Information

Programmatische Möglichkeit, Homodimere von Heterodimeren zu unterscheiden?

Programmatische Möglichkeit, Homodimere von Heterodimeren zu unterscheiden?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Zumpdbfiles gibt es eine einfache programmgesteuerte Methode, um festzustellen, ob die Datei aus Homodimeren oder Heterodimeren besteht.

Ich habe viele Dateien, daher würde ein Online-Tool oder Pseudocode/Skripte mehr helfen, als jede einzelne manuell zu bewerten.


Ich würde nur die Aminosäuresequenzen der einzelnen Proteinketten vergleichen. Mit etwas Spielraum für Reste, die in der Dichte nicht beobachtet werden, dh nur 90 oder 95 % Sequenzidentität erfordern oder Lücken ignorieren.

Dies sagt Ihnen nichts darüber aus, ob das Dimer (wenn Sie mehrere Moleküle in der asymmetrischen Einheit beobachten) tatsächlich real ist. Dazu müsste man ein Experiment machen, Literatur recherchieren oder schauen, ob Software wie der PISA-Server einen Anhaltspunkt geben könnte.


Falls Sie ein eigenes Unterprogramm schreiben möchten,
1. Scannen Sie das Ganze.pdbDatei für die Anzahl der vorhandenen Ketten, wenn mehrere, fahren Sie fort.
2. Erstellenindex_counterfür jede Aminosäure einer einzelnen Kette.
3. Jetzt für EINZELNE Kette. Während Sie nach jeder Aminosäure scannen, führen Sie ai=i+1Betrieb für diese spezifischeAminosäure_Zähler.
4. Vergleichen Sie dieAminosäure_Zählerzwischen/zwischen den Ketten.
5. Genaue Übereinstimmung = Homomer oder nicht genaue Übereinstimmung = Heteromer.
Hoffe du verstehst die Logik.


Ann K. Corsi, Ph.D.

Unsere Forschung zielt darauf ab, die grundlegende Frage der Entwicklungsbiologie zu verstehen: "Wie wird das Schicksal einer Zelle während der Entwicklung festgelegt?" Oder einfacher gesagt, woher weiß eine Zelle, dass sie zu einer Muskelzelle wird und nicht zu einer Nervenzelle oder einem anderen Zelltyp? Bestimmte Proteine ​​tragen zum Schicksal einer Zelle bei, und Regulatoren, die Transkriptionsfaktoren genannt werden, kontrollieren das Vorhandensein dieser Proteine. Eine sorgfältige Untersuchung, wie Transkriptionsfaktoren ihre Funktion erfüllen, wird daher entscheidend sein, um die Spezifikation des Zellschicksals zu verstehen. Wir untersuchen die Spezifizierung des Zellschicksals im Kontext der Transkriptionsregulation im Mesoderm. Das Mesoderm ist die mittlere embryonale Keimschicht, aus der Muskel-, Binde- und Herzgewebe gewonnen werden. Als Modellorganismus verwenden wir den nichtparasitären Bodennematoden Caenorhabditis elegans. C. elegans hat eine Reihe von Vorteilen für die Untersuchung der Entwicklung, wie transparente Zellen, vollständige Genominformationen und leistungsstarke Genetik. Die Tiere haben auch eine kurze Generationszeit von 3 Tagen, was ein schnelles Experimentieren ermöglicht. Darüber hinaus haben die Nematoden mehrere Gewebetypen, die mesodermalen Ursprungs sind, und dennoch eine geringe Gesamtzahl mesodermaler Zellen, so dass wir uns auf Ereignisse auf Einzelzellebene konzentrieren können.

Eine Reihe von Transkriptionsfaktoren spielen eine Rolle bei der Spezifizierung des Zellschicksals. Wir konzentrieren uns auf einen grundlegenden Helix-Loop-Helix (bHLH) Transkriptionsfaktor CeTwist, der bei der Musterbildung und Spezifizierung des Mesoderms in C. elegans eine Rolle spielt. Unser Ziel ist es, den Mechanismus zu verstehen, durch den dieser Faktor die Expression von Zielgenen in verschiedenen mesodermalen Zellen steuert. CeTwist bildet mit einem anderen bHLH-Faktor, CeE/DA, Heterodimere. Als ersten Schritt zu unserem Ziel haben wir Zielgene der Heterodimere identifiziert, indem wir Mikroarrays verwendet haben, die alle Transkripte im Genom von C. elegans repräsentieren (Wang et al., 2006). Wir haben auch den Regulationsmechanismus eines der Zielgene, arg-1, untersucht (Zhao et al., 2007). In der Promotorregion von arg-1 haben wir drei Elemente gefunden, die einzigartig für das Expressionsmuster von arg-1 erforderlich sind. Derzeit verfolgen wir verschiedene Forschungsrichtungen, um zu verstehen, wie diese Elemente von den bHLH-Faktoren zur Regulierung der Transkription in einzelnen Zellen einzigartig verwendet werden. Darüber hinaus haben wir eine Rolle für CeTwist enthaltende Homodimere identifiziert (Manuskript in Vorbereitung) und verwenden einen Microarray-Ansatz, um Zielgene der Homodimere zu identifizieren. Um schließlich die zeitliche und räumliche Regulation der CeTwist- und CeE/DA-Gene zu verstehen, verwenden wir einen Reportergen-Ansatz, um Elemente zu identifizieren, die für ihre Expression wichtig sind. Insgesamt erwarten wir, dass unsere vielfältigen Ansätze ein mechanistisches Verständnis der Zielgenkontrolle durch bHLH-Faktoren in der Mesodermentwicklung ermöglichen werden.

Unsere Arbeit hat schwerwiegende Folgen für die menschliche Gesundheit. Mutationen im menschlichen Twist-Gen werden mit einer Entwicklungsstörung namens Saethre-Chotzen-Syndrom in Verbindung gebracht, bei der Patienten kraniofaziale und Fingerdefekte haben. Mutationen in menschlichen Homologen mehrerer CeTwist-Zielgene, einschließlich arg-1, werden mit anderen menschlichen Syndromen in Verbindung gebracht, die ähnliche Defekte verursachen wie bei Saethre-Chotzen-Patienten, und es gibt ähnliche Krankheiten, deren zugrunde liegende genetische Grundlage noch nicht bekannt ist. Somit werden C. elegans-Gene, die durch die genetischen und molekularen Ansätze in unserem Labor identifiziert wurden, Kandidaten für defekte menschliche Gene bei Individuen mit verwandten Entwicklungssyndromen aufdecken. Wir haben bereits mehrere Kandidatengene gefunden und erwarten, dass ein sorgfältiges Verständnis ihrer Regulation uns helfen wird, mehr über kraniofaziale Erkrankungen beim Menschen zu verstehen.

Forschungsförderung

Die Arbeit von Dr. Corsi wird durch einen R15 Academic Research Enhancement Award (AREA) des National Institute of Dental and Craniofacial Research der National Institutes of Health finanziert.  

Aktuelle Veröffentlichungen

1. Kim, S, Twigg, SRF, Scanlon, VA, Chandra, A, Hansen, TJ, Alsubait A, Fenwick AL, McGowan SJ, Lord H, Lester T, Sweeney E, Weber A, Cox H, Wilkie AOM, Golden , A, Corsi, AK (2017) Lokalisierte TWIST1- und TWIST2-Basisdomänenmutationen verursachen vier verschiedene menschliche Krankheiten, die in modelliert werden können C. elegans. Hum Mol Genet. 26:2118-2132.

2. Corsi, AK, Wightman B und Chalfie M (2015) Ein transparentes Fenster in die Biologie: Eine Einführung zu Caenorhabditis elegans. Genetik 200:387-407.


Abstrakt

Meganukleasen schneiden lange (㸒 bp) einzigartige Sequenzen in Genomen und können verwendet werden, um gezieltes Genom-Engineering durch homologe Rekombination in der Nähe ihrer Spaltungsstelle zu induzieren. Die Verwendung natürlicher Meganukleasen ist jedoch durch das Repertoire ihrer Zielsequenzen begrenzt, und es wurden beträchtliche Anstrengungen unternommen, um neu gestaltete Meganukleasen zu entwickeln, die ausgewählte Ziele spalten. Homodimere Meganukleasen wie I-CreI haben ein Gerüst bereitgestellt, können jedoch nur modifiziert werden, um neue quasi-palindromische DNA-Sequenzen zu erkennen, was ihre allgemeine Anwendbarkeit einschränkt. Andere Gruppen haben Dimer-Schnittstellen-Redesign und Peptidbindung verwendet, um die Heterodimerisierung zwischen verwandten Meganukleasen wie I-DmoI und I-CreI zu kontrollieren, aber bis jetzt gab es keine Anwendung, die speziell auf die Gerüste aus bestehenden kombinatorischen Bibliotheken von I-CreI . abzielte . Hier zeigen wir, dass das Engineering von Meganukleasen, um obligate Heterodimere zu bilden, zu funktionellen Endonukleasen führt, die nicht-palindromische Sequenzen schneiden. Der Protein-Design-Algorithmus (FoldX v2.7) wurde verwendet, um spezifische Heterodimer-Schnittstellen zwischen zwei Meganuklease-Monomeren zu entwerfen, die selbst konstruiert wurden, um unterschiedliche DNA-Sequenzen zu erkennen. Die neuen Monomere begünstigen die Bildung funktioneller Heterodimeren und verhindern die Erkennung von Homodimerstellen. Dieses Design erhöht massiv das potenzielle Repertoire an DNA-Sequenzen, die spezifisch von entworfenen I-CreI-Meganukleasen angesteuert werden können, und öffnet den Weg für ein sichereres zielgerichtetes Genom-Engineering.


