden Reaktionen kann die spezifische Amplifikation durch eine Schmelzkurvenanalyse verifiziert werden. Thermische Schmelzkurven werden erzeugt, indem das gesamte Produkt bei einer niedrigeren Temperatur (ungefähr 60 °C) doppelsträngige DNA bilden kann und die Temperatur langsam auf denaturierende Werte (ungefähr 95 °C) erhöht wird. Die Produktlänge und -sequenz beeinflussen die Schmelztemperatur (Tm), daher wird die Schmelzkurve verwendet, um die Homogenität des Amplikons zu charakterisieren. Unspezifische Amplifikation kann durch breite Peaks in der Schmelzkurve oder Peaks mit unerwarteten Tm-Werten identifiziert werden. Durch die Unterscheidung spezifischer und unspezifischer Amplifikationsprodukte fügt die Schmelzkurve einen Aspekt der Qualitätskontrolle während des Routineeinsatzes hinzu. Die Erstellung von Schmelzkurven ist mit Assays, die auf der 5&prime&rarr3&prime-Exonukleaseaktivität der Taq-DNA-Polymerase beruhen, wie der Sonden-basierten TaqMan®-Technologie, nicht möglich.

Einige qPCR-Strategien verwenden komplementäre Nukleinsäuresonden, um das DNA-Ziel zu quantifizieren. Diese Sonden können auch verwendet werden, um Einzelnukleotidpolymorphismen (Lee et al. 1993 Bernhard et al. 1998). Es gibt mehrere allgemeine Kategorien von Echtzeit-PCR-Sonden, einschließlich Hydrolyse-, Haarnadel- und einfache Hybridisierungssonden. Diese Sonden enthalten eine komplementäre Sequenz, die es der Sonde ermöglicht, an das akkumulierende PCR-Produkt anzulagern, aber die Sonden können sich in der Anzahl und Position der fluoreszierenden Reporter unterscheiden.

Hydrolysesonden sind mit einem Fluor am 5&prime-Ende und einem Quencher am 3&prime-Ende markiert, und da die beiden Reporter in unmittelbarer Nähe sind, wird das Fluoreszenzsignal gelöscht. Während des Annealing-Schritts hybridisiert die Sonde an das PCR-Produkt, das in vorherigen Amplifikationszyklen erzeugt wurde. Das resultierende Sonde:Ziel-Hybrid ist ein Substrat für die 5&prime&rarr3&prime-Exonuklease-Aktivität der DNA-Polymerase, die die angelagerte Sonde abbaut und den Fluor freisetzt (Holland et al. 1991). Der Fluor wird von den Wirkungen des energieabsorbierenden Quenchers befreit und der Reaktionsfortschritt und die Akkumulation von PCR-Produkt wird durch die resultierende Zunahme der Fluoreszenz verfolgt. Bei diesem Ansatz müssen vor den Quantifizierungsexperimenten Vorversuche durchgeführt werden, um zu zeigen, dass das erzeugte Signal proportional zur Menge des gewünschten PCR-Produkts ist und dass keine unspezifische Amplifikation auftritt.

Haarnadelsonden, auch als Molecular Beacons bekannt, enthalten invertierte Wiederholungen, die durch eine zur Ziel-DNA komplementäre Sequenz getrennt sind. Die Wiederholungen annealen, um eine Haarnadelstruktur zu bilden, bei der das Fluor am 5&prime-Ende und ein Quencher am 3&prime-Ende nahe beieinander liegen, was zu einem geringen Fluoreszenzsignal führt. Die Haarnadelsonde ist so konstruiert, dass die Sonde bevorzugt an die Ziel-DNA bindet, anstatt die Haarnadelstruktur beizubehalten. Während die Reaktion fortschreitet, hybridisieren zunehmende Mengen der Sonde mit dem sich ansammelnden PCR-Produkt, und als Ergebnis werden der Fluor und der Quencher physikalisch getrennt. Der Fluor wird nicht mehr gelöscht und die Fluoreszenz nimmt zu. Ein Vorteil dieser Technik besteht darin, dass Haarnadelsonden weniger wahrscheinlich fehlpassen als Hydrolysesonden (Tyagi et al. 1998). Es müssen jedoch Vorversuche durchgeführt werden, um zu zeigen, dass das Signal spezifisch für das gewünschte PCR-Produkt ist und keine unspezifische Amplifikation stattfindet.

