Information

Unterschied in der Abdeckung zwischen Amplikons

Unterschied in der Abdeckung zwischen Amplikons



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ich habe 2 fastq-Dateien und ich habe eine BAM-Datei (indiziert und sortiert) einiger Lesevorgänge generiert. Ich habe sie auf ein Referenzgenom (hg19) ausgerichtet.

Ich arbeite mit verschiedenen Primern.

VORWÄRTS 1. TTGCCAGTTAACGTCTTCCTTCTCTCTCTG 2. CCCTTGTCTCTGTGTTCTTGTCCCCCCCA 3. TGATCTGTCCCTCACAGCAGGGTCTTCTCT 4. CACACTGACGTGCCTCTCCCTCCCTCCA RÜCKWÄRTS 1. GAGAAAAGGTGGGCCTGAGGTTCAGAGCCA 2. CCCCACCCAGCCATGACTCACCTCCCAGGCATGACTCACCTCCCAGGCATGACTCACCTCCCAGGCATGACTCACCTCCCAGGCATGACT

Daher habe ich verschiedene Amplikons. Wie kann ich die Abdeckung dieser verschiedenen Amplikons darstellen? Und was könnte den großen Unterschied zwischen ihnen erklären?

Vielen Dank für Ihre Hilfe.


Nun, um die Abdeckung darzustellen, würde ich etwas wie Python Matplotlib verwenden. Schauen Sie sich dieses Beispiel an:

import matplotlib.pyplot as plt import matplotlib amplicons = ('TTGCCAGTTAACGTCTTCCTTCTCTCTCTG', 'CCCTTGTCTCTGTGTTCTTGTCCCCCCCA', 'TGATCTGTCCCTCACAGCAGGGTCTTCTCT', 'CACACTGACGTGCCTCTCCTTCTCCA', 'TGATCTGTCCCTCACAGCAGGGTCTTCTCT', 'CACACTGACGTGCCTCCC,85 )) subplt = fig.add_subplot(111) subplt.set_ylabel('Count') subplt.set_xlabel('Amplicons') subplt.plot(amplicons, countAmpl, linestyle="-", marker="o", color="blue ") für tl in subplt.get_yticklabels(): tl.set_color('blue') plt.savefig("amplicons.eps")

Überprüfen Sie andere Diagrammtypen in Matplotlib, wenn Sie der Meinung sind, dass Sie etwas anderes benötigen.

Sie können auch versuchen, die BAM im IGV des Broad Institute zu öffnen und zu visualisieren.

Was den Unterschied in der Abdeckung angeht, würde ich sagen, dass einige aus einer sich wiederholenden Region stammen. Oder die Verstärkungstiefe einer Region ist größer als bei den anderen. Oder vielleicht hat der Aligner ähnliche Regionen gefunden und entschieden, dass das Amplikon in all diesen Regionen gut ausgerichtet ist.


BEDTools liefert Ihnen neben anderen Software-Suiten ein Abdeckungshistogramm. Die größte Quelle für Verzerrungen bei der PCR-Effizienz ist nur, dass einige Primer besser funktionieren als andere, es gibt auch Sequenzfehler in der PCR-Amplifikationsphase der Bibliotheksvorbereitung. GC-Inhalte tragen dazu bei.


Gezielte Sequenzierungsansätze für NGS

Während die Sequenzierung des gesamten menschlichen Genoms die Entdeckung und die menschliche Gesundheit vorangebracht hat, sind schwierige Regionen des Genoms mit diesem Ansatz schwierig zu analysieren, was zu einer Verzerrung der Populationssequenzierung führt, und vorhandene Datenbanken werden weder als vollständig noch als genau bezeichnet (1). Für viele Forschungsanwendungen können die Kosten für die Sequenzierung des gesamten Genoms immer noch eine Belastung darstellen, insbesondere wenn man die Anforderungen an Computerverarbeitung und Informatik für die Analyse des gesamten Genoms berücksichtigt. Diese zusätzlichen Kosten und Komplexität wären von geringem Nutzen, wenn eine bestimmte Region von Interesse für Krankheiten und Anwendungen in der translationalen Forschung untersucht würde. Um dieses Problem anzugehen, haben viele Forscher einen gezielten Sequenzierungsansatz gewählt, um die Abdeckung zu verbessern, die Analyse und Interpretation zu vereinfachen und die Gesamtkosten für den Sequenzierungsworkflow zu senken.


Zuerst werden die Zielregionen einer Genom- oder DNA-Probe durch gut gestaltete Multiplex-PCR-Primer amplifiziert, wobei überhängende Schwänze partielle Adaptersequenzen sind, die mit entsprechenden DNA-Sequenzern kompatibel sind, was sowohl zu Ziel-Amplikons als auch zu unspezifischen PCR-Produkten einschließlich Primer-Dimeren führt.

Traditionell können die unspezifischen PCR-Produkte bei großen Panels (z. B. mehr als 2.000 Amplikons in einem einzigen Pool) überwältigend sein und die nachgelagerten Schritte erheblich beeinträchtigen, wenn keine Maßnahmen zu ihrer Entfernung getroffen werden. Einige Verfahren auf Amplikon-Basis verwenden die Reinigung von Kügelchen und die Größenauswahl, um kleinere DNA-Fragmente wie Primer-Dimere zu entfernen. Einige komplizierte unspezifische PCR-Produkte mit Größen, die den Längen der Ziel-Amplikons und der daraus resultierenden Bibliotheken ähneln, können jedoch durch einfache Größenauswahl schwierig zu entfernen sein. Die folgende Bioanalyzer-Spur zeigt signifikantes Hintergrundrauschen um eine Zielbibliothek von 300bp.

/>CleanPlex Library Trace ohne Hintergrundbereinigung

CleanPlex überwindet diesen Nachteil mit einem innovativen und patentierten enzymatischen/chemischen Hintergrundreinigungsschritt, der unspezifische PCR-Produkte einschließlich sowohl Primer-Dimere als auch kompliziertere und längere unspezifische PCR-Artefakte entfernt, was zu sehr reinen Zielbibliotheken führt. Die folgende Bioanalyzer-Spur zeigt die Wirkung der CleanPlex-Hintergrundreinigungstechnologie.

/>CleanPlex Library Trace mit Hintergrundbereinigung

Anschließend werden Proben-Barcodes (zum Zweck des Proben-Poolings) durch einen indizierten PCR-Schritt hinzugefügt, um sequenzierungsbereite Bibliotheken zu erhalten. Der gesamte Workflow dauert nur 3 Stunden und minimale praktische Zeit.