Ergebnisse

Spezifische PRLR-PRLR-Interaktion wird durch den Split-Luciferase-Komplementationsassay nachgewiesen

Parallel zu unseren Studien zur GHR-GHR-Komplementation versuchten wir, den Split-Luciferase-Komplementierungsassay (45) einzusetzen, um die PRLR-PRLR-Assoziation zu untersuchen. Wir schufen zunächst hPRLR-Nluc- und PRLR-Cluc-Chimärenproteine ​​mit einem flexiblen 10-Reste-Linker (AAAGSGGGGGS) zwischen Rezeptor und luc-Fragmenten ( Abbildung 1 A). Zum Vergleich sind auch unsere zuvor beschriebenen GHR-Nluc, GHR-Cluc, EPOR-Cluc und ER-Fragment-Cluc (44) in Abbildung 1 A dargestellt. Wie zuvor verwendeten wir die JAK2-exprimierende humane Fibrosarkom-Zelllinie, &# x003b32A-JAK2 (53,�), als Wirt für die Expression der Chimären. Ein Expressionsvektor, der Wildtyp-PRLR kodiert, wurde als Positivkontrolle und nur Vektor als Negativkontrolle für Experimente verwendet, die die transiente Transfektion von Vektoren, die PRLR-Nluc und PRLR-Cluc kodieren, vergleichen. Immunblotting von Detergenzextrakten transfizierter Zellen mit Anti-PRLR (Abbildung 1 B) zeigte, dass beide Chimären wie erwartet bei den entsprechenden M . exprimiert und nachgewiesen wurdenR. Darüber hinaus verursachten sowohl GH als auch PRL eine akute Aktivierung der Signalübertragung, wie durch Immunblotting mit anti-pSTAT3/anti-STAT3 nachgewiesen (Abbildung 1 C), was auf eine geeignete Faltung und Zelloberflächenpräsentation der PRLR-luc-Chimärenrezeptoren hinweist, wie zuvor für GHR . gezeigt -luc- und EPOR-luc-Chimären (44).

Spezifische Luciferase-Komplementierung von PRLR-Nluc mit PRLR-Cluc. A, Schematische Darstellung von Luciferase-Fragment-Chimären, die in dieser Studie verwendet wurden. Alle im Text und in Materialien und Methoden beschriebenen Konstrukte. PRLR-Nluc und PRLR-Cluc: hPRLR voller Länge, fusioniert am Ende des ICD mit entweder Nluc bzw. Cluc über ein Linkerpeptid. GHR-Nluc und GHR-Cluc: Human-GHR voller Länge, fusioniert am Ende des ICD entweder mit Nluc oder Cluc über ein Linker-Peptid. EPOR-Cluc: Human-EPOR voller Länge, fusioniert am Ende des ICD mit Cluc über ein Linker-Peptid. ER-Cluc: menschliches ER-Fragment, fusioniert mit Cluc. B, PRLR-Nluc und PRLR-Cluc sind spezifisch immunnachweisbar und zeigen die erwartete SDS-PAGE-Migration. 𻌪-JAK2-Zellen wurden vorübergehend transfiziert, um PRLR, PRLR-Nluc, PRLR-Cluc oder mit dem leeren Vektor pcDNA3.1(+)/zeo zu exprimieren. Waschmittelzellextrakte wurden durch SDS-PAGE aufgetrennt und mit Anti-PRLR (H-300) immungeblottet. PRLR- und PRLR-luc-Chimären sind durch ein Sternchen gekennzeichnet und zeigen die erwartete Migration. NS, unspezifisch. C, PRLR-Nluc und PRLR-Cluc ermöglichen eine normale akute Liganden-induzierte Signalübertragung. 𻌪-JAK2-Zellen wurden transfiziert, um PRLR, PRLR-Nluc, PRLR-Cluc oder mit dem leeren Vektor pcDNA3.1(+)/zeo zu exprimieren. Behandlung: ±GH oder PRL. Immunblot von Zellextrakten für phosphoryliertes und Gesamt-STAT3. D, Spezifische Luciferase-Komplementierung von PRLR-Nluc mit PRLR-Cluc. 𻌪-JAK2-Zellen wurden vorübergehend mit Expressionsplasmiden transfiziert, die die angegebenen Chimären kodieren. Die Biolumineszenz wurde dreifach bestimmt (Einschub zeigt die tatsächlichen farbcodierten Signale) und wird grafisch als mittlerer ± SE des Gesamtflusses (Photonen/s × 1000) angezeigt. Für PRLR-Nluc/PRLR-Cluc vs PRLR-Nluc/EPOR-Cluc oder PRLR-Nluc/ER-Cluc, P < .05 bzw. Weitere Informationen finden Sie unter Materialien und Methoden.

Um die Interaktion von Rezeptoren zu beurteilen, koexprimierten wir PRLR-Nluc mit PRLR-Cluc in 𻌪-JAK2 und maßen die Rekonstitution der Luciferase-Aktivität (Komplementierung von Nluc mit Cluc) mittels IVIS 100-Biolumineszenz-Bildgebung lebender transfizierter Zellen in Gegenwart von D- Luciferin (Abbildung 1 D). Bei der PRLR-Nluc/PRLR-Cluc-Coexpression ergab sich eine beträchtliche Komplementation, während bei der PRLR-Nluc/EPOR-Cluc- oder PRLR-Nluc/ER-Cluc-Coexpression sehr wenig Signal nachgewiesen wurde. Dieses Ergebnis deutet auf eine ligandenunabhängige spezifische Präassoziation von PRLRs hin, im Einklang mit Studien mit verschiedenen Methoden, die eine ligandenunabhängige PRLR-Dimerbildung zeigten (25, 31).

Auswirkungen der Ligandenbehandlung auf die PRLR-PRLR-Komplementation

Um Ligandeneffekte auf die PRLR-PRLR-Komplementation zu untersuchen, isolierten wir 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc-Zellen, in denen PRLR-Nluc und PRLR-Cluc stabil im 𻌪-JAK2-Zellhintergrund koexprimiert werden. Wie bei den transienten Transfektionen in Abbildung 1 wurden PRLR-Nluc und PRLR-Cluc in 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc-Zellen durch Anti-PRLR-Immunpräzipitation und Immunblotting nachgewiesen, und beide Chimären wurden durch Anti-pY . nachgewiesen Immunblotting nach kurzer Behandlung der Zellen mit PRL (Abbildung 2 A, oberes Feld). In diesem stabilen Klon war PRLR-Nluc in etwas größerer Menge vorhanden und wurde als Reaktion auf PRL entsprechend stärker induzierbar als PRLR-Cluc. Wie erwartet, verursachte PRL auch eine akute Phosphorylierung sowohl von JAK2 als auch von STAT5, wie durch Immunblotting von Zellextrakten nachgewiesen wurde (Abbildung 2 A, untere Tafel).