Die Verwendung einfacher Hybridisierungssonden umfasst zwei markierte Sonden oder alternativ eine markierte Sonde und einen markierten PCR-Primer. Beim ersten Ansatz wird die vom Fluor an einer Sonde emittierte Energie von einem Fluor an der zweiten Sonde absorbiert, die in der Nähe hybridisiert. Beim zweiten Ansatz wird die emittierte Energie von einem zweiten Fluor absorbiert, das als Teil des Primers in das PCR-Produkt eingebaut wird. Beide dieser Ansätze führen zu einer erhöhten Fluoreszenz des Energieakzeptors und einer verringerten Fluoreszenz des Energiedonors. Die Verwendung von Hybridisierungssonden kann noch weiter vereinfacht werden, so dass nur eine markierte Sonde benötigt wird. Bei diesem Ansatz wird das Löschen des Fluors durch Desoxyguanosin verwendet, um eine Änderung der Fluoreszenz herbeizuführen (Crockett und Wittwer, 2001, Kurata et al. 2001). Die markierte Sonde annealt, so dass sich der Fluor in unmittelbarer Nähe zu den G-Resten innerhalb der Zielsequenz befindet, und wenn die Sonden-Annealing zunimmt, nimmt die Fluoreszenz aufgrund des Desoxyguanosin-Quenchings ab. Bei diesem Ansatz ist die Position der Sonde begrenzt, da die Sonde hybridisieren muss, so dass der Fluoreszenzfarbstoff sehr nahe einem G-Rest ist. Der Vorteil einfacher Hybridisierungssonden besteht darin, dass sie durch die Verwendung unterschiedlich gefärbter Fluors und Sonden mit unterschiedlichen Schmelztemperaturen leichter gemultiplext werden können als Hydrolyse- und Haarnadelsonden (Übersicht in Wittwer et al. 2001).

Einige qPCR-Strategien verwenden komplementäre Nukleinsäuresonden, um das DNA-Ziel zu quantifizieren. Diese Sonden können auch verwendet werden, um Einzelnukleotidpolymorphismen (Lee et al . 1993 Bernhard et al . 1998). Es gibt mehrere allgemeine Kategorien von Echtzeit-PCR-Sonden, einschließlich Hydrolyse-, Haarnadel- und einfache Hybridisierungssonden. Diese Sonden enthalten eine komplementäre Sequenz, die es der Sonde ermöglicht, an das akkumulierende PCR-Produkt anzulagern, aber die Sonden können sich in der Anzahl und Position der fluoreszierenden Reporter unterscheiden.

QPCR-Produkte und -Ressourcen

GoTaq® qPCR- und RT-qPCR-Kits sind für farbstoffbasierte oder sondenbasierte Echtzeit-PCR-Ansätze erhältlich. GoTaq qPCR-Systeme enthalten BRYT Green Dye, das eine maximale Amplifikationseffizienz und eine höhere Fluoreszenz als SYBR Green bietet.

GoTaq®-Sondensysteme sind gebrauchsfertige Master-Mixe, die den Reaktionsaufbau für die auf Hydrolysesonden basierende Detektion vereinfachen.


Warum sollten Primer keine Tm-Differenz von mehr als 5 °C aufweisen? - (29.09.2011)

Tm für meine Vorwärts-Primer ist 73C und für die Rückwärts-Primer 53C.

Grundierung F
TGCAGGCGCCCCGAGTGCTGC

Grundierung R
CGTCACTAGTGTCGTCTACTA

Abgesehen von der Tatsache, dass Tm 73C sogar höher ist als die Extensionstemperatur (68C für pfx DNA Polymerase), sagen mir die Tm-Rechner, dass der Unterschied zwischen den Tm-Temperaturen größer als die empfohlenen 5C ist und daher die PCR nicht funktioniert.

Tm sagt Ihnen, bei welcher Temperatur die Hälfte Ihres Primers geschmolzen ist (d. h. keine Template-DNA bindet). Ta wird niedriger als Tm gewählt, sodass die meisten Ihrer Primer die DNA binden. Je niedriger Sie mit der Temperatur gehen, desto größer ist die Chance, dass Ihr Primer unspezifisch (an nicht komplementäre Sequenzen) bindet. Sie müssen also die richtige Annealing-Temperatur wählen, nicht so hoch (keine Amplifikation) nicht so niedrig (unspezifisch).
Wenn Sie Primer mit so unterschiedlicher Tm haben, können Sie keine optimale Temperatur für die Bindung beider Primer haben.
IMO.

Aber besteht eine Chance, dass es funktioniert?

Es gibt immer Chancen. Es gibt viele Möglichkeiten, Tm zu berechnen, und einige von ihnen unterscheiden sich stark. Und die wirkliche Situation hängt auch von der Vorlage ab und wer weiß was noch.
Aber ich wäre nicht zu optimistisch, es sind 20 Grad. Ihre F-Primersequenz ist hochgradig selbstkomplementär, sodass Sie ein höheres Ta benötigen würden, um sie zu entspannen, aber zu diesem Zeitpunkt würde Ihr R-Primer wahrscheinlich die DNA überhaupt nicht binden.
Sie können es versuchen, aber wenn es nicht funktioniert, wäre es wahrscheinlich schneller und billiger, neue Primer zu entwerfen.