Bewertung des Precision ID Ancestry-Panels

Die Fähigkeit, genaue DNA-basierte forensische Intelligenz bereitzustellen, erfordert die Analyse mehrerer DNA-Marker, um die biogeografische Abstammung (BGA) und die äußerlich sichtbaren Merkmale (EVCs) des Spenders biologischer Beweise vorherzusagen. Massive Parallel Sequencing (MPS) ermöglicht die gleichzeitige Analyse von Hunderten von DNA-Markern in mehreren Proben, was den Wert der Intelligenz für forensische Ermittler erhöht und gleichzeitig die Erschöpfung von Beweismaterial aufgrund mehrerer Analysen verringert. Das Precision ID Ancestry Panel (ehemals HID Ion AmpliSeq™ Ancestry Panel) (Thermo Fisher Scientific) (TFS)) besteht aus 165 autosomalen SNPs, die ausgewählt wurden, um BGA abzuleiten. Anhand dieses Panels wurden forensische Validierungskriterien auf 95 Proben angewendet, um die Sensitivität (1 ng-15 pg), die Reproduzierbarkeit (Variabilität zwischen und innerhalb der Läufe) und die Auswirkungen von kompromittierten und forensischen Fallbeispielen (künstlich abgebaut und gehemmt, gemischte Quellen und gealterte Blut- und Knochenproben). Die Genauigkeit der BGA-Vorhersage wurde anhand von Proben von Personen bewertet, die ihre Vorfahren selbst erklärten, dass sie aus einzelnen Herkunftspopulationen stammen (n = 36) oder aus mehreren Herkunftspopulationen (n = 14). Die Sequenzierung wurde auf Ion 318 TM -Chips (TFS) auf dem Ion PGM TM -System (TFS) durchgeführt. Die Software HID SNP Genotyper v4.3.1 (TFS) wurde verwendet, um BGA-Vorhersagen basierend auf Beimischungsanteilen (kontinentaler Ebene) und Wahrscheinlichkeitsschätzungen (Subpopulationsebene) durchzuführen. Die BGA-Vorhersage war bei DNA-Matrizenmengen von 125 pg und 30 pg unter Verwendung von 21 bzw. 25 PCR-Zyklen genau. HID SNP Genotyper BGA-Zuordnungen auf kontinentaler Ebene stimmten mit BGAs für selbsternannte ostasiatische, afrikanische, europäische und südasiatische Personen überein. Kompromittierte, gemischte Quellen und gemischte Proben erfordern zusätzlich zur Vorhersage auf Subpopulationsebene eine umfassendere Analyse.

Dies ist eine Vorschau von Abonnementinhalten, auf die Sie über Ihre Institution zugreifen können.


Abstrakt

Die forensische Phänotypisierung kann nützliche Informationen über die biogeografische Abstammung (BGA) und die extern sichtbaren Merkmale (EVCs) des Spenders einer Beweisprobe liefern. Gegenwärtig wird die auf Einzelnukleotidpolymorphismus (SNP) basierende Inferenz von BGA und EVCs am häufigsten unter Verwendung von SNaPshot ® , einem Single-Base-Extension (SBE)-Assay, durchgeführt. Eine einzelne SNaPshot-Multiplex-PCR ist jedoch auf 30–40 SNPs beschränkt. Next Generation Sequencing (NGS) bietet das Potenzial, Hunderte bis Tausende von SNPs aus mehreren Proben in einem einzigen Versuchsdurchlauf zu genotypisieren. Die PCR-Multiplexe aus fünf SNaPshot-Assays (SNPzumID 52plex, SNPzumID 34plex, Eurasiaplex, IrisPlex und ein unveröffentlichter BGA-Assay) wurden auf drei verschiedene DNA-Matrizenmengen (0,1, 0,2 und 0,3 ng) in drei Proben (9947A und 007 Kontroll-DNAs und ein männlicher Spender) aufgetragen. Die gepoolten PCR-Amplikons mit 136 einzigartigen SNPs wurden mit dem Ion Torrent™ PGM-System von Life Technologies sequenziert. Ungefähr 72 Mb Sequenz wurden aus zwei 10 Mb Ion 314 TM v1-Chips erzeugt. Genaue Genotypen wurden leicht aus allen drei Matrizenmengen erhalten. Von insgesamt 408 Genotypen waren 395 (97%) über alle drei Template-Mengen vollständig mit SNaPshot übereinstimmend. Von diesen mit SNaPshot nicht übereinstimmenden Genotypen waren sechs Ion-Torrent-Sequenzen (1,5%) über die drei Matrizenmengen hinweg vollständig mit der Sanger-Sequenzierung übereinstimmend. Sieben SNPs (1,7%) stimmten entweder nicht mit den Template-Mengen überein oder mit der Sanger-Sequenzierung nicht übereinstimmend. Die in der Negativkontrolle beobachtete Sequenzabdeckung und die Variation der Allelabdeckung für heterozygote Genotypen unterstreicht die Notwendigkeit, einen Schwellenwert für die Hintergrundwerte der Sequenzausgabe und das heterozygote Gleichgewicht festzulegen. Diese vorläufige Studie des Ion Torrent PGM-Systems hat ein beträchtliches Potenzial für den Einsatz in forensischen DNA-Analysen als NGS-Plattform mit niedrigem bis mittlerem Durchsatz unter Verwendung etablierter SNaPshot-Assays gezeigt.


Q5® High-Fidelity-DNA-Polymerasen

Q5 ® High-Fidelity DNA Polymerase (NEB #M0491) setzt einen neuen Standard für Genauigkeit und robuste Leistung. Mit der höchsten verfügbaren Wiedergabetreue (>280-mal höher als Taq) führt Q5 DNA Polymerase zu extrem niedrigen Fehlerraten. Die Q5-DNA-Polymerase besteht aus einer neuartigen Polymerase, die an die prozessivitätserhöhende Sso7d-DNA-Bindungsdomäne fusioniert ist, was die Geschwindigkeit, Genauigkeit und Zuverlässigkeit der Leistung verbessert. Q5-Mastermixe enthalten dNTPs, Mg++ und einen proprietären, breit verwendbaren Puffer, der unabhängig vom GC-Gehalt nur die Zugabe von Primern und DNA-Template für eine robuste Amplifikation erfordert.

NEU: Q5U Hot-Start-High-Fidelity-DNA-Polymerase (NEB #M0515). Q5U ist eine modifizierte Version der Q5 High-Fidelity DNA Polymerase, die eine Mutation in der Uracil-Bindungstasche enthält, die es ermöglicht, Templates mit Uracil- und Inosinbasen zu lesen und zu amplifizieren. Dies ist nützlich, um Bisulfit-konvertierte, enzymatisch desaminierte oder beschädigte DNA zu amplifizieren, um Verschleppungskontaminationen in der PCR (bei Verwendung mit dUTP und UDG) und in USER-Klonierungsmethoden zu verhindern. Erfahren Sie mehr über dieses Produkt.

Vergleich von High-Fidelity-Polymerasen

1 Wir untersuchen weiterhin verbesserte Assays, um die sehr niedrige Fehlerrate von Q5 zu charakterisieren, um sicherzustellen, dass wir möglichst genaue Daten zur Wiedergabetreue präsentieren (Potapov, V. und Ong, J.L. (2017) PLoS ONE. 12(1): e0169774).
2 PCR-basiertes Mutationsscreening in lacI (Agilent) oder rpsL (Life).