PRL und GH induzieren spezifisch zeitliche Veränderungen der PRLR-PRLR-Komplementation. A, PRL-Signalgebung in 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc-Zellen, in denen PRLR-Nluc und PRLR-Cluc stabil im 𻌪-JAK2-Hintergrund exprimiert werden. Behandlung: ±PRL. Oberes Feld, Waschmittelzellextrakte wurden mit Anti-PRLR (Anti-PRLRcyt-AL84), durch SDS-PAGE aufgelöst und sequenziell mit Anti-pY und Anti-PRLR (Anti-PRLRcyt-AL84). Unteres Feld, Immunblot von Zellextrakten für Anti-pJAK2, Anti-JAK2, Anti-pSTAT5 und Anti-STAT5. Die schwarzen Pfeilspitzen zeigen phosphoryliertes oder Gesamt-PRLR-Nluc (obere Bande) und phosphoryliertes oder Gesamt-PRLR-Cluc (untere Bande) an. B, PRL-konzentrationsabhängige Veränderungen der Komplementation. Nachdem die basale Biolumineszenz in 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc-Zellen bestimmt wurde, wurde PRL in den angegebenen Konzentrationen zugegeben und die Biolumineszenz wurde seriell in 5-Minuten-Intervallen über 40 Minuten bestimmt. Die Daten werden als mittlerer ± SE des PRL-induzierten Signals als Prozentsatz über dem Basisliniensignal (n = 3 pro Bedingung) ausgedrückt. Für 100-ng/ml-PRL vs. 250-ng/ml-PRL oder 500-ng/ml-PRL, P < .05 jeweils zu jedem Zeitpunkt. Für 250-ng/ml-PRL vs. 500-ng/ml-PRL, P < .05 bei 35 und 40 Minuten. C, GH-konzentrationsabhängige Veränderungen der Komplementation. Nachdem die basale Biolumineszenz in 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc-Zellen bestimmt wurde, wurde GH in den angegebenen Konzentrationen zugegeben und die Biolumineszenz wurde seriell bestimmt. Weitere Informationen finden Sie unter Materialien und Methoden. Für 100-ng/ml-GH im Vergleich zu 500-ng/ml-GH, P < .05 zu jedem Zeitpunkt. Für 100-ng/ml-GH im Vergleich zu 250-ng/ml-GH, P < .05 bei 25 und 30 Minuten. D, PRLR-spezifischer Antagonist, G129R, hemmt die GH- und PRL-induzierte JAK2-Aktivierung in 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc-Zellen. Präinkubation: ±G129R (20 μg/ml). Behandlung: ±GH oder PRL. Immunblot von Zellextrakten für phosphoryliertes und Gesamt-JAK2. E, G129R allein beeinflusst nicht die basale Komplementation von PRLR-PRLR. 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc-Zellen wurden mit Vehikel oder G129R für 30 Minuten vorinkubiert, wonach die Biolumineszenz bestimmt wurde. Die Daten werden grafisch als mittlerer ± SE-Gesamtfluss (Photonen/s × 1000) angezeigt. Es wurde kein signifikanter Unterschied festgestellt (n = 12 pro Bedingung). F, PRLR-spezifischer Antagonist, G129R, hemmt PRL-induzierte Veränderungen der PRLR-PRLR-Komplementation. 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc-Zellen wurden mit G129R vorinkubiert und anschließend mit PRL (500 ng/ml) behandelt, wonach die Biolumineszenz seriell bestimmt wurde. Weitere Informationen finden Sie unter Materialien und Methoden. Für PRL vs. PRL+G129R, P < .05 zu jedem Zeitpunkt. G, PRLR-spezifischer Antagonist, G129R, hemmt GH-induzierte Veränderungen der PRLR-PRLR-Komplementation. 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc-Zellen wurden mit G129R vorinkubiert und anschließend mit GH (500 ng/ml) behandelt, wonach die Biolumineszenz seriell bestimmt wurde. Weitere Informationen finden Sie unter Materialien und Methoden. Für GH im Vergleich zu GH+G129R, P < .05 zu jedem Zeitpunkt.

Da hPRLR sowohl von PRL als auch von GH aktiviert wird ( Tabelle 1 ), testeten wir Ligandeneffekte auf die PRLR-Nluc/PRLR-Cluc-Komplementation in Zeitverlaufsexperimenten mit unterschiedlichen Konzentrationen von PRL ( Abbildung 2 B) und GH ( Abbildung 2 C). In jedem Fall wurde nach dem Nachweis der basalen Biolumineszenz Ligand zu den 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc-Zellen zugegeben und die Biolumineszenz wurde sequentiell in 5-Minuten-Intervallen für 40 Minuten gemessen. PRL steigerte die basale Biolumineszenz in einer dosisabhängigen Weise schnell, wobei sie nach 15 Minuten mit 500-ng/ml-PRL im Durchschnitt um etwa 45 % zunahm. Danach nahm das Signal nach 30� Minuten auf ungefähr 30 %� % über dem Basalwert ab. (Abbildung 2B). Wie PRL erhöhte auch die GH-Behandlung dosisabhängig die PRLR-Nluc/PRLR-Cluc-Komplementation nach 15 Minuten mit 500 ng/ml GH um fast 70 % (Abbildung 2 C). Diese Muster erinnerten an diejenigen, die zuvor bei der GH-Behandlung von Zellen beobachtet wurden, die GHR-Nluc/GHR-Cluc (44) exprimieren, und legen ebenfalls nahe, dass sowohl PRL als auch GH die Annäherung der C-terminalen Schwänze von PRLR-Nluc und PRLR-Cluc innerhalb von verstärken ein vorgeformtes PRLR-Dimer.

Tabelle 1.

Bindungsstellen von Liganden und Antagonisten gegen Rezeptordimere

G129R ist eine hPRL-Mutante, bei der der Glycinrest an Position 129 von PRL durch Arginin ersetzt ist PRL (Tabelle 1). Wie erwartet, löste die Behandlung von 𻌪-JAK2-PRLR-Nluc/PRLR-Cluc-Zellen mit G129R selbst keine Signalübertragung aus, jedoch blockierte G129R sowohl die GH- als auch die PRL-induzierte JAK2-Phosphorylierung vollständig (Abbildung 2 D). In Übereinstimmung mit diesen Signalisierungsdaten veränderte G129R selbst die basale Komplementation von PRLR-Nluc/PRLR-Cluc nicht (Abbildung 2 E), blockierte jedoch sowohl die PRL-induzierte ( Abbildung 2 F) als auch die GH-induzierte ( Abbildung 2 G) Augmentation von PRLR- Nluc/PRLR-Cluc-Komplementation. Dies deutet stark darauf hin, dass die Liganden-induzierte Erhöhung der PRLR-Nluc/PRLR-Cluc-Komplementation die proximalen Ereignisse der PRLR-Aktivierung bei der Ligandenbindung widerspiegelt.

GHR-PRLR-Interaktion und Hetero-Komplementation

In humanen T47D-Brustkrebszellen, die sowohl GHR als auch PRLR endogen exprimieren, werden die beiden Rezeptoren unabhängig von der Ligandenbindung spezifisch coimmunpräzipitiert (42), was darauf hindeutet, dass GHR und PRLR in intakten Zellen interagieren, obwohl die Stöchiometrie und Architektur der GHR-PRLR-Komplexe unbekannt sind . Wir verfolgten diese Assoziation mit unserem Split-Luciferase-Komplementierungsassay weiter, bei dem 𻌪-JAK2-Zellen verwendet wurden, die stabil PRLR-Nluc exprimieren (𻌪-JAK2-PRLR-Nluc) ( Abbildung 3 A). 𻌪-JAK2-PRLR-Nluc-Zellen wurden vorübergehend entweder mit GHR-Cluc, PRLR-Cluc, EPOR-Cluc oder ER-Cluc transfiziert. Wie erwartet führte die PRLR-Cluc-Expression zu einer wesentlichen spezifischen PRLR-Nluc/PRLR-Cluc-Komplementation. Bemerkenswerterweise wurde eine ähnliche Komplementation bei der PRLR-Nluc/GHR-Cluc-Coexpression beobachtet. Dies stimmt mit unseren früheren GHR-PRLR-Koimmunpräzipitationsergebnissen überein.