Ich verstehe den Punkt, den Trof zu vertreten versucht, und stimme zu, dass ich versuchen würde, verschiedene Primer mit näheren Tm-Werten neu zu entwerfen, wenn die PCR nicht funktioniert und Sie die Möglichkeit haben. Zum Beispiel könnten Sie den letzten "GC" von Ihrem Vorwärtsprimer nehmen und das würde Ihren Tm um etwa 8 Grad senken. Davon abgesehen hatte ich Situationen, in denen ich keine Wahl hatte, zwei Primer mit stark unterschiedlichen Tm-Werten zu verwenden, und die PCR funktionierte gut. Sie müssen immer innerhalb der Grenzen Ihres niedrigsten Tm-Primers arbeiten, was bedeutet, dass Sie wahrscheinlich eine Annealing-Temperatur von 50-54 Grad verwenden müssen. Darüber hinaus habe ich festgestellt, dass Sie bei der Arbeit mit Primern mit hoher Tm möglicherweise Ihren Denaturierungsschritt verlängern möchten. Die meisten Polymerasen haben einen empfohlenen Zeitbereich (z. B. 95 Grad für 10-30 s). Wenn ich einen Primer mit einem Tm über 65 habe, erweitere ich normalerweise meinen Denaturierungsschritt beim Radfahren auf 30 Grad und finde, dass es hilft.

Die Gradienten-PCR schlug fehl. Ich habe die Temps von 40 ° C auf 65 ° C eingestellt, aber es hat keine Band erzeugt. Ich habe auch eine 2-Schritt-PCR durchgeführt, ich habe mit der von allynspear empfohlenen Denaturierungszeit gespielt, aber es ist auch fehlgeschlagen. Ich denke, ich werde neue Primer entwerfen.


Wie berechnet man die Annealing-Temperatur für die PCR?

Die Glühtemperatur (Tein) für die PCR gewählt wird, hängt direkt von der Länge und Zusammensetzung der Primer ab. Im Allgemeinen sollten Sie eine Glühtemperatur von etwa 5 °C unter der T . verwendenm deiner Primer. Die optimale Glühtemperatur (Tein Opt) für ein gegebenes Primerpaar auf einem bestimmten Ziel kann wie folgt berechnet werden: Tein Opt = 0,3 x (Tm der Grundierung) + 0,7 x (Tm des Produkts) &ndash 14.9 wobei Tm des Primers ist die Schmelztemperatur des weniger stabilen Primer-Template-Paares und Tm des Produkts ist die Schmelztemperatur des PCR-Produkts [1].

Eine Folge davon, dass Tein zu niedrig ist, dass einer oder beide Primer an andere Sequenzen als das beabsichtigte Ziel anlagern, da interne Fehlpaarungen einzelner Basen oder teilweises Anlagern toleriert werden können. Dies kann zu einer unspezifischen PCR-Amplifikation führen und reduziert folglich die Ausbeute des gewünschten Produkts. Umgekehrt, wenn Tein ist die Reaktionseffizienz zu hoch, kann dies verringert werden, da die Wahrscheinlichkeit des Primer-Annealings signifikant verringert wird. Optimale Annealing-Temperaturen ergeben die höchste Produktausbeute des richtigen Amplikons.


High-Speed ​​qPCR – 5 Wege, um Ihre qPCR schneller zu machen

Dies sind nicht die üblichen Tipps wie das Aliquotieren von Primern, die Verwendung von ausgewiesenen Bereichen (Drei-Raum-Regel) und Ausrüstung für die Prä- und Post-Amplifikationsschritte, um das Risiko von Kontaminationen zu reduzieren. Lassen Sie uns also darauf eingehen!

1. Wählen Sie einen höheren GC-Inhalt für Ihre Vorlage – die qPCR-Geschwindigkeit hängt davon ab

Es ist möglicherweise nicht immer machbar, aber wenn möglich, wählen Sie Amplikons mit höhere GC-Gehalte. Die durchschnittliche Verlängerungsrate für Guanin (G) und Cytosin (C) betrug 2,8-fach höher als für Adenin (A) und Thymin (T) bei Temperaturen bis 75°C. Der optimale GC-Gehalt liegt bei ungefähr 60%. Hier wurden die höchsten Dehnungsraten zwischen 70 °C und 75 °C beobachtet (bei Temperaturen unter 70 °C und über 75 °C zeigten die Dehnungsraten eine fast lineare Abnahme).