Vorteile

  • Höchste Wiedergabetreue (>280X höher als Taq)
  • Extrem niedrige Fehlerraten
  • Überlegene Leistung für eine breite Palette von Amplikons (von hohem AT bis zu hohem GC)
  • Hot-Start- und Master-Mix-Formate verfügbar

Das Q5-Puffersystem wurde entwickelt, um eine überragende Leistung mit minimaler Optimierung über eine breite Palette von Amplikons hinweg zu bieten, unabhängig vom GC-Inhalt. Für routinemäßige oder komplexe Amplikons bis zu

65 % GC-Gehalt, Q5-Reaktionspuffer (NEB #B9027) bietet zuverlässige und robuste Amplifikation. Bei Amplikons mit hohem GC-Gehalt (>65% GC) sorgt die Zugabe des Q5 High GC Enhancer für anhaltende maximale Leistung. Q5- und Q5-Hot-Start-DNA-Polymerasen sind als eigenständige Enzyme oder für zusätzlichen Komfort in einem Master-Mix-Format erhältlich. Mastermix-Formulierungen beinhalten dNTPs, Mg++ und alle notwendigen Pufferkomponenten.

Robuste Amplifikation mit Q5 (A) und Q5 Hot Start (B) High-Fidelity DNA Polymerasen

Amplifikation einer Vielzahl humaner genomischer Amplikons mit niedrigem bis hohem GC-Gehalt unter Verwendung von Q5 oder Q5 Hot Start High-Fidelity DNA Polymerase. Reaktionen unter Verwendung von Q5 Hot Start wurden bei Raumtemperatur durchgeführt. Alle Reaktionen wurden unter Verwendung von 30 Amplifikationszyklen durchgeführt und durch mikrofluidische LabChip®-Analyse visualisiert.

Im Gegensatz zu chemisch modifizierten oder antikörperbasierten Hot-Start-Polymerasen verwendet NEBs Q5 Hot Start (NEB #M0493) ein einzigartiges synthetisches Aptamer. Dieses Molekül bindet durch nicht-kovalente Wechselwirkungen an die Polymerase und blockiert die Aktivität während des Reaktionsaufbaus. Die Polymerase wird unter normalen Zyklusbedingungen aktiviert, sodass Reaktionen bei Raumtemperatur durchgeführt werden können. Q5 Hot Start erfordert keinen separaten Hochtemperatur-Aktivierungsschritt, was die Reaktionszeiten verkürzt und die Benutzerfreundlichkeit erhöht. Q5 Hot Start Polymerase ist die ideale Wahl für die Amplifikation mit hoher Spezifität und bietet eine robuste Amplifikation einer Vielzahl von Amplikons, unabhängig vom GC-Gehalt.

Amplifikationsleistung über ein breites Spektrum genomischer Targets

Die PCR wurde mit einer Vielzahl von Amplikons durchgeführt, deren GC-Gehalt von hohem AT bis zu hohem GC reichte, mit Q5 und mehreren anderen kommerziell erhältlichen Polymerasen. Alle Polymerasen wurden gemäß den Empfehlungen des Herstellers zyklisiert, einschließlich der Verwendung von GC-Puffern und -Enhancern, wenn empfohlen. Ausbeute und Reinheit der Reaktionsprodukte wurden quantifiziert und, wie im Figurenschlüssel dargestellt, durch Punktfarbe und -größe dargestellt. Ein großer dunkelgrüner Punkt steht für die erfolgreichste Leistung. Q5 bietet überragende Leistung über den gesamten GC-Inhaltsbereich.

Master-Mix und Stand-Alone-Formate bieten Komfort und Flexibilität

Q5 ® ist eine eingetragene Marke von New England Biolabs, Inc.
LabChip ® ist eine eingetragene Marke von Caliper Life Sciences, ein Teil von Perkin Elmer, Inc.

Typ wählen:

  • Häufig gestellte Fragen
  • Protokolle
  • Anwendungshinweise
  • Tools & Ressourcen
  • Veröffentlichungen
  • PCR-Auswahltool
  • Vergleich von High-Fidelity-Polymerasen
  • Q5 DNA Polymerase bietet überlegene Amplifikation für eine Vielzahl von Templates
  • Fünf Qualitätsmerkmale von Q5
  • Auswahltabelle für DNA-Polymerase
  • Rechtsinformation

Feature-Artikel

Lesen Sie mehr über die Beziehung zwischen Polymerase-Struktur und -Funktion beim Kopieren von DNA.

Broschüren

Auswahlwerkzeuge

Anleitungen zur Fehlerbehebung

Nutzungsrichtlinien

  1. Treue &ndash die höchste verfügbare Wiedergabetreue (>100X höher als Taq)
  2. Robustheit &ndash hohe Spezifität und Ausbeute bei minimaler Optimierung
  3. Abdeckung &ndash überlegene Leistung für eine breite Palette von Amplikons (von hohem AT bis zu hohem GC)
  4. Geschwindigkeit &ndash kurze Verlängerungszeiten
  5. Amplikonlänge &ndash robuste Amplifikationen bis zu 20 kb für einfache Templates und 10 kb für komplexe

NEB bietet einen Leitfaden zur Auswahl der richtigen DNA-Polymerase für Ihre Anwendung, indem er eine Liste spezifischer Eigenschaften bereitstellt. Mehrere Faktoren bestimmen, welche Polymerase in einer bestimmten Anwendung verwendet werden sollte, darunter:

Vorlagen-/Produktspezifität: Ist RNA oder DNA beteiligt? Befindet sich das 3´-Ende an einer Lücke, einem Einschnitt oder am Ende des Templates?

Entfernung vorhandener Nukleotide: Wird das Nukleotid(e) im Rahmen des Protokolls aus der bestehenden Polynukleotidkette entfernt? Wenn ja, werden sie vom 5´- oder vom 3´-Ende entfernt?

Thermische Stabilität: Muss die Polymerase die Inkubation bei hoher Temperatur überleben oder ist eine Hitzeinaktivierung wünschenswert?

Treue: Wird die nachfolgende Sequenzanalyse oder Expression von der Genauigkeit der synthetisierten Produkte abhängen?

Dieses Produkt ist durch ein oder mehrere Patente, Warenzeichen und/oder Urheberrechte geschützt, die sich im Besitz von New England Biolabs, Inc (NEB) befinden oder von ihr kontrolliert werden.

Während NEB seine Produkte für verschiedene Anwendungen entwickelt und validiert, kann die Verwendung dieses Produkts erfordern, dass der Käufer für bestimmte Anwendungen zusätzliche geistige Eigentumsrechte Dritter erwerben muss.

Für weitere Informationen zu kommerziellen Rechten wenden Sie sich bitte an das Global Business Development Team von NEB unter [email protected]

Dieses Produkt ist nur für Forschungszwecke bestimmt. Dieses Produkt ist nicht für therapeutische oder diagnostische Zwecke bei Mensch oder Tier bestimmt.