Spezifische Luciferase-Heterokomplementierung von PRLR-luc mit GHR-luc und der Ligandeneffekt. A, Spezifische Luciferase-Komplementierung von PRLR-Nluc mit GHR-Cluc. 𻌪-JAK2-PRLR-Nluc-Zellen wurden vorübergehend mit Expressionsplasmiden transfiziert, die die angegebenen Chimären kodieren. Die Biolumineszenz wurde dreifach bestimmt (Einschub zeigt die tatsächlichen farbcodierten Signale) und wird grafisch als mittlerer ± SE-Gesamtfluss (Photonen/s × 1000) angezeigt. Für GHR-Cluc vs. EPOR-Cluc oder ER-Cluc, P < .05. Für PRLR-Cluc vs. EPOR-Cluc oder ER-Cluc war der Wert P < .05. Weitere Informationen finden Sie unter Materialien und Methoden. B, Charakterisierung von GNR-Nluc- und PRLR-Cluc-doppelstabilen Zellen. Serum-verhungerte 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-Zellen wurden mit ± GH oder PRL behandelt. Linkes Feld, Waschmittelzellextrakte wurden mit Anti-GHR (Anti-GHR .) immunpräzipitiertcyt-AL47) oder Anti-PRLR (Anti-PRLRcyt-AL84), aufgelöst durch SDS-PAGE und sequenziell immungeblottet mit Anti-pY und Anti-GHR (Anti-GHRcyt-AL47) oder Anti-PRLR (Anti-PRLRcyt-AL84). Rechtes Feld, Immunblot von Zellextrakten für phosphoryliertes und Gesamt-STAT5 und phosphoryliertes und Gesamt-STAT3. C, GH-konzentrationsabhängige Veränderungen der Heterokomplementation. Nachdem die basale Biolumineszenz in 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-Zellen bestimmt wurde, wurde GH in den angegebenen Konzentrationen zugegeben und die Biolumineszenz wurde seriell bestimmt. Weitere Informationen finden Sie unter Materialien und Methoden. Für 50-ng/ml-GH im Vergleich zu 100-ng/ml-GH, P < .05 zu jedem Zeitpunkt von 20 bis 40 Minuten. Für 50-ng/ml-GH im Vergleich zu 250-ng/ml-GH, P < .05 zu jedem Zeitpunkt außer 10 und 15 Minuten. Für 50-ng/ml-GH vs. 500-ng/ml-GH, P < .05 zu jedem Zeitpunkt außer 5 Minuten. Für 50-ng/ml-GH im Vergleich zu 1000-ng/ml-GH, P < .05 zu jedem Zeitpunkt außer 5 Minuten. Für 100-ng/ml-GH im Vergleich zu 250-ng/ml-GH, P < .05 zu jedem Zeitpunkt außer 10 und 15 Minuten. Für 100-ng/ml-GH im Vergleich zu 500-ng/ml-GH, P < .05 zu jedem Zeitpunkt außer 5 Minuten. Für 100-ng/ml-GH im Vergleich zu 1000-ng/ml-GH, P < .05 zu jedem Zeitpunkt außer 5 Minuten. Für 250-ng/ml-GH im Vergleich zu 500-ng/ml-GH oder 1000-ng/ml-GH, P < .05 zu jedem Zeitpunkt. D, PRL-konzentrationsabhängige Veränderungen der Heterokomplementation. Nachdem die basale Biolumineszenz in 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-Zellen bestimmt wurde, wurde PRL in den angegebenen Konzentrationen zugegeben und die Biolumineszenz wurde seriell bestimmt. Weitere Informationen finden Sie unter Materialien und Methoden. Für 50-ng/ml-PRL im Vergleich zu 100–ng/ml-PRL, P < .05 bei 25, 30 und 40 Minuten. Für 50-ng/ml-PRL vs. 250-ng/ml-PRL oder 500-ng/ml-PRL, P < .05 zu jedem Zeitpunkt außer 5 Minuten. Für 50-ng/ml-PRL vs. 1000-ng/ml-PRL, P < .05 zu jedem Zeitpunkt. Für 100-ng/ml-PRL im Vergleich zu 250-ng/ml-PRL oder 500-ng/ml-PRL oder 1000-ng/ml-PRL, P < .05 zu jedem Zeitpunkt. Für 250-ng/ml-PRL vs. 500-ng/ml-PRL, P < .05 bei 20 und 25 Minuten. Für 250-ng/ml-PRL vs. 1000-ng/ml-PRL, P < .05 von 10 bis 25 Minuten.

Da GH sowohl GHR als auch PRLR aktiviert, vermuten wir, dass die GHR-PRLR-Assoziation biologisch relevante Konsequenzen haben kann. Um die Natur des GHR-PRLR-Heteromers und die Wirkungen der Ligandenbehandlung besser zu verstehen, isolierten wir 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-Zellen, die GHR-Nluc und PRLR-Cluc stabil exprimieren und eine wesentliche basale Luciferase-Komplementierung aufweisen (Daten nicht gezeigt). Wie erwartet, löste GH die Phosphorylierung von GHR-Nluc und PRLR-Cluc aus, und PRL löste nur die Phosphorylierung von PRLR-Cluc aus ( Abbildung 3 B, linkes Feld). Ebenso lösten sowohl GH als auch PRL die zelluläre STAT3- und STAT5-Signalisierung aus (Abbildung 3 B, rechtes Feld). Somit werden sowohl GHR-Nluc als auch PRLR-Cluc reichlich an der Zelloberfläche exprimiert und ermöglichen normalerweise den Ligandeneingriff und die Aktivierung der Signalübertragung in diesen Zellen.

Als nächstes untersuchten wir die Wirkungen einer GH- oder PRL-Behandlung auf die GHR-Nluc/PRLR-Cluc-Komplementation. Bemerkenswerterweise und in scharfem Gegensatz zur Verstärkung der Komplementation durch GH auf GHR-Nluc/GHR-Cluc und PRLR-Nluc/PRLR-Cluc ergab die GH-Behandlung von 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-Zellen weitgehend a dosisabhängiger Rückgang der Komplementation über eine Behandlungsdauer von 40 Minuten, am deutlichsten nach 15 Minuten (Abbildung 3 C). Dies legt nahe, dass sich ein GHR-PRLR-Heteromer als Reaktion auf GH ganz anders verhält als ein GHR-GHR-Homodimer oder ein PRLR-PRLR-Homodimer. Prinzipiell ist eine mögliche Anordnung des Heteromers in Form eines GHR-PRLR-Heterodimers an sich. Dies würde implizieren, dass GH an die Heterodimer-Partner binden könnte, um irgendwie eine Trennung ihrer Schwänze und eine daraus resultierende verminderte Komplementierung zu bewirken. Eine andere mögliche Anordnung wäre jedoch, dass das Heteromer aus GHR-Nluc/GHR-Nluc-Homodimeren und PRLR-Cluc/PRLR-Cluc-Homodimeren in einem heterooligomeren Komplex besteht. In diesem Fall würde die basale Komplementation aus der Interaktion von GHR-Nluc mit PRLR-Cluc resultieren, jeweils innerhalb benachbarter Homodimere, und die GH-Bindung an jedes Homodimer würde dazu führen, dass die nicht komplementierenden Rezeptorschwänze innerhalb der Dimere näher zusammenrücken, aber die komplementierenden Schwänze zwischen den Dimeren sich bewegen voneinander entfernt, wodurch das Komplementationssignal verringert wird. Um dies zu testen, fragten wir, welche Wirkung eine PRL-Behandlung haben würde, mit der Begründung, dass PRL kein GHR-PRLR-Heterodimer oder ein GHR-GHR-Homodimer, sondern nur ein PRLR-PRLR-Homodimer involvieren kann. Interessanterweise führte die PRL-Behandlung von 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-Zellen (Abbildung 3D) zu einer dosisabhängigen Abnahme der Komplementation, ähnlich wie bei der Reaktion auf GH, was die Hypothese begünstigt, dass die GHR- Die PRLR-Assembly, an der beide Liganden beteiligt sind, ist eher eine von heteromeren GHR-GHR- und PRLR-PRLR-Dimeren als von GHR-PRLR-Heterodimeren. Diese heteromere Anordnung kann als (GHR-GHR)x/(PRLR-PRLR)y-Multimer dargestellt werden, wobei die Expressionsniveaus jedes Rezeptors x und y und somit die Stöchiometrie des Komplexes definieren könnten (z. B. ein Dimer von Dimeren, wenn x =y = 1, aber ein Hexamer mit 3 Dimeren, wenn z. B. x = 1 und y = 2 ist).

Wirkungen von GHR- und PRLR-Antagonisten auf die GHR-PRLR-Heterokomplementation

G120R ist eine hGH-Mutante mit einer Gly-zu-Arg-Substitution am Rest 120. Diese Substitution führt zu einer dramatisch reduzierten Bindungsaffinität von Stelle 2 für die Interaktion mit GHR und PRLR, aber die Bindungsaffinität von Stelle 1 bleibt intakt, sodass G120R als Antagonist gegen beide fungiert GHR und PRLR (Tabelle 1) (60). B2036 ist ein weiteres Analogon von hGH mit einer Gly-zu-Lys-Änderung am Rest 120, die die Bindungsaffinität von Stelle 2 verringert, zusammen mit 8-Aminosäure-Substitutionen an der Bindungsstelle 1, die spezifisch die Bindungsaffinität von Stelle 1 an GHR erhöhen, was zu einer GHR- spezifischer Antagonist (Tabelle 1) (61). Wie oben ist G129R eine PRL-Mutante mit einer Gly-zu-Arg-Substitution am Rest 129 (Stelle 2), die sich als PRLR-spezifischer Antagonist von sowohl GH als auch PRL verhält (Tabelle 1) (58, 59). Wir testeten die Wirkungen jedes dieser Antagonisten, G120R, B2036 und G129R, auf die GHR/PRLR-Heterokomplementation in 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-Zellen. Bemerkenswerterweise veränderte keiner der Antagonisten, von denen jeder nur eine Stelle besitzt, die GHR (G120R und B2036) oder PRLR (G120R und G129R) binden kann, die basale GHR-Nluc/PRLR-Cluc-Komplementation (Abbildung 4 A), was bestätigt, dass einzelne Die Bindung an die Stelle ist nicht ausreichend, um die Nähe der distalen Schwänze innerhalb von Heteromeren zu verringern oder zu erhöhen.