Bei Templates mit einem geringen GC-Gehalt oder einem GC-Gehalt von mehr als 60 % nehmen die Extensionsraten ab. Hier wirkt sich ein hoher GC-Gehalt stärker aus als ein niedriger GC-Gehalt, wahrscheinlich aufgrund der Bildung von Sekundärstrukturen im Ausdehnungsbereich.

Es ist jedoch entscheidend, Testen Sie verschiedene GC-Inhalte für die verwendete Polymerase. Die native und eine Deletionsvariante der Taq-Polymerase zeigten bei steigendem GC-Gehalt erhöhte Extensionsraten (bis ca et al., 2014).

Insgesamt lohnt es sich zu prüfen, ob ein höherer GC-Gehalt des Amplikons die Verlängerungszeit jedes Zyklus verkürzen könnte.

2. Wählen Sie den Mastermix für Ihre qPCR mit Bedacht

Wenn es um Geschwindigkeit geht, ist die Nutzung von dUTP als Ersatz für dTTP im Mastermix sollte vermieden werden. Die Aufnahme von Uracil (U) ist im Durchschnitt 50% langsamer als von T bei Temperaturen bis 65°C. Die Erhöhung der U-Konzentration im Mastermix hatte keinen positiven Einfluss auf die Einarbeitungsrate, sondern reduzierte sie sogar (Montgomery et al., 2014).

Auch der pH der Reaktion beeinflusst die Extensionsgeschwindigkeiten stark. Der ideale Bereich ist jedoch schmal und liegt zwischen pH 8,5 und pH 8,7. Unter pH 8,5 nehmen die Extensionsraten deutlich ab: ca. 60 % mit jeder pH-Einheit. Oberhalb des idealen pH-Bereichs nehmen die Extensionsraten noch deutlicher ab und werden bei pH 7 fast vollständig gehemmt (Montgomery et al., 2013).

Andere Faktoren mit hohem Einfluss auf die Verlängerungsrate sind Magnesiumchlorid (MgCl 2 ) und Kaliumchlorid (KCL)-Konzentrationen. Hohe MgCl 2 -Konzentrationen von 3 bis 6 mM führen zu höheren Extensionsraten. Insbesondere ein 1,5 mM MgCl 2 Es wurde festgestellt, dass die Konzentration zu ca 50 % Ermäßigung der Extensionsrate im Vergleich zu einer Konzentration von 5 mM.

Hohe Konzentrationen von KCl, jedoch, hemmen stark die Polymeraseaktivität. Bei einer KCl-Konzentration von 37,5 mM wurde eine Verringerung der Extensionsrate um mehr als 70 % im Vergleich zu 0 mM beobachtet. Die größte Polymeraseaktivität wurde gefunden, wenn KCl fehlt oder die niedrigste Konzentration aufweist (Montgomery et al., 2013 Montgomery und Wittwer, 2014).

Wenn der GC-Gehalt des Amplikons höher ist, wird die Zugabe von DMSO bei 5% oder 7,5% kann die Amplifikation durch Verringerung der Sekundärstrukturen verbessert werden. Es wurde jedoch festgestellt, dass die Verwendung von 10 % DMSO die Verlängerungsraten verringert (Montgomery et al.,2014 Montgomery und Wittwer, 2014)!

Daher ist es für die qPCR-Geschwindigkeit unerlässlich, den pH-Wert sowie die MgCl 2 - und KCl-Konzentrationen des Mastermixes anzupassen.

Ein weiterer zu berücksichtigender Punkt ist die Auswahl der entsprechende Farbstoffkonzentration für qPCR-Reaktionen. Nichtkovalente Farbstoffe verringern die Extensionsgeschwindigkeiten und eine niedrigere Konzentration dieser Farbstoffe beschleunigt nachweislich die Extension. Niedrigere Farbstoffkonzentrationen führen jedoch zu geringeren Signalstärken und können nur verwendet werden, wenn die Empfindlichkeit des optischen Sensors des qPCR-Cyclers groß genug ist (Montgomery und Wittwer, 2014). Der Beweis für den Pudding liegt also im Essen.

3. Reduzieren Sie die Zykluszeit und minimieren Sie die Temperaturunterschiede der

Schritte in Ihrer qPCR

Die Laufzeit einer qPCR hängt stark von den Anstiegsraten ab, das ist die Zeit, die der Cycler benötigt, um zwischen den Temperaturen zu wechseln. Eine Reduzierung der Temperaturunterschiede kann durchaus Auswirkungen haben!