Was ist geplant

- fügt Cookie-Unterstützung hinzu, um sich individuell zugewiesene Eingabeparameter von einer Sitzung zur nächsten zu merken. Wenn Sie einen Standard-Parametersatz verwenden, müssen Sie diese nicht mehr bei jedem Besuch des muPlex-Servers erneut eingeben. Die Verwendung der Cookies ist völlig freiwillig. Wenn Cookies in Ihrem Browser deaktiviert sind, wird die Benutzeroberfläche automatisch auf die Standardparameter zurückgesetzt.

- wird ein muPlex-Forum (Wiki?) einführen, um unsere wachsende Benutzerliste zu unterstützen!

- Haben Sie Ideen zur Verbesserung von muPlex? Unsere laufenden Entwicklungsbemühungen basieren in erster Linie auf Vorschlägen unserer Benutzer. (Sehen Fragen und Feedback unter.)


Kontroverse um HPV-Impfstoff

Während einer Debatte zwischen republikanischen Präsidentschaftskandidaten im Jahr 2011 implizierte Michele Bachmann, einer der Kandidaten, dass der Impfstoff gegen HPV für Kinder unsicher ist und zu geistiger Behinderung führen kann. Wissenschaftler und andere Angehörige der Gesundheitsberufe legten sofort Beweise vor, um diese Behauptung zu widerlegen. EIN USA heute Artikel „No Evidence HPV Vaccines Are Dangerous“ (19. September 2011) beschrieb zwei Studien der Centers for Disease Control and Prevention (CDC), die die Sicherheit des Impfstoffs verfolgen. Hier ein Auszug aus dem Artikel:

  • Zunächst überwacht die CDC Berichte an das Vaccine Adverse Event Reporting System, eine Datenbank, an die jeder eine vermutete Nebenwirkung melden kann. CDC-Beamte untersuchen dann, ob gemeldete Probleme möglicherweise durch Impfstoffe verursacht werden oder einfach nur ein Zufall sind. Zweitens hat die CDC im Laufe der Zeit Mädchen verfolgt, die den Impfstoff erhalten, und sie mit einer Kontrollgruppe ungeimpfter Mädchen verglichen. Auch hier wurde festgestellt, dass der HPV-Impfstoff sicher ist.

Laut einem Artikel von Elizabeth Rosenthal, „Drug Makers’ Push Leads to Cancer Vaccines’ Rise“ (New York Times, 19. August 2008), sagten die FDA und die CDC, dass "bei Millionen von Impfungen allein durch Zufall einige ernsthafte Nebenwirkungen und Todesfälle in der Zeit nach der Impfung auftreten werden, die aber nichts mit dem Impfstoff zu tun haben." In dem Artikel heißt es, dass die FDA und die CDC die Daten überwachen, um festzustellen, ob schwerwiegendere Auswirkungen auftreten, als allein aufgrund des Zufalls zu erwarten wäre.

Laut einer anderen Quelle deuten die CDC-Daten darauf hin, dass etwa 3 von 100.000 ernsthaften Gesundheitsproblemen nach der Impfung auftreten. Dies ist ein Anteil von 0,00003. Aber sind diese Gesundheitsprobleme auf den Impfstoff zurückzuführen? Ist die Rate ähnlicher Gesundheitsprobleme bei denen, die den Impfstoff nicht erhalten, unterschiedlich? Nehmen wir an, es gibt keine Unterschiede in der Rate schwerwiegender gesundheitlicher Probleme zwischen der Behandlungs- und der Kontrollgruppe. Das heißt, nehmen wir an, dass der Anteil der schwerwiegenden Gesundheitsprobleme in beiden Gruppen 0,00003 beträgt.

Angenommen, die CDC folgt einer Zufallsstichprobe von 100.000 Mädchen, die den Impfstoff hatten, und einer Zufallsstichprobe von 200.000 Mädchen, die den Impfstoff nicht hatten. Im Laufe der Zeit berechnen sie den Anteil in jeder Gruppe, der ernsthafte gesundheitliche Probleme hat.

Frage: Wie viel Unterschied in diesen Probenanteilen ist ungewöhnlich, wenn der Impfstoff keine Auswirkungen auf das Auftreten schwerwiegender gesundheitlicher Probleme hat?

Um diese Frage zu beantworten, müssen wir sehen, wie viel Variation wir in Stichproben erwarten können, wenn kein Unterschied in der Häufigkeit schwerwiegender Gesundheitsprobleme besteht. Daher verwenden wir die Stichprobenverteilung der Unterschiede in den Stichprobenverhältnissen.

  • Spread: Die großen Stichproben erzeugen einen sehr kleinen Standardfehler. Der Standardfehler der Unterschiede in den Stichprobenanteilen beträgt

Antworten: Wir können Stichproben, die mehr als 2 Standardfehler vom Mittelwert abweichen, als ungewöhnlich ansehen. Wenn kein Unterschied in der Häufigkeit schwerwiegender Gesundheitsprobleme besteht, beträgt der Mittelwert 0. Daher sind Unterschiede in den Häufigkeiten größer als 0 + 2(0,00002) = 0,00004 ungewöhnlich. Dies entspricht etwa 4 weiteren Fällen von ernsthaften Gesundheitsproblemen von 100.000. Bei solch großen Stichproben sehen wir, dass eine kleine Anzahl zusätzlicher Fälle von schwerwiegenden Gesundheitsproblemen in der Impfstoffgruppe ungewöhnlich erscheinen wird. Aber sind 4 Fälle von 100.000 von praktischer Bedeutung angesichts des potenziellen Nutzens des Impfstoffs? Dies ist eine wichtige Frage für die CDC.

Versuch es

Laut einer 2008 vom AFL-CIO veröffentlichten Studie hatten 78 % der gewerkschaftlich organisierten Arbeitnehmer einen Arbeitsplatz mit Krankenversicherung des Arbeitgebers, verglichen mit 51 % der nicht gewerkschaftlich Beschäftigten. Im Jahr 2009 zitierte das Employee Benefit Research Institute Daten aus großen Stichproben, die darauf hindeuteten, dass 80 % der gewerkschaftlich organisierten Arbeitnehmer eine Krankenversicherung hatten, verglichen mit 56 % der nicht gewerkschaftlich Beschäftigten. Nehmen wir an, die Daten von 2009 stammen aus Zufallsstichproben von 3.000 gewerkschaftlich Beschäftigten und 5.000 nicht gewerkschaftlich Beschäftigten.

Versuch es

Das Folgende ist ein Auszug aus einer Pressemitteilung auf der AFL-CIO-Website, die im Oktober 2003 veröffentlicht wurde.