Wirkung von Antagonisten auf die GHR-PRLR-Heterokomplementation. A: Weder der GHR-spezifische Antagonist B2036, der PRLR-spezifische Antagonist G129R noch der allgemeine GHR- und PRLR-Antagonist G120R beeinflussen die basale GHR-PRLR-Heterokomplementierung. 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-Zellen wurden mit Vehikel B2036, G129R oder G120R für 30 Minuten behandelt, wonach die Biolumineszenz bestimmt wurde. Die Daten werden grafisch als mittlerer ± SE-Gesamtfluss (Photonen/s × 1000) angezeigt. Es wurde kein signifikanter Unterschied festgestellt (n = 9 pro Bedingung). B, Wirkung von G129R auf die PRL-induzierte GHR-PRLR-Heterokomplementationsänderung. Serum-verhungerte 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-Zellen wurden mit oder ohne G129R vorinkubiert und dann mit PRL (500 ng/ml) behandelt. Danach wurde die Biolumineszenz seriell gemessen. Weitere Informationen finden Sie unter Materialien und Methoden. Für PRL vs. PRL+G129R, P < .05 zu jedem Zeitpunkt. C, Wirkung von G120R auf die GH-induzierte GHR-PRLR-Heterokomplementationsänderung. Serum-verhungerte 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-Zellen wurden mit oder ohne G120R vorinkubiert und dann mit GH (500 ng/ml) behandelt. Danach wurde die Biolumineszenz seriell gemessen. Weitere Informationen finden Sie unter Materialien und Methoden. Für GH im Vergleich zu GH+G120R, P < .05 zu jedem Zeitpunkt außer 5 Minuten. D, Vergleich der Wirkungen von G129R und B2036 auf die GH-induzierte GHR-PRLR-Heterokomplementationsänderung. Serum-verhungerte 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-Zellen wurden mit ± G129R oder B2036 vorinkubiert und dann mit GH (500 ng/ml) behandelt. Danach wurde die Biolumineszenz seriell gemessen. Weitere Informationen finden Sie unter Materialien und Methoden. Die Kurve mit gestrichelter Linie und ausgefüllten Kreisen spiegelt die Wirkung von GH in Gegenwart von G129R wider, vermutlich über die Bindung von GH an GHR-GHR-Homodimere Die Kurve mit durchgezogener Linie und leeren Kreisen spiegelt die Wirkung von GH in Gegenwart von B2036 wider, vermutlich über die Bindung von GH an PRLR- PRLR-Homodimere. Die Kurve mit durchgezogener Linie und leeren Dreiecken wurde durch mathematisches Kombinieren des Wertes zu jedem Zeitpunkt von (GH+B2036) mit dem von (GH+G129R) erzeugt, daher wurden keine Fehlerbalken verwendet. Diese Kombinationsverfolgung überlappte fast mit der experimentellen Verfolgung, die GH-induzierte Veränderungen widerspiegelt (gestrichelte Linie und ausgefüllte Dreiecke), was darauf hindeutet, dass die Wirkung von GH auf die Heterokomplementation die Nettowirkung seiner unabhängigen Bindung an GHR-GHR-Homodimere und PRLR-PRLR-Homodimere ist. E, GH-induzierte Komplementationsänderungen über jeden Rezeptor sind proportional zur relativen Häufigkeit der Rezeptoren in verschiedenen stabilen Klonzellen. Linkes Feld, Zelllysate von 2 stabilen GHR-Nluc/PRLR-Cluc-Klonen (𻌪-JAK2-GHR-Nluc/PRLR-Cluc-Zellen und 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-2-Zellen) waren durch SDS-PAGE aufgelöst und sequenziell mit Anti-GHR (Anti-GHRcyt-AL47) und mit Anti-PRLR (Anti-PRLRcyt-AL84). 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-2-Zellen hatten ein höheres Verhältnis von GHR zu PRLR als 𻌪-JAK2-GHR-Nluc/PRLR-Cluc. Rechtes Feld, gestapelte Balkendiagramme, die die Wirkungen der Antagonisten auf die Heterokomplementation in den 2 stabilen GHR-Nluc/PRLR-Cluc-Klonen zum Zeitpunkt 40 Minuten nach der Behandlung mit GH (500 ng/ml) zeigen. Schwarzer Balken, GH-Effekt über PRLR-PRLR-Homodimere Der Wert wurde als die Komplementationsänderung von (GH+B2036) dividiert durch die von GH berechnet. Grauer Balken, Wirkung von GH über GHR-GHR-Homodimere Der Wert wurde als die Komplementationsänderung von (GH+G129R) dividiert durch die von GH berechnet. Beachten Sie, dass die Summe der 2 Fraktionen in jedem Klon ungefähr 1 beträgt. Jeder Balken kombiniert Daten aus 4 unabhängigen Experimenten und wird als Bruchmittelwert ± SE angezeigt. Beachten Sie, dass 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-2 mit einem größeren Verhältnis von GHR zu PRLR als 𻌪-JAK2-GHR-Nluc/PRLR-Cluc auch einen größeren Anteil an Komplementationsänderungen über GHR aufwies -GHR-Homodimere (GH+G129R).

Wir testeten auch die Wirkungen der Antagonisten auf Liganden-induzierte GHR-Nluc/PRLR-Cluc-Komplementierungsänderungen. Obwohl es die basale Heterokomplementierung nicht beeinflusste, hemmte G129R den PRL-induzierten Rückgang der GHR-Nluc/PRLR-Cluc-Komplementation vollständig (Abbildung 4 B), was mit der Schlussfolgerung übereinstimmt, dass die PRL-induzierte Abnahme über seine Bindung an das PRLR . erfolgt -PRLR-Homodimere innerhalb eines (GHR-GHR)x/(PRLR-PRLR)y-Multimers.

Im Gegensatz zu PRL kann GH sowohl GHR-GHR als auch PRLR-PRLR aktivieren. In Übereinstimmung damit wurde die Wirkung von GH auf die GHR-Nluc/PRLR-Cluc-Komplementation vollständig durch G120R verhindert, das die GH-Bindung an beide Rezeptoren blockiert ( Abbildung 4 C). Bemerkenswerterweise veränderte die selektive Hemmung der GH-Bindung an GHR (mit B2036) gegenüber PRLR (mit G129R) die GH-induzierten GHR-Nluc/PRLR-Cluc-Komplementierungsänderungen auf unterschiedliche Weise (Abbildung 4 D). Im Prinzip sollte der Antagonismus von B2036 der Bindung von GH an GHR-GHR-Homodimere die Bindung von GH an PRLR-PRLR-Homodimere nicht beeinträchtigen, daher sind die Auswirkungen auf die Heterokomplementierung von (GH+B2036) GH-induzierte Veränderungen über PRLR-PRLR-Homodimere ( Abbildung 4 D). In ähnlicher Weise sollte der Antagonismus von G129R der Bindung von GH an PRLR-PRLR-Homodimere die Bindung von GH an GHR-GHR-Homodimere nicht beeinträchtigen, daher sind die Auswirkungen auf die Heterokomplementierung von (GH + G129R) GH-induzierte Veränderungen über GHR-GHR-Homodimere ( 4D ) . Wir kamen zu dem Schluss, dass die GH-induzierten Veränderungen bei der Heterokomplementation die Nettoveränderungen von seiner unabhängigen Bindung an jedes Rezeptor-Homodimer sind. Um dies anzugehen, haben wir die Wirkung von GH über seine Bindung an PRLR-PRLR-Homodimere (GH+B2036) mit der über seine Bindung an GHR-GHR (GH+G129R) mathematisch “kombiniert” und eine ȁKombinationsverfolgung, x0201d repräsentiert die Nettoeffekte der GH-Bindung an jedes Rezeptor-Homodimer (Abbildung 4 D). Interessanterweise überlappte die kombinierte GH-Wirkung praktisch mit der experimentellen Aufzeichnung, die sich aus der GH-Behandlung allein ergab ( Abbildung 4 D), was das (GHR-GHR)x/(PRLR-PRLR)y-Multimermodell stark unterstützt.