Es hat sich gezeigt, dass erfolgreiche PCR-Ergebnisse mit fairen breite Zeitbedingungen und Temperaturbereich. Bustin (2017) testete sechs verschiedene qPCR-Cycling-Bedingungen für sechs zufällig ausgewählte Gene in einer Brustkrebszelllinie (MCF-7) auf zwei verschiedenen qPCR-Cycler. Denaturierungszeit und -temperaturen sowie Annealing-/Extensionszeit und -temperatur wurden recht breit variiert (Tabelle 1) und erzeugten (überraschenderweise) ungefähr die gleiche Anzahl von Quantifizierungszyklen (Cqs), auch Schwellenzyklus (Ct) genannt.

Tabelle 1: Unterschiedliche qPCR-Reaktionsbedingungen für Assays, die parallel auf zwei verschiedenen qPCR-Cyclern durchgeführt wurden.

Denaturierung Annealing/Polymerisation

95 °C für 5 Sekunden 60 °C für 15 Sekunden

93°C für 1 Sekunde 60°C für 5 Sekunden

93°C für 1 Sekunde 60°C für 1 Sekunde

90°C für 1 Sekunde 60°C für 15 Sekunden

90°C für 1 Sekunde 60°C für 1 Sekunde

88°C für 1 Sekunde 60°C für 1 Sekunde

Die Schmelzkurvenanalyse zeigte, dass die gleichen Amplikons unter allen unterschiedlichen Bedingungen produziert wurden, mit Ausnahme von Ubiquitin C auf einem der Cycler.

Zusammenfassend hat dies gezeigt, dass gute qPCR-Ergebnisse erhältlich mit niedrigere Denaturierungstemperaturen und kürzere Denaturierungs- und Annealing-/Extension-Zeiten! Die Zeit, um einen 40-Zyklen-Lauf mit angepassten Bedingungen wie beschrieben durchzuführen, dauerte nur etwa 60% der Zeit eines Laufs mit Standardbedingungen (Bustin, 2017).

4. Wählen Sie zuverlässige und getestete Designtools für den perfekten PCR-Primer und

qPCR-Assays

Eurofins Genomics' zuverlässig und bewährt Design-Tools für PCR-Primer basieren auf „Prime+“ des GCG Wisconsin Package, das ursprünglich von Irv Edelman geschrieben wurde und um zusätzliche Parameter für perfektes PCR-Primer- und Sondendesign.

Bei der Auswahl geeigneter PCR-Primer/Sonden-Kombinationen für Genotypisierungs- und Genexpressionsassays werden eine Vielzahl von Einschränkungen für PCR-Primer, Sonde und amplifiziertes Produkt berücksichtigt und teilweise als Standardwerte in unserem qPCR-Assay-Design vordefiniert. Für die bi-plex Beim Design des qPCR-Assays werden alle Primer und Sonden erneut gegeneinander abgeglichen. Die Ergebnisse werden nach den besten vorhergesagten Leistungskriterien bewertet.

Für Ihre Bequemlichkeit können Sie direkt bestellen die ausgewählten PCR-Primer-Paare oder PCR-Primer/Sonden-Kombinationen in unserem Shop.

5. Schnelle PCR-Primer zur Beschleunigung Ihres qPCR-Projekts

Eurofins Genomics hohe Qualität NightXpress (q)PCR-Primer erhöht den Abschluss Ihres qPCR-Projekts. Bestellen Sie noch heute und sie werden geliefert in weniger als 24 Stunden! Sie können also fast sofort mit Ihrer qPCR-basierten Untersuchung beginnen.

(q)PCR Primer NightXpress ist für jede Art von Standard- und Echtzeit-PCR geeignet. Wir garantieren genaue und zuverlässige Primermengen mit hoher Reinheit. Außerdem ergibt die niedrige Salzkonzentration dieser Primer stabile Schmelztemperaturen (Tm).

Bonus-Tipp, um die Veröffentlichung Ihrer qPCR-Ergebnisse zu beschleunigen:

Verwenden Sie die MQE-Richtlinien

Die Mindestinformationen für die Veröffentlichung von quantitativen Real-Time-PCR-Experimenten (MIQE) Richtlinien bieten Methoden für das Design von qPCR-Experimenten, um die Konsistenz bei der Veröffentlichung von Daten zu gewährleisten. Die Einhaltung dieser Richtlinien hilft bei der Generierung zuverlässiger qPCR-Daten, die vergleichbar und reproduzierbar sind (Konsistenz zwischen den Experimenten) (Bustin et al., 2009). Es wird auch dazu beitragen, Ihre Daten veröffentlicht.

Von Dr. Andreas Ebertz

- Bustin, S.A. (2017) Wie man die Polymerase-Kettenreaktion beschleunigt. Biomol Detect Quantif. 12: 10-4.