  • Wal-Mart ist ein Beispiel für den schädlichen Trend unter den großen amerikanischen Arbeitgebern, sich auf Kosten ihrer Arbeitnehmer und der Gemeinschaft vor der Verantwortung für die Krankenversicherung zu drücken. Mit reduziertem Versicherungsschutz und erhöhten Arbeitnehmerprämien setzt Wal-Mart – der größte private Arbeitgeber in den USA – einen beunruhigenden Standard. Weniger als die Hälfte der Wal-Mart-Beschäftigten sind im Rahmen des Unternehmensplans versichert – nur 46 Prozent. Laut einer heute veröffentlichten neuen Studie des Commonwealth Fund, die den wachsenden Trend bei großen Arbeitgebern dokumentiert, die Krankenversicherung für ihre Arbeitnehmer abzubrechen, ist diese Rate dramatisch niedriger als die 66 Prozent der Arbeitnehmer in großen Privatunternehmen, die im Rahmen ihrer Unternehmenspläne versichert sind.

Angenommen, wir möchten sehen, ob dieser Unterschied den Versicherungsschutz für Arbeitnehmer in unserer Gemeinde widerspiegelt. Wir wählen eine Zufallsstichprobe von 50 Mitarbeitern von Wal-Mart und 50 Mitarbeitern anderer großer Privatunternehmen in unserer Gemeinde aus. Angenommen, 20 der Mitarbeiter von Wal-Mart und 35 der anderen Mitarbeiter sind über ihren Arbeitgeber versichert.


Häufig gestellte Fragen zu AmpliSeq for Illumina Custom und Community Panels

Nein, eine neue Version ist derzeit nicht geplant. Die Standard-Panels und Community-Panels basieren auf hg19. Die Umstellung von vorgefertigten Paneelen kann in Zukunft je nach Marktnachfrage in Betracht gezogen werden.

Design Studio

Was sind die Ziel-Amplikongrößen?

Amplikon kann einen Bereich haben, in dem Sie die maximale Amplikongröße auswählen.

Entsprechen die Amplikon-Größen den Insert-Größen?

Da wir die Primer während des Schrittes Teilweise verdauen der Amplikons verdauen, sind die resultierenden Insertgrößen kleiner als die Amplikongröße. Je nach gewählter Leselänge empfehlen wir Adapterbeschnitt.

Warum sind manche Ziele in DesignStudio schwer zu entwerfen?
  • Homologe: Homologe im gleichen Design können zu geringer Designbarkeit führen. Teilen Sie Homologe in separate Pools auf.
  • GC-Inhalt: Regionen mit mehr als 80 % GC-Gehalt können schwierig zu entwerfen sein, insbesondere wenn diese Regionen länger als 500 bp sind.
  • Homopolymersequenzen und repetitive Elemente: DesignStudio vermeidet diese Regionen, um sicherzustellen, dass Sonden eine bessere Spezifität im Genom aufweisen.
  • Schlechte Spezifität: DesignStudio bewertet die Spezifität von Sonden und schließt diejenigen aus, die keine zufriedenstellende Zielabdeckung bieten.
Wie wählt DesignStudio Primer aus?

Optimale Sonden werden unter Verwendung eines Algorithmus ausgewählt, der Schmelztemperatur (Tm), % GC, Länge, Sekundärstruktur, Einzigartigkeit im Genom und das Vorhandensein zugrunde liegender SNPs (basierend auf dbSNP) berücksichtigt. Weitere Informationen finden Sie in der DesignStudio-Onlinehilfe.

Wie kann ich die Gestaltungsfähigkeit und Abdeckung in meinem DesignStudio-Projekt verbessern?
  • Das Erhöhen der Größe des Ziels, gegen das ausgelegt werden soll, kann zuvor „nicht gestaltbare“ Regionen retten. Die größere Größe eines Targets gibt DesignStudio etwas mehr Flexibilität, um ein Amplikon mit höherer Punktzahl über die gewünschten Target-Basen zu bringen.
  • Ändern Sie den Kontext des Panels – zum Beispiel kann es problematisch sein, eine stark homologe oder stark GC-reiche Zielsequenz in dasselbe Multiplex-Design zu integrieren, um Sonden zu entwickeln, um jedes Ziel einzeln zu amplifizieren. Das Verschieben problematischer Bereiche in ein separates Design kann häufig die Designbarkeit verbessern.
  • Ändern Sie die Stringenzstufen.
Kann ich ein Dual-Pool-Design erstellen?

Nein. Dies ist eine Multiplex-PCR, die nicht zwischen dem oberen und unteren Strang unterscheiden kann.

Kann ich den Inhalt meines Designs bearbeiten, nachdem ich es eingereicht habe?

Nein. Sie können jedoch über die Schaltfläche „Design ändern“ den Inhalt in ein neues Panel kopieren und anschließend bearbeiten.

Kann ich mein Design bearbeiten, nachdem ich eine Bestellung aufgegeben habe?

Nein. Nachdem Sie eine Bestellung aufgegeben haben, können Sie das Design nicht mehr bearbeiten. Die für die Analyse durch BaseSpace Sequence Hub und Local Run Manager erforderlichen Dateien müssen mit dem von Ihnen bestellten Material synchronisiert bleiben.

Was ist die aktuelle Bearbeitungszeit für ein eingereichtes Design in Bezug auf die Zielgröße oder die Anzahl der Ziele?

Ein Design mit weniger als 250 KB hat eine erwartete Bearbeitungszeit von 48 Stunden oder weniger. Designs mit mehr als 250 KB oder mit vielen Zielen können länger als 48 Stunden dauern, bis sie zurückgegeben werden.

On-Demand-Designs haben eine kürzere Bearbeitungszeit als andere Einreichungen. On-Demand-Designs von 250 KB oder weniger sollten in weniger als 2 Stunden zurückgegeben werden.

Was bestimmt die Designkriterien des Amplikons?

Derzeit können Benutzer in DesignStudio für jedes Design eine Amplikongröße von 140, 175, 275 oder 375 (empfohlen für MiSeq) auswählen. Die Amplikongröße umfasst die Primersequenzen und die Insertbereiche. Wir empfehlen die Verwendung von 175 bp für FFPE-DNA, 140 bp für cfDNA und 275 bp für normale DNA.

Ist es möglich, ein AmpliSeq for Illumina-Design zu verwenden, um viele SNPs (bis zu 1000 oder mehr) für viele Personen (bis zu 1000 oder mehr) zu screenen?

Ja, DesignStudio ermöglicht die SNP-Genotypisierung durch Sequenzierung.

Was ist das größte Design, das ich an die AmpliSeq for Illumina-Pipeline senden kann?

Sie können Designs bis zu 500 kb direkt in die Pipeline einreichen. Die Pipeline ist fähig von Verarbeitungsdesigns bis zu 5 MB, aber solche Designs sind kostspielig und beanspruchen eine große Menge an Rechenressourcen.

Wir empfehlen, nur Designs bis 2 MB einzureichen. Für Designs zwischen 2 MB und 5 MB empfehlen wir Ihnen, sich an Ihren Vertriebsspezialisten zu wenden.

Welche Panels kann ich verwenden, um Amplicons zu einem neuen Design hinzuzufügen?

Sie können Amplicons aus benutzerdefinierten, Community- und festen AmpliSeq for Illumina-Panels kopieren, indem Sie dieselbe Art wie Ihr Design verwenden. Für Informationen zu den verfügbaren Community- und Festtafeln wenden Sie sich an den technischen Support von Illumina.