Um diese Idee weiter zu verfolgen, isolierten und testeten wir einen separaten Transfektantenklon, der GHR-Nluc und PRLR-Cluc coexprimiert. In this clone, designated 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-2 cells, the ratio of GHR-Nluc to PRLR-Cluc is greater than that in JAK2-GHR-Nluc/PRLR-Cluc cells by immunoblotting ( Figure 4 E, left panel). Intriguingly, consistent with its greater GHR-Nluc to PRLR-Cluc ratio, 𻌪-JAK2-GHR-Nluc/PRLR-Cluc-2 has a greater proportion of GH's effect via GHR-GHR homodimers (GH+G129R) vs its effect via PRLR-PRLR homodimers (GH+B2036) than seen in 𻌪-JAK2-GHR-Nluc/PRLR-Cluc ( Figure 4 E, right panel). Collectively, these data suggest a (GHR-GHR)x/(PRLR-PRLR)y multimer model, in which GHR-GHR and PRLR-PRLR homodimers are activated independently by their corresponding ligands and in proportion relative to the relationship between x and y. In contrast, these data do not support a scenario in which biofunctional GHR-PRLR heterodimers form and are activated per se by GH.

Effects of a novel GHR-PRLR agonist on GHR-PRLR hetero-complementation

B-G is a recombinant protein in which B2036 and G129R are fused in tandem with B2036 situated N-terminal to G129R ( Figure 5 A) this combined GHR-PRLR antagonist, by virtue of possessing single binding sites for each receptor ( Table 1 ), can be an agonist in cells that express both GHR and PRLR, but not in cells expressing only GHR or PRLR (49). Indeed, B-G treatment of our 𻌪-JAK2-GHR-Nluc/PRLR-Cluc cells resulted in acute tyrosine phosphorylation of both GHR and PRLR, as well as phosphorylation of STAT3 ( Figure 5 B), suggesting that both receptors are engaged by B-G. As expected, B-G treatment did not alter complementation in cells expressing GHR-Nluc/GHR-Cluc or PRLR-Nluc/PRLR-Cluc (data not shown). In contrast, B-G acutely and dose dependently augmented GHR/PRLR hetero-complementation in 𻌪-JAK2-GHR-Nluc/PRLR-Cluc cells ( Figure 5 C). We emphasize that this B-G-induced pattern is dramatically different from that observed with either GH ( Figure 3 C) or PRL ( Figure 3 D) in the hetero-complementation setting. The augmentation of GHR-Nluc/PRLR-Cluc complementation from B-G was completely inhibited by either B2036 alone or G129R alone ( Figure 5 D), confirming that B-G engages both GHR and PRLR to affect GHR-PRLR heteromer complementation. In the context of the data presented in Figures 3 and ​ and4, 4 , the data with B-G in Figure 5 may conform with the (GHR-GHR)x/(PRLR-PRLR)y multimer model, in that B-G binds to 1 GHR monomer within a GHR-GHR dimer and to 1 PRLR monomer within a nearby PRLR-PRLR dimer in the hetero-multimer. This B-G binding is envisioned to exert different effects on intracellular tail approximation (bringing GHR-Nluc within one GHR-Nluc-GHR-Nluc dimer into proximity with PRLR-Cluc within a PRLR-Cluc-PRLR-Cluc dimer to augment complementation) compared to GH or PRL (each bringing monomers within homodimers together and separating homodimers within the hetero-multimers).

Effect of a novel GHR-PRLR agonist on GHR-PRLR hetero-complementation. A, Diagram of B-G: a novel GHR-PRLR agonist. B2036 and G129R are fused in tandem with a single binding site (site 1, in red) on B2036 for GHR and a single binding site (site 1, in yellow) on G129R for PRLR, respectively. Yellow “X” indicates the mutated site 2 of GH on B2036 or mutated site 2 of PRL on G129R. B, Agonist B-G induces phosphorylation of GHR and PRLR and triggers cellular signaling in 𻌪-JAK2-GHR-Nluc/PRLR-Cluc cells. Treatment: ଛ-G. Detergent cell extracts were immuno-precipitated with anti-GHR (anti-GHRcyt-AL47) (upper panel) or anti-PRLR (anti-PRLRcyt-AL84) (middle panel), resolved by SDS-PAGE and sequentially immunoblotted with anti-pY and anti-GHR (anti-GHRcyt-AL47) or anti-PRLR (anti-PRLRcyt-AL84). Lower panel, Immunoblot of cell extracts for phosphorylated and total STAT3. C, B-G induces concentration-dependent augmentation in hetero-complementation. After basal bioluminescence was determined in 𻌪-JAK2-GHR-Nluc/PRLR-Cluc cells, B-G at indicated concentrations was added, and bioluminescence was serially determined. See Materials and Methods for details. For 0.5-μg/mL B-G vs 1-μg/mL B-G, P < .05 at each time point except 35 minutes. For 0.5-μg/mL B-G vs 5-μg/mL B-G or 10-μg/mL B-G, P < .05 at each time point. For 1-μg/mL B-G vs 5-μg/mL B-G or 10-μg/mL B-G, P < .05 at each time point except 35 and 40 minutes. For 5-μg/mL B-G vs 10-μg/mL B-G, P < .05 at 5 minutes. D, G129R or B2036 each completely antagonizes B-G-induced hetero-complementation changes. Serum-starved 𻌪-JAK2-GHR-Nluc/PRLR-Cluc cells were preincubated ± G129R or B2036 and then treated ± B-G (1 μg/mL). Bioluminescence was measured serially thereafter. See Materials and Methods for details. For B-G vs B-G+G129R or B-G+B2036, P < .05 at each time point.


Types of DNA binding domains with examples - Zinc finger, Leucine Zipper, Helix loop Helix

DNA binding proteins interact with DNA by means of various structural motifs, and can stimulate or repress transcription of messenger RNA, depending on the properties and location of the DNA sequence to which they bind.

  • This protein consists of three linked alpha helices (helices 1, 2and 3). Helices 2 and 3 are arranged in a conspicuous helix turn helix motif.
  • A 60 amino acid long region (homeodomain) within helix 3 binds specifically to DNA segments that contain the sequence 5’ATTA3’

II) Zinc finger protein :


Examples of Zinc finger proteins are:
a) Transcription factor IIIA(TFIIIA), which engages RNA polymerase II to the gene promoter
b) Sp1(First described for its action on the SV40 promoter), which engages RNA polymerase II to the gene promoter by binding to the GC box
c) Glucocorticoid receptor, estrogen receptor, progesterone receptor, thyroid hormone receptor (erbA), retinoid acid receptor, and the vitamin D3 receptor.


Molecular controls of lymphatic VEGFR3 signaling

Ziele: Vascular endothelial growth factor receptor 3 (VEGFR3) plays important roles both in lymphangiogenesis and angiogenesis. On stimulation by its ligand VEGF-C, VEGFR3 is able to form both homodimers as well as heterodimers with VEGFR2 and activates several downstream signal pathways, including extracellular signal-regulated kinases (ERK)1/2 and protein kinase B (AKT). Despite certain similarities with VEGFR2, molecular features of VEGFR3 signaling are still largely unknown.

Vorgehensweise und Ergebnisse: Human dermal lymphatic endothelial cells were used to examine VEGF-C-driven activation of signaling. Compared with VEGF-A activation of VEGFR2, VEGF-C-induced VEGFR3 activation led to a more extensive AKT activation, whereas activation of ERK1/2 displayed a distinctly different kinetics. Furthermore, VEGF-C, but not VEGF-A, induced formation of VEGFR3/VEGFR2 complexes. Silencing VEGFR2 or its partner neuropilin 1 specifically abolished VEGF-C-induced AKT but not ERK activation, whereas silencing of neuropilin 2 had little effect on either signaling pathway. Finally, suppression of vascular endothelial phosphotyrosine phosphatase but not other phosphotyrosine phosphatases enhanced VEGF-C-induced activation of both ERK and AKT pathways. Functionally, both ERK and AKT pathways are important for lymphatic endothelial cells migration.

Conclusions: VEGF-C activates AKT signaling via formation of VEGFR3/VEGFR2 complex, whereas ERK is activated by VEGFR3 homodimer. Neuropilin 1 and vascular endothelial phosphotyrosine phosphatase are involved in regulation of VEGFR3 signaling.

Schlüsselwörter: NRP1 NRP2 VE-PTP VEGF-C VEGFR2 VEGFR3.

© 2014 American Heart Association, Inc.

Interessenkonflikt-Erklärung

Disclosure: The authors have declared that no conflict of interest exists.