- Bustin, SA, Benes, V., Garson, JA, Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, MW, Shipley, GL, Vandesompele, J ., Wittwer, CT

(2009)Die MIQE-Richtlinien: Mindestinformationen für die Veröffentlichung quantitativer Real-Time-PCR-Experimente. Klin. Chem.-Nr. 55(4): 611–22.


PCR – reduzierte Bindungseffizienz bei niedrigerem Tm&bgr; - (29. Februar 2008)

Ich weiß, dass die übliche Regel für die PCR lautet, dass eine höhere Schmelztemperatur die Spezifität der Primerbindung erhöht (und es für Primer schwieriger macht, an eine weniger als perfekt passende Sequenz zu binden) und umgekehrt (also bei einer niedrigeren Temperatur). Sie können mehrere Banden von vielen unspezifischen Bindungen erhalten).

Hat jemand schon mal davon gehört, dass das Gegenteil passiert?? Ich habe seit einiger Zeit Probleme mit einem bestimmten Primer-Set und in einigen Fällen führt eine niedrigere Schmelztemperatur zu Negativen, die bei einer höheren Schmelztemperatur positiv waren. Ich bin sehr verwirrt.

Ich weiß, dass die übliche Regel für die PCR lautet, dass eine höhere Schmelztemperatur die Spezifität der Primerbindung erhöht (und es für Primer schwieriger macht, an eine weniger als perfekt passende Sequenz zu binden) und umgekehrt (also bei einer niedrigeren Temperatur). Sie können mehrere Banden von vielen unspezifischen Bindungen erhalten).

Hat schon mal jemand von dem Gegenteil gehört?? Ich habe seit einiger Zeit Probleme mit einem bestimmten Primer-Set und in einigen Fällen führt eine niedrigere Schmelztemperatur zu Negativen, die bei einer höheren Schmelztemperatur positiv waren. Ich bin sehr verwirrt.

Sind Sie sicher, ob das, was Sie als positiv sehen, wirklich positiv ist? Es konnte nicht passieren, dass das, was Sie sehen, unspezifisch ist und wenn Sie die Temperatur erhöhen, verschwinden??

Ich weiß, dass die übliche Regel für die PCR lautet, dass eine höhere Schmelztemperatur die Spezifität der Primerbindung erhöht (und es für Primer schwieriger macht, an eine weniger als perfekt passende Sequenz zu binden) und umgekehrt (also bei einer niedrigeren Temperatur). Sie können mehrere Banden von vielen unspezifischen Bindungen erhalten).

Hat jemand schon mal davon gehört, dass das Gegenteil passiert?? Ich habe seit einiger Zeit Probleme mit einem bestimmten Primer-Set und in einigen Fällen führt eine niedrigere Schmelztemperatur zu Negativen, die bei einer höheren Schmelztemperatur positiv waren. Ich bin sehr verwirrt.

Bei der Suppressions-PCR (nur ein einzelner Primer, der den invertierten terminalen Wiederholungen des Ziels entspricht, wurde verwendet) kann eine verringerte Annealing-Temperatur die Effizienz des Primer-Template-Annealing reduzieren.


Polymerase-Kettenreaktion (PCR)

Die Polymerase-Kettenreaktion (PCR) ist eine Methode zur schnellen Amplifikation von DNA-Sequenzen. Während einer typischen PCR wird Matrizen-DNA (die die interessierende Region enthält) mit Desoxynukleotiden (dNTPs), einer DNA-Polymerase und Primern gemischt. Primer sind kurze DNA-Segmente, die stromaufwärts der interessierenden Region zur Matrizen-DNA komplementär sind und als Rekrutierungsstellen für die Polymerase dienen. Die PCR umfasst eine Reihe von Temperaturzyklen, die, obwohl sie einst durch Bewegen von Röhrchen durch verschiedene Wasserbäder durchgeführt wurden, jetzt automatisch durch die Verwendung von Thermocyclern oder Thermocyclern gesteuert werden. Thermocycler bieten eine genaue Kontrolle über die Reaktionstemperatur und die Dauer jedes Temperaturschritts und gewährleisten so eine effiziente Amplifikation. Während einer typischen PCR werden Denaturierungs-, Annealing- und Extension-Zyklen wiederholt, um eine exponentielle Amplifikation der Zielsequenz zu erreichen. Denaturierung besteht darin, die Proben typischerweise auf 94-98 °C zu erhitzen, um eine Denaturierung der Template-DNA zu bewirken, die Wasserstoffbrückenbindungen und Basenstapel-Wechselwirkungen, die die DNA-Stränge zusammenhalten, aufbricht. Sobald die Stränge getrennt sind, wird die Temperatur auf die Annealing-Temperatur gesenkt, damit die Primer Basenpaare (oder Annealing) an komplementäre Regionen der Matrize bilden können. Die Annealing-Temperatur (typischerweise zwischen 48-72 °C) hängt von der Schmelztemperatur (Tm) der Primer ab und muss für jedes in der PCR verwendete Primerpaar bestimmt werden. Während des Verlängerungsschritts (typischerweise 68-72 °C) verlängert die Polymerase den Primer, um einen entstehenden DNA-Strang zu bilden. Dieser Vorgang wird mehrere Male wiederholt (typischerweise 25-35 Zyklen), und da jeder neue Strang auch als Matrize für die Primer dienen kann, wird die interessierende Region exponentiell amplifiziert. Der letzte Schritt der PCR ist im Allgemeinen ein längerer einzelner Temperaturschritt (oft 5-10 min bei 68-72°C), der die Vervollständigung jeglicher Teilkopien und die Beseitigung aller Replikationsmaschinen von der entstehenden DNA ermöglicht. Sobald die PCR abgeschlossen ist, wird der Thermocycler auf 4 °C bis 10 °C eingestellt, um die Produktintegrität zu wahren, bis die Röhrchen aus dem Gerät entfernt werden können.