DesignStudio - Primer Bioinformatik

Wie hoch ist die Überlappung zwischen den Primern?

Primer im selben Pool/Röhrchen überlappen sich nicht.

Werden mit AmpliSeq for Illumina-Projekten in DesignStudio Primer-Sets automatisch (mit einem Computerprogramm) ohne Rückfrage durch einen Forscher entworfen?

Der Prozess ist eine automatisierte Pipeline, die optimiert wurde, um die maximale Abdeckung mit zuverlässigen Primer-Sets zu bieten.

DesignStudio - Oligo Bestellung

Kann ich einem Satz zuvor bestellter Primer ein paar weitere Gene hinzufügen?

Nein. Sie müssen das Design ändern, die neuen Gene hinzufügen und eine neue Bestellung aufgeben.

Wenn ich reguläre Primer für eine Region habe und weiß, dass sie funktionieren, kann ich sie dann meinem AmpliSeq for Illumina-Design hinzufügen?
Kann ich nach dem Design manuell Primer hinzufügen, um eine Region vollständig abzudecken?

Nein. Wir verwenden speziell modifizierte Primer, sodass Standardprimer keine Bibliothekskonstruktion ermöglichen.

Gibt es eine Mindestbestellmenge für AmpliSeq für Illumina Gene- und Hotspot-Designs?

AmpliSeq for Illumina Custom Panels reichen von 12 Amplicons bis 3.072 Amplicons pro Pool. Zielregionen können bis zu 1 bp groß sein, aber da Designs 12 Amplikons enthalten müssen, benötigen Sie 12 Sätze von 1 bp-Regionen.

Alle Bestellungen haben einen Mindestpreis, der den Kosten einer Bestellung mit 48 Amplikons entspricht.

In welchem ​​Containerformat erhalte ich meine benutzerdefinierten Primer?

Jeder benutzerdefinierte Primer-Pool wird als vorgepooltes Röhrchen geliefert.

Wie kann ich den Status einer Designeinreichung bei AmpliSeq for Illumina Custom Panel herausfinden?

E-Mail an [email protected] Verwenden Sie Ihre AmpliSeq for Illumina Design-ID-Nummer oder Lösungs-ID-Nummer, wenn Sie sich auf Ihre Bestellung beziehen.

DesignStudio - Fehlerbehebung und Validierung

Angenommen, ich ziele auf eine Region ab und DesignStudio schlägt ein Design vor, das aus zwei Primer-Pools besteht. Sollte ich für jede Probe eine Bibliothek für jede Amplifikation (jeden Pool) erstellen? Oder sollte ich die beiden Amplifikationen (die Produkte der beiden amplifizierten Pools) kombinieren und dann die Bibliothek vorbereiten?

Wenn Ihr Design zu mehreren Pools führt, wird jeder Pool unabhängig durch „Amplify DNA/cDNA Targets“ verarbeitet, wie im AmpliSeq for Illumina Custom and Community Panel Reference Guide beschrieben. Die Pools werden dann vor dem Schritt „Partially Digest Amplicons“ kombiniert. Sie werden als eine Probe durch die Indexligation und die abschließende Amplifikation der Bibliothek fortgesetzt.

Wie viele Basenpaare trennen die Primer von der Zielregion?

Um sicherzustellen, dass ein gesamtes Exon abgedeckt wird, fügen wir standardmäßig 25 bp Padding stromauf- und stromabwärts der ausgewählten Zielregion hinzu. Diese Polsterung bietet Platz zum Platzieren der Primer. Die Polsterung gewährleistet eine qualitativ hochwertige Sequenzierung an den Enden der Exons und ermöglicht eine gewisse Sequenzierung in die Splice-Junction-Regionen. Primer-Regionen gelten nicht als abgedeckt. Wenn die Abdeckung aus dem ursprünglichen Design weniger als 100 % beträgt, können wir daher noch einmal versuchen, den Primer weiter in das Intron zu verlängern, um das gesamte Exon einzufangen.

Eingang

Welche DNA-Inputmenge ist erforderlich?

Der Assay verwendet zwischen 1 und 100 ng DNA pro Primerpool, wobei die meisten Designs 10 ng pro Pool verwenden.

Welche DNA-Qualität ist erforderlich und wie ist die DNA-Qualität zu beurteilen?

Wir haben mit den Protokolländerungen, die in den Benutzerhandbüchern angegeben sind, Erfolg mit Eingaben von geringer Qualität. Kommerziell erhältliche oder im Labor validierte DNA-Extraktionsverfahren liefern normalerweise DNA, die mit diesem Assay kompatibel ist. Die DNA-Reinheit sollte ein A260/A280-Verhältnis von 1,8–2,0 aufweisen. PicoGreen wird für eine genaue Quantifizierung empfohlen.

Werden FFPE-Beispiele unterstützt?

Verwenden Sie nur von FFPE abgeleitete DNA, wenn Sie kurze Amplikonlängen von 140 oder 175 bp verwenden. Kürzere Amplikons bieten eine bessere Amplifikation als längere, wenn der Probeneingang fragmentierte FFPE-abgeleitete DNA ist.

Wie viel DNA kann mit diesem Kit gezielt werden?

Es gibt eine Grenze von 12-6.144 Primerpaaren pro Pool. Wenn eine Zielregion von mehr als 5 MB generiert wird, empfehlen wir die Auswahl einer Anreicherungsoption.

Protokoll

Verwendet dieser Assay die standardmäßigen Nextera- oder TruSeq-Adapter?

Die in diesem Assay verwendeten Adapter sind für den AmpliSeq-Workflow optimiert. Nextera- oder TruSeq-Adapter sind mit diesem Assay nicht kompatibel.

Was ist erforderlich, um bei Illumina zu kaufen?
Kann ich zwei oder drei verschiedene Amplifikationen durchführen und sie dann zusammenfassen, bevor ich mit der Bibliotheksvorbereitung fortfahre?

Es ist möglich, 3 verschiedene AmpliSeq for Illumina-Designs mit jeweils Barcodes im selben Sequenzierungslauf auszuführen. Ihre Ziel-Amplikongröße und die erforderliche Abdeckung müssen jedoch in einem einzigen Lauf erreicht werden.

Sequenzierung

Welche Leselänge wird für die Sequenzierung empfohlen?

Für 140-275 bp-Amplikongrößen wird ein Paired-End-Read mit 2 × 150 bp empfohlen. Für 375 bp Amplikongrößen werden bis zu 2x300 bp Paired-End-Lauf auf dem MiSeq empfohlen.

Wie viele Proben können gleichzeitig sequenziert werden?

Dieses Kit verfügt über integrierte Proben-Barcodes, die das Poolen von bis zu 96 Proben pro Sequenzierungslauf ermöglichen. Die tatsächliche Anzahl der Proben, die pro Sequenzierungslauf zusammengeführt werden können, hängt jedoch von der Anzahl der Amplikons und der gewünschten Tiefe der Sequenzierungsabdeckung ab. In DesignStudio steht ein Online-Rechner zur Verfügung, der Sie bei diesen Berechnungen unterstützt.