Figuren

Figure 1. Comparison of VEGFR2 and VEGFR3…

Figure 1. Comparison of VEGFR2 and VEGFR3 signaling

Figure 2. VEGFR2 is involved in VEGF-C-induced…

Figure 2. VEGFR2 is involved in VEGF-C-induced AKT but not ERK activation

Figure 3. NRP1 but not NRP2 is…

Figure 3. NRP1 but not NRP2 is required for VEGF-C signaling

Figure 4. VE-PTP negatively regulates VEGFR3 signaling…

Figure 4. VE-PTP negatively regulates VEGFR3 signaling and endocytosis

Figure 5. VEGFR2 and NRP1 but not…

Figure 5. VEGFR2 and NRP1 but not VE-PTP or NRP2 are required for VEGF-C-induced cell…


MATERIALEN UND METHODEN

Hairpin, double-stranded and monomolecular and bimolecular quadruplex DNA structures

Nucleotide sequences of synthetic DNA oligomers (products of Sigma/Genosys Rehovot, Israel) represented guanine-rich segments of promoter regions of the α7 integrin and sarcomeric mitochondrial creatine kinase (sMtCK) genes ( 35), included the core E-box DNA sequence or encoded the basic regions of MyoD or Myogenin ( Table 1). Following purification of the single-stranded oligonucleotides by denaturing gel electrophoresis in 8.0 M urea, 12% polyacrylamide (acryl/bisacrylamide, 19:1) ( 37), their 5′ ends were labeled by 32 P in bacteriophage T4 polynucleotide kinase (PNK)-catalyzed reaction ( 38). Hairpin, monomolecular and bimolecular tetraplex structures of the integrin and sMtCK DNA oligomers were formed as we described ( 35). E-box or basic region encoding DNA duplexes were prepared by annealing under described conditions ( 39) equimolar amounts of 5′ and 3′ complementary oligomers.

DNA oligomers used in this study

Oligomer designation . Bases . Nucleotide sequence .
Integrin DNA 26 5′-d(CAT GGGGG C GGG AA GGGG C GGGG TCT)-3′
sMtCK DNA 24 5′-d(CTGA GG EIN GGGG CT GG EIN GGG ACCAC)-3′
5′ E-box 26 5′-d(TCGATCCCCCAA CACCTG CTGCCTGA)-3′
3′ E-box 26 5′-d(TCAGGCAG CAGGTG TTGGGGGACGA)-3′
5′- Myogenin basic region 89 5′-d(CAAGGCGTGTAAGAGGAAGTCTGTGTCTGTGGACCGGCGGAGGGCAG CCACACTGAGGGAGAAGCGCAGGCTCAGCAAAGT GAATGAGG)-3′
3′- Myogenin basic region 91 5′-d(TCATTCACTTTGCTGAGCCTGCGCTTCTCCCTCAGTGTGGCTGCCCTCC GCCGGTCCACAGACACAGACTTCCTCTTACACGCCTTG CATG )-3′
5′- MyoD basic region 89 5′-d(CAAGGTGTGCAAGCGCAAGACCACCAACGCTGATCGCCGCAAGGCCG CCACCATGCGCGAGCGCCGCCGCCTGAAGAAAGTGAATGAGG)-3′
3′- MyoD basic region 91 5′-d(TCATTCACTTTCTTCAGGCGGCGGCGCTCGCGCATGGTGGCGGCCTTGC GGCGATCAGCGTTGGTGGTCTTGCGCTTGCACACCTTG CATG )-3
Oligomer designation . Bases . Nucleotide sequence .
Integrin DNA 26 5′-d(CAT GGGGG C GGG AA GGGG C GGGG TCT)-3′
sMtCK DNA 24 5′-d(CTGA GG EIN GGGG CT GG EIN GGG ACCAC)-3′
5′ E-box 26 5′-d(TCGATCCCCCAA CACCTG CTGCCTGA)-3′
3′ E-box 26 5′-d(TCAGGCAG CAGGTG TTGGGGGACGA)-3′
5′- Myogenin basic region 89 5′-d(CAAGGCGTGTAAGAGGAAGTCTGTGTCTGTGGACCGGCGGAGGGCAG CCACACTGAGGGAGAAGCGCAGGCTCAGCAAAGT GAATGAGG)-3′
3′- Myogenin basic region 91 5′-d(TCATTCACTTTGCTGAGCCTGCGCTTCTCCCTCAGTGTGGCTGCCCTCC GCCGGTCCACAGACACAGACTTCCTCTTACACGCCTTG CATG )-3′
5′- MyoD basic region 89 5′-d(CAAGGTGTGCAAGCGCAAGACCACCAACGCTGATCGCCGCAAGGCCG CCACCATGCGCGAGCGCCGCCGCCTGAAGAAAGTGAATGAGG)-3′
3′- MyoD basic region 91 5′-d(TCATTCACTTTCTTCAGGCGGCGGCGCTCGCGCATGGTGGCGGCCTTGC GGCGATCAGCGTTGGTGGTCTTGCGCTTGCACACCTTG CATG )-3

The integrin and sMtCK oligomers are tetraplex-forming guanine-rich sequences derived from promoter regions of the respective genes ( 35). Underlined are guanine clusters that participate in quadruplex formation. The core E-box sequence is underlined in the 5′ and 3′ E-box complementary oligomers. Sequences representing the Myogenin and MyoD basic regions are italicized in the respective basic region 5′ and 3′ complementary oligomers and the BsmI and SphI complementing ends are underlined.

DNA oligomers used in this study

Oligomer designation . Bases . Nucleotide sequence .
Integrin DNA 26 5′-d(CAT GGGGG C GGG AA GGGG C GGGG TCT)-3′
sMtCK DNA 24 5′-d(CTGA GG EIN GGGG CT GG EIN GGG ACCAC)-3′
5′ E-box 26 5′-d(TCGATCCCCCAA CACCTG CTGCCTGA)-3′
3′ E-box 26 5′-d(TCAGGCAG CAGGTG TTGGGGGACGA)-3′
5′- Myogenin basic region 89 5′-d(CAAGGCGTGTAAGAGGAAGTCTGTGTCTGTGGACCGGCGGAGGGCAG CCACACTGAGGGAGAAGCGCAGGCTCAGCAAAGT GAATGAGG)-3′
3′- Myogenin basic region 91 5′-d(TCATTCACTTTGCTGAGCCTGCGCTTCTCCCTCAGTGTGGCTGCCCTCC GCCGGTCCACAGACACAGACTTCCTCTTACACGCCTTG CATG )-3′
5′- MyoD basic region 89 5′-d(CAAGGTGTGCAAGCGCAAGACCACCAACGCTGATCGCCGCAAGGCCG CCACCATGCGCGAGCGCCGCCGCCTGAAGAAAGTGAATGAGG)-3′
3′- MyoD basic region 91 5′-d(TCATTCACTTTCTTCAGGCGGCGGCGCTCGCGCATGGTGGCGGCCTTGC GGCGATCAGCGTTGGTGGTCTTGCGCTTGCACACCTTG CATG )-3
Oligomer designation . Bases . Nucleotide sequence .
Integrin DNA 26 5′-d(CAT GGGGG C GGG AA GGGG C GGGG TCT)-3′
sMtCK DNA 24 5′-d(CTGA GG EIN GGGG CT GG EIN GGG ACCAC)-3′
5′ E-box 26 5′-d(TCGATCCCCCAA CACCTG CTGCCTGA)-3′
3′ E-box 26 5′-d(TCAGGCAG CAGGTG TTGGGGGACGA)-3′
5′- Myogenin basic region 89 5′-d(CAAGGCGTGTAAGAGGAAGTCTGTGTCTGTGGACCGGCGGAGGGCAG CCACACTGAGGGAGAAGCGCAGGCTCAGCAAAGT GAATGAGG)-3′
3′- Myogenin basic region 91 5′-d(TCATTCACTTTGCTGAGCCTGCGCTTCTCCCTCAGTGTGGCTGCCCTCC GCCGGTCCACAGACACAGACTTCCTCTTACACGCCTTG CATG )-3′
5′- MyoD basic region 89 5′-d(CAAGGTGTGCAAGCGCAAGACCACCAACGCTGATCGCCGCAAGGCCG CCACCATGCGCGAGCGCCGCCGCCTGAAGAAAGTGAATGAGG)-3′
3′- MyoD basic region 91 5′-d(TCATTCACTTTCTTCAGGCGGCGGCGCTCGCGCATGGTGGCGGCCTTGC GGCGATCAGCGTTGGTGGTCTTGCGCTTGCACACCTTG CATG )-3

The integrin and sMtCK oligomers are tetraplex-forming guanine-rich sequences derived from promoter regions of the respective genes ( 35). Underlined are guanine clusters that participate in quadruplex formation. The core E-box sequence is underlined in the 5′ and 3′ E-box complementary oligomers. Sequences representing the Myogenin and MyoD basic regions are italicized in the respective basic region 5′ and 3′ complementary oligomers and the BsmI and SphI complementing ends are underlined.