Einführung

Die Amplifikation von Ziel-DNA-Sequenzen mit hohem GC-Gehalt (>60%) kann ein Hindernis für eine erfolgreiche PCR sein. Dieses Problem wird durch die hohe Wahrscheinlichkeit der Bildung von Sekundärstrukturen wie Haarnadeln innerhalb von DNA-Matrizen, Selbst- und Kreuzprimer-Dimerbildung erschwert. Solche Strukturen können die DNA-Polymerase blockieren und/oder verhindern, dass Primer an die Matrizen anlagern, wodurch die Synthese des neuen DNA-Strangs während der PCR beendet wird. Darüber hinaus kann die Klonierung von Genen mit hohem GC-Gehalt durch PCR mit langen Primern aufgrund der hohen Schmelztemperatur eine zusätzliche Herausforderung für den Amplifikationsprozess darstellen (Tm) aufgrund der zusätzlichen Wasserstoffbrückenbindung zwischen Cytosin- und Guanin-Basenpaaren (Borah, 2011).

Studien, die darauf abzielten, diese Probleme zu überwinden, berücksichtigten insbesondere die Primer, Enhancer-Lösungen und zyklischen Bedingungen. Es wird empfohlen, die Länge der Primer zwischen 15 und 30 Nukleotidresten (Basen) zu halten und die Tm zwischen 52 und 58 °C. (Bora, 2011). Die Zugabe von Enhancern wie Betain, Dimethylsulfoxid (DMSO) und Formamid kann die Schmelzeigenschaften der doppelsträngigen DNA-Helices verändern, was eine einfache Trennung der Stränge ermöglicht. Betain ist ein Aminosäureanalogon, das die für die Denaturierung von DNA-Strängen erforderliche Energie verringert. DMSO stört die Bildung von Wasserstoffbrückenbindungen und verhindert ein erneutes Annealing zwischen den und in den Strängen. (Jensen et al., 2010 Ralser et al., 2006 Rees et al., 1993). Formamid erhöht die PCR-Spezifität bei der Arbeit mit GC-reichen Zielen (Sarkar et al., 1990). Auch die Modifikation zyklischer Bedingungen wird in Betracht gezogen, dazu gehören die Optimierung der Annealing-Temperatur, die Anwendung von Hot-Start-PCR und die Verwendung von Nested-PCR und Touchdown-PCR (Don et al., 1991 Lorenz, 2012).

Es ist anzumerken, dass selbst bei der Übernahme der zuvor erwähnten Ansätze immer noch Amplifikationsherausforderungen bestehen, insbesondere wenn GC-reiche Template, lange Primer verwendet werden und längere Produkte amplifiziert werden sollen. Darüber hinaus konzentriert sich der Großteil der veröffentlichten Literatur auf die Amplifikation von Genen mit weniger als 1 Kilobase und die Optimierung der Bedingungen in Bezug auf ein einzelnes PCR-Produkt (Frey et al., 2008 Jensen et al., 2010 Kumar et al., 2014 Mamedov et al ., 2008 Ralser et al., 2006) behandeln jedoch nicht die Arbeit mit mehreren langen GC-reichen Zielen (>1 kb). Im Rahmen eines anderen Projekts in unserem Labor zur Amplifikation und Klonierung mehrerer GC-reicher ORFs aus dem Mycobacterium bovis genome, a standard procedure that enables amplification of these targets simultaneously was required without the need to optimize individual conditions for each target. This provoked us to design this study that tested and compared the PCR amplification of one “difficult” target as a model, Mb0129 von M. bovis, a large-sized gene 1794 bp and a GC content 77.5%, and two relatively “easier” targets, mpb83 (Mb2898) von M. bovis, a 663 bp gene and 63% GC content, and LMHCC_RS00060 von Listeria monocytogenes, a 1617 bp gene and 41.5% GC. Three PCR protocols were designed and experimented with each of the three genes using five different polymerase enzymes in the presence or absence of enhancers.