Analyse

Welche Tools werden zur Datenanalyse angeboten?

Für Local Run Manager und BaseSpace Sequence Hub stehen Apps für die Analyse zur Verfügung. Die DNA-Amplikon-Analyse-App und die RNA-Amplikon-Analyse-App sind im BaseSpace Sequence Hub verfügbar. Eine weitere Analyse kann für alle Variantenaufrufe mit dem BaseSpace Variant Interpreter durchgeführt werden. Local Run Manager verfügt über ein ähnliches DNA-Amplikon-Analysemodul und ein ähnliches RNA-Amplikon-Analysemodul, die denselben Arbeitsablauf und denselben Algorithmus wie die BaseSpace Sequence Hub-Apps verwenden.

Der DNA-Amplikon-Analyse-Workflow kann verwendet werden, um das Alignment und das Varianten-Calling durchzuführen, und der RNA-Amplicon-Analyse-Workflow für das Fusion-Calling. Darüber hinaus steht OncoCNV-Caller, eine BaseSpace Lab Apps für die CNV-Analyse zur Verfügung.

Gibt es Beispieldaten, die ich anzeigen kann?

Ja, es gibt Beispieldatensätze in BaseSpace Public Data.

Welche tatsächliche Assay-Leistung kann ich von meinem Design erwarten?

DesignStudio liefert Amplikon-Designs mit hoher Zuverlässigkeit, die eine beispiellose Amplikon-Multiplexing-Leistung liefern. Da jedes Design einzigartig ist und die Probeneingabe variieren kann, muss die Leistung des Designs empirisch getestet werden.

Are there non-encrypted manifest files available for my RNA panels (custom or fixed) containing fusions?

No. Manifest files for any RNA panel containing fusions are unavailable in a non-encrypted format. Only the encrypted manifest file is available.

Where can I find the breakpoint details for fusion panels (custom or fixed) included in the design?

Information about exact breakpoints contained in all RNA fusion panel designs is not provided. The result files produced by Illumina software analysis tools provide details of any RNA fusion events identified by the software. For information on which gene pairs are evaluated for your panel, see the panel's data sheet.

Where can I find my alignment files (eg, BAM files) from my analysis of RNA panels containing fusions?

Illumina software packages, including BaseSpace Sequence Hub Apps, do not provide alignment files as output from the analysis. At this time, only the final reporting of the results from the analysis are provided. For more details, consult the software's documentation.

Is there any information about potential false negatives or uncalled fusions from analysis of RNA panels containing fusions?

No. The software only reports detected fusion events. For information on which gene pairs are evaluated for your panel, see the panel's data sheet.

AmpliSeq for Illumina On-Demand

What is the minimum number of genes I can order in an On-Demand panel?

We’ve set an ordering minimum of 1 gene or 24 amplicons per panel. Designs must also have at least 2 pools and 12 amplicons per pool.

What is the maximum number of genes I can order in an On-Demand panel?

We have set an ordering maximum of 500 genes or 15,000 amplicons per panel due to manufacturing restrictions. We are always making improvements, so this limit is likely to increase. You may be able to order larger designs in the future.

What annotation source and version is used to recognize gene symbols when creating an On-Demand Panel?

Illumina uses RefGene v74 as the source of annotations.

Are untranslated regions (UTRs) included in an On-Demand gene’s design?

No, only the coding DNA sequence (CDS) region of a gene is included as part of an On-Demand gene design.

What is “Gene Amplicon Uniformity”?

Gene amplicon uniformity is the percentage of amplicons for a gene with greater than 0.2 times the mean coverage of all amplicons targeting that gene. It represents the observed wet-lab uniformity calculated from NextSeq data with the Illumina DNA Amplicon workflow.

Do On-Demand panels support UTR-only genes? What about pseudogenes?

No. On-Demand panels only support genes containing CDS regions. Pseudogenes are not supported.

What is the padding used for On-Demand gene designs?

The padding for every On-Demand gene design is 5 bp on the 5′ and 3′ ends of the exon.

Have all possible gene combinations been tested for primer-primer interactions?

No. The number of possible combinations is astronomical. It is not feasible to test for all possible combinations in the lab. However, through computer-based searches, we have reduced the occurrence of primer-primer interactions as much as possible. In addition, when synthesizing many genes simultaneously in large batches, we have observed less than 1% amplicon drop-out due to suspected primer-primer interactions.

Why are the number of primer pairs per pool indicated on the tube and box labels different than the number of amplicons per pool indicated in DesignStudio?

Die Anzahl der amplicons per pool in DesignStudio reflects the number of unique amplicons in each pool. Die Anzahl der primer pairs per pool on the tube and box labels reflects the total number of oligos per pool. Either value can be used when preparing libraries according to the AmpliSeq for Illumina On-Demand, Custom and Community Panels Reference Guide (Table 4. X cycles and X minutes). If the values fall into different cycle categories, the higher PCR cycle number is recommended.

AmpliSeq for Illumina On-Demand – IGV Viewer

What is the “observed coverage” track in the IGV viewer?

The “observed coverage” track indicates the number of observed reads for each amplicon of each targeted gene during validation experiments on a NextSeq. Use this track as general guidance for the likely performance when running an experiment. While values can vary among assays, the general coverage trend should remain consistent.

What are “Gaps”?

Gaps occur where there are no amplicons to provide coverage for the intended target. We have made every effort to minimize the occurrence of these regions in our On-Demand designs.

What is the scale on the Y-axis?

The Y-axis represents the observed coverage normalized by the mean amplicon coverage for the gene.

Can I use coordinates to navigate the IGV viewer?

No. The IGV viewer can only focus on your gene of interest. In the Grid View, select a gene, and the IGV viewer updates automatically to center on that gene.

I notice that the “observed coverage” track for an amplicon occasionally does not appear to contain information. Warum ist das so?

All amplicons in the design contain reads that are visualized in the “observed coverage” track. If the number of reads covering an amplicon is relatively small in comparison to neighboring amplicons, the “observed coverage” track appears empty. However, if you change the scale to a lower value, you will then be able to visualize the lower number of reads. If the observed coverage track is not present, the designer notifies you why that track is not available.

Kontaktiere uns
Technical Support
Share With Tech Support

Get instructions for sharing your desktop while working with Technical Support.

Other Support
Kontaktiere uns
Technical Support
[email protected]
Other Support

Innovative technologies

At Illumina, our goal is to apply innovative technologies to the analysis of genetic variation and function, making studies possible that were not even imaginable just a few years ago. It is mission critical for us to deliver innovative, flexible, and scalable solutions to meet the needs of our customers. As a global company that places high value on collaborative interactions, rapid delivery of solutions, and providing the highest level of quality, we strive to meet this challenge. Illumina innovative sequencing and array technologies are fueling groundbreaking advancements in life science research, translational and consumer genomics, and molecular diagnostics.

Nur für Forschungszwecke. Nicht zur Verwendung in diagnostischen Verfahren (außer wie ausdrücklich angegeben).


COVER: a priori estimation of coverage for metagenomic sequencing

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Zusammenfassung

In any metagenomic project, the coverage obtained for each particular species depends on its abundance. This makes it difficult to determine a priori the amount of DNA sequencing necessary to obtain a high coverage for the dominant genomes in an environment. To aid the design of metagenomic sequencing projects, we have developed COVER, a web-based tool that allows the estimation of the coverage achieved for each species in an environmental sample. COVER uses a set of 16S rRNA sequences to produce an estimate of the number of operational taxonomic units (OTUs) in the sample, provides a taxonomic assignment for them, estimates their genome sizes and, most critically, corrects for the number of unobserved OTUs. COVER then calculates the amount of sequencing needed to achieve a given goal. Our tests and simulations indicate that the results obtained through COVER are in very good agreement with the experimental results.

Abb. S1. The accuracy of the estimation of the fraction of 16S rRNA sequences belonging to unobserved OTUs (Good&aposs sample coverage). The results were obtained using a simulated data set composed of 16S rRNA sequences corresponding to 200 genomes, with abundances following a log-normal distribution (upper panel) or a broken-stick distribution (lower panel). Both distributions are used in ecology: the first is widely found in many natural communities, whereas the second is predicted for communities where the resources are partitioned into niches at random. Although microbial communities usually do not follow the broken-stick distribution, we wanted to test the performance of our calculation under this model of extremely high evenness. The insets show a rank-abundance graph showing the shapes of the respective distributions, with species ranked by abundance on the x-axis. The expected number of sequences is calculated using Good&aposs estimator, as described in the main text, whereas the real numbers are obtained by the random sampling of the number of sequences indicated by the x-axis.

Abb. S2. Accuracy of the estimation of unknown genome sizes. Upper: The difference in the genome size (expressed as |S1 − S2/max(S1, S2)|, with S1 and S2 representing the real sizes of the genomes) for pairs of genomes of known sizes, in relation to their taxonomic proximity. The relationship between the genome size and taxonomic relatedness is apparent. For instance, genomes related at the species level (i.e. different strains from the same species) usually have less than a 10% difference in genome size. If the genomes belong to the same genus, the difference can extend to 25%, although in most cases, it remains at 10% or less. Lower: Use of the genome sizes of sequenced species to infer the sizes for species currently being sequenced (species ‘in progress’ in the NCBI database, http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi, whose size has been estimated, usually via PFGE). The plot shows the probability of inferring the size correctly using the sizes of other species at different taxonomic ranks. For instance, the case marked by a dashed line in the plot corresponds to the estimation of the size of some species using the known sizes of other species from the same genus. In that case, there is an approximate 75% probability that we can infer its genome size with less than 10% error.

Abb. S3. Accuracy of the estimation of the 16S rRNA copy number. Differences in copy number (expressed as |C1 − C2/max(C1, C2)|, with C1 and C2 representing the numbers of 16S copies in the genomes) for pairs of genomes of known copy number, in relation to their taxonomic proximity.

Abb. S4. Variation of the estimated coverage in relation to the number of 16S rRNA sequences provided. A community of 100 species was simulated, and the estimated coverage for the first 10 members was calculated by COVER using different initial numbers of 16S sequences, supposing a sequencing effort of 500 000 reads of 400 base pairs each. It can be seen that the estimates of coverage oscillate greatly when few sequences are provided, indicating that the community composition is still not well determined. When a substantial amount of 16S sequences is provided (between 2000 and 3000, in this case), the estimated coverage values stabilize and are very similar to the real coverage values (last point in the plot).

Fig. S5. Results of the estimation of coverage for a controlled data set composed of 100 genomes, with abundances following a log-normal distribution. The results are obtained by simulating the sequencing of 500 000 reads of 400 bp each. The plot shows the real coverage for each species (red line) and the obtained coverage predicted by COVER (green points). Species (genomes) are sorted according their abundances. Estimated coverage values match the real values very well. Some instances have no coverage estimated. These species have been merged with closely related ones because the 16S identity for the related species is 98% or more. Zum Beispiel, Burkholderia cenocepacia is given a coverage of zero because it was merged with Burkholderia pseudomallei, whose coverage is, thus, overestimated. Both species share 98% identity in their 16S rRNA. There was a similar occurrence for two more cases in this experiment: Bacillus anthracis was merged with Bacillus cereus, und Escherichia fergusonii was merged with Escherichia coli.

Table S1. Upper: Number of taxa for each rank, as listed in NCBI&aposs taxonomy database (http://www.ncbi.nlm.nih.gov/Taxonomy) and the number of taxa containing at least one member with known size (from either complete genomes, genomes in progress or genomes with PFGE size estimates, http://www.genomesize.com/prokaryotes). Lower: Presence of families without any members of known genome size in the environmental samples (http://metagenomics.uv.es/envDB). In a set of 3035 samples, 810 contain a member from one of these families.

Table S2. Results obtained for the estimation of the number of reads needed for obtaining coverage 5× for the most represented genome in a controlled data set composed of 300 genomes, with abundances following a log-normal distribution. For studying the influence of inaccurate estimations of genomic sizes, we allowed these sizes to vary by some percentage of their original values. We draw a random value between 0 and a given percentage of the estimated genomic size, and added or subtracted that value to the estimation. The results obtained allowing 20% and 50% of variation are shown. The values change around 10% when allowing 20% of variation in the estimated sizes, and barely 25% when allowing 50% of variation.

Tabelle S3. Comparison of the real and expected results for two metagenomic sequencing projects. The metagenomes were kindly provided by Dr Alejandro Mira (CSISP, Valencia, Spain), and they consist of two coupled sets of 16S and metagenomic sequences from oral samples. The first was obtained by sequencing amplicons from clone libraries. The contig length distributions for the real and expected instances were calculated as described in the text.

Dateiname Beschreibung
EMI4_338_sm_FigS1.jpg165 KB Unterstützendes Infoelement
EMI4_338_sm_FigS2.jpg207.5 KB Unterstützendes Infoelement
EMI4_338_sm_FigS3.jpg61.4 KB Unterstützendes Infoelement
EMI4_338_sm_FigS4.jpg93.6 KB Unterstützendes Infoelement
EMI4_338_sm_FigS5.jpg46.1 KB Unterstützendes Infoelement
EMI4_338_sm_TabS1.doc23 KB Unterstützendes Infoelement
EMI4_338_sm_TabS2.doc27.5 KB Unterstützendes Infoelement
EMI4_338_sm_TabS3.doc33.5 KB Unterstützendes Infoelement

Bitte beachten Sie: Der Herausgeber ist nicht verantwortlich für den Inhalt oder die Funktionalität der von den Autoren bereitgestellten unterstützenden Informationen. Alle Anfragen (außer fehlenden Inhalten) sollten an den entsprechenden Autor des Artikels gerichtet werden.