Zusätzliche Informationen

S1 Fig. Sequencing workflow using targeted-amplicon sequencing (TAS) (A) and the polymerase-exonuclease-PCR (PEX PCR) method (B).

The TAS workflow consists of two PCR stages in which template-specific primers containing 5’ linker sequences are used to amplify from template DNA. Subsequently, an aliquot of the first PCR is transferred to a second reaction for amplification with primers containing NGS sequencing adapters and a sample-specific barcode. In the PEX PCR method, a modified workflow is used the first stage reaction is truncated after 2 cycles, primers are removed using exonuclease digestion, and the exonuclease-treated reaction mixture is subsequently PCR-amplified with primers containing sequencing adapters and barcodes. AT = annealing temperature ET = Elongation time.

S2 Fig. Effect of 5-nitroindole substitution and amplification strategy on observed microbial community structure and primer utilization patterns.

(EIN) Non-metric multidimensional scaling (NMDS) plot of lake sediment microbiome, performed at the taxonomic level of family and based on Bray-Curtis similarity (2D stress = 0.02). Samples were rarefied to 4,750 sequences per sample and no transformation was applied. Symbols are color-coded by the diversity (Shannon Index) of reverse primers (ich.e. 806R) detected in the sequences. Maximum possible Shannon index for 18 primers in the primer pool is 2.89. Reactions in which the 806R primer with 5-nitroindole (806R-NI) substitutions was used were less reproducible. (B) Group-average dendogram of observed lake sediment microbial community structure from a single sample as amplification method is altered. gDNA was PCR amplified using the standard TAS reaction and with PEX PCR reactions with and without exonuclease and with and without primers containing 5-nitroindole substitutions. Bray-Curtis similarity scores were generated based on family-level taxonomic classification, generated as described in the text. Data were standardized but not transformed. Clusters containing all three replicates from a single treatment are indicated by a symbol at the node. (C) Dendogram and heatmap of reverse (806R) primer utilization patterns for the same samples. Bray-Curtis similarity was generated based on standardized abundance of each of 18 primer variants present in the reverse primer pool. The heatmap indicates relative abundance of each primer variant for each sample, with primers ordered by increasing theoretical Tm. A separate column (at the very bottom) indicates the relative abundance of variants potentially present when 5-nitroindole primers are used.

S3 Fig. Effect of method and annealing temperature on primer utilization patterns in mock DNA.

Dendogram and heatmap of reverse primer utilization patterns for the mock community analyzed using the TAS and PEX PCR methods, at temperatures from 30°-55°C. Bray-Curtis similarity was generated based on standardized abundance of each of 18 primer variants present in the reverse primer pool. The heatmap indicates relative abundance of each primer variant for each sample, with primers ordered by increasing theoretical Tm. All reactions using the TAS method clustered together (node indicated by a blue circle). Underlined samples are analyzed at the individual template level in S4 Fig.

S4 Fig. Effect of method and annealing temperature on primer utilization patterns for each mock template.

Dendogram and heatmap of reverse primer utilization patterns for the mock community analyzed using the TAS and PEX PCR methods, at temperatures of 45° and 55°C. Bray-Curtis similarity was generated based on standardized abundance of each of 18 primer variants present in the reverse primer pool. The heatmap indicates relative abundance of each primer variant for each template within the mock community DNA pool, with primers ordered by increasing theoretical Tm.

S5 Fig. Effect of annealing temperature on observed microbial community structure and primer utilization patterns.

(EIN) Group-average dendogram of observed mammalian fecal microbial community structure from a single sample (“Chin”) as PEX PCR stage 1 annealing temperature is altered. Labeled nodes indicate grouping of replicates from a single annealing temperature (* indicates a single replicate from 55°C is included). Bray-Curtis similarity scores were generated based on family-level biological data, generated as described in the text. Data were standardized but not transformed. (B) Dendogram and heatmap of reverse primer utilization patterns for the same samples. Bray-Curtis similarity was generated based on standardized abundance of each of 18 primer variants present in the reverse primer pool. The heatmap (0–75%) indicates the relative abundance of each primer variant for each sample, with primers ordered by increasing theoretical Tm.