Preparation, purification and expression of full-length and mutant recombinant MyoD, MRF4 and Myogenin

Plasmids harboring cDNA that encoded full-length unmodified member proteins of the MRF family were: pGEX-6P-MyoD (Muskulatur) ( 15) pGEX-MRF4 (Rattus norvegicus) (gift of Dr P. Muñoz-Cánoves, Center for Genomic Regulation, Barcelona, Spain) pEMSV- Myogenin (Rattus norvegicus) (contributed by Dr S.J. Tapscott, FHCRC, Seattle, WA, USA) was subcloned into a pGEX-6P vector. The pGEX4T1-E47 harboring cDNA that encoded full-length Muskulatur E47 protein was a gift of Dr A. Cano (CSIC-UAM, Madrid, Spain).

To create mutant Myogenin with basic amino acid clusters identical to those of MyoD and MRF4, an R84K mutation was introduced by PCR into the second triad using the 5′ and 3′ primers 5′-d(GTCTGTGGACCGGCGGAAGGCAGCCCACACTGAGGG)-3′ and 5′-d(CCCTCAGTGTGGGCTGCCTTCCGCCGGTCCACAGAC)-3′, respectively, and full-length pGEX-6P-Myogenin cDNA template. Following verification of the mutation by sequencing, an additional K91R mutation was introduced by PCR into the third triad using a pGEX-6P-myogenin R84K cDNA template and the respective 5′ and 3′ primers 5′-d(GCCACACTGAGGGAGAGGCGCAGGCTCAAGAAAG)-3′ and 5′(CTTTCTTGAG CCTGCGCCTCTCCCTCAGTGTGGC)-3′.

To construct chimerical MyoD, which had its native basic region replaced by a Myogenin basic region (MyoD/MyogeninB), SphI and BsmI cleavage sites were generated at positions 99 and 126, respectively, upstream and downstream to the MyoD basic region (residues 102–121). A BsmI restriction site was formed by PCR as we described ( 36) using as template GST-fused full-length MyoD cDNA in pGEX-6P and the 5′ and 3′ primers 5′-d(GCAAAGTGAATGAGGCATTCGAGACGCTCAAGC)-3′ and 5′-d(GCTTGAGCGTCTCGAATGCCTCATTCACTTTGC)-3′, respectively. Presence of the BsmI restriction site was verified by sequencing and the mutated cDNA was used as template to generate by PCR a SphI restriction site using the respective 5′ and 3′ primers 5′-d(CTGCTTGCTGTGGGCATGCAAGGCGTGCAAG)-3′ and 5′-d(CTTGCACGCCTTGCATGCCCACAGCAAGCAG)-3′. The doubly mutated MyoD DNA was cut by SphI, treated with calf intestinal phosphatase (CIP), cleaved by BsmI, resolved by gel agarose electrophoresis and isolated. Myogenin basic region 5′ and 3′ oligomers ( Table 1) that were annealed and phosphorylated at their 5′-termini by PNK were ligated into the restricted MyoD cDNA. The insert had at its ends SphI and BsmI complementary sites and 5′ and 3′ sequences that encoded MyoD residues 99–101 and 122–126, respectively whereas its core encoded the Myogenin basic region (residues 74–93). Reciprocal chimerical Myogenin that contained a MyoD basic region (Myogenin/MyoDB) was prepared as follows: GST-fused full-length Myogenin cDNA in pGEX-6P vector served as a template into which a BsmI restriction site was introduced by PCR using the 5′ and 3′ primers 5′-d(GAAAGTGAATGAGGCATTCGAGGCTCTGAAGAGAAGC)-3′ and 5′-d(GCTTCTCTTCAGAGCCTCGAATGCCTCATTCACTTTC)-3′, respectively. To have the generated BsmI site as a single a BsmI restriction sequence in the Myogenin cDNA, PCR was employed to eliminate a native site at position 486 by using the respective 5′ and 3′ primers 5′-d(CCCAGTGAATGTAACTCCCACAGCGCCTCC)-3′ and 5′-d(GGAGGCGCTGTGGGAGTTACATTCACTGGG)-3′ and the modified Myogenin cDNA template. A SphI restriction site was introduced into the mutated Myogenin cDNA template by PCR using the respective 5′ and 3′ primers 5′-d(CAGTGCCTGCCCTGGGCATGCAAGGTGTGTAAGAG)-3′ and 5′-d(CTCTTACACACCTTGCATGCCCAGGGCA GGCACTG)-3′. Restriction and isolation of linear Myogenin DNA was conducted as described for MyoD DNA. MyoD basic region 5′ and 3′ oligomers ( Table 1) were annealed, phosphorylated and ligated into the restricted Myogenin DNA as detailed above. The insert had at its ends SphI and BsmI complementary sites and 5′ and 3′ sequences that encoded Myogenin residues 71–73 and 94–98, respectively, whereas its core encoded the MyoD basic region (residues 102–121).

Recombinant unmodified or mutant proteins were expressed and purified as follows: pGEX-6P plasmids harboring the respective cDNA sequences were electroporated into competent Escherichia coli BL21 (DE3)pLysS cells that were grown in LB medium containing ampicillin and chloramphenicol to an A600 of ∼0.6. Synthesis of the GST-fused proteins was induced by exposure to 100 μM IPTG for 3 h. Purification of the recombinant proteins from the bacterial cell extracts to >95% homogeneity was attained by glutathione-agarose (Sigma) affinity column chromatography. The GST residue was cleaved from the MyoD or Myogenin fusion proteins by incubating 100 μg protein at 4°C for 4 h with 1.0 unit preScission protease (GE Healthcare, Bucks, UK). The DNA-binding capacity of Myogenin that was used in some experiments as an intact fusion protein was found to be indistinguishable from that of the preScission protease cleaved protein. MRF4 and E47 were used as uncleaved fusion proteins.

Electrophoresis mobility shift separation of protein–DNA complexes and determination of their dissociation constants

Heterodimers of MyoD, MRF4 or Myogenin with E47 were generated prior to their binding to the various DNA probes by incubating at 37°C for 10 min purified recombinant MRF protein with an equimolar amount of E47 in reaction mixtures that contained in a final volume of 10 μl: 45 mM KCl, 4.5 mM MgCl2, 0.5 mM EDTA, 1 mM DTT, 20% glycerol in 20 mM Tris–HCl buffer, pH 8.0. Protein–DNA binding was conducted in reaction mixtures that contained in a final volume of 10 μl: specified amounts of homodimeric MRF proteins or their heterodimers with E47 and 5′- 32 P labeled DNA probe, 10 mM KCl, 1.0 mM EDTA, 0.5 mM DTT, 20% glycerol in 25 mM Tris–HCl buffer, pH 8.0. Mixtures for the binding of end-labeled bimolecular tetraplex DNA structures of muscle-specific regulatory sequences were also supplemented with 10 mM KCl. The mixtures were incubated at 30°C for 20 min and protein–DNA complexes were resolved from free DNA by electrophoresis at 4°C and under 200–250 V in nondenaturing 4 or 6% polyacrylamide gel (acryl/bisacrylamide, 19:1) in 10 mM KCl in 0.25× TBE buffer (0.5 mM EDTA in 22.5 mM Tris–borate buffer, pH 8.3). Electrophoresis of the DNA was conducted until a bromophenol blue marker dye migrated 7.5 cm into the gel. The gels were dried on DE81 filter paper and the relative proportions of bands of free and protein-bound DNA were quantified by phosphor imaging analysis.

Dissociation constants, KD, values of complexes of homodimeric MRF proteins or their heterodimers with E47 with E-box DNA or with bimolecular tetraplex structures of guanine-rich muscle-specific DNA sequences were determined as follows: increasing amounts of 32 P-labeled DNA were incubated with a constant amount of protein in the above described protein–DNA binding reaction mixtures. Following electrophoretic resolution of the protein–DNA complexes from free DNA by mobility shift, their relative amounts were determined by phosphor imaging quantification of the respective radioactive bands. KD values were deduced from the negative reciprocal of the slope of a Scatchard plot of the results as described elsewhere ( 40).


Danksagung

We thank Lukasz Patyk, Froukje van der Wal and Richard Immink for assistance with the yeast two-hybrid and yeast one-hybrid assays, and the latter as well as Selahattin Danisman for useful discussions. Mrs Ruth White (Boyce Thompson Institute, Ithaca, NY) is gratefully acknowledged for sending us tomato EST clones. This work was partially funded by European Commission 6 th Framework programme project “High Quality Solanaceous crops for consumers, processors and producers by exploration of natural biodiversity” (EU-SOL contract nr. PL 016214–2), by the Dutch Ministry of Agriculture, Nature and Food Quality and the Dutch Organization for Scientific Research NWO-ALW project nr. 828.08.005.


Gene organization and evolutionary history

Peptidoglycan recognition proteins (PGRPs) are innate immunity molecules that contain a conserved peptidoglycan-binding type 2 amidase domain that is homologous to bacteriophage and bacterial type 2 amidases [1–6]. PGRPs are ubiquitous in most animals. Insects have multiple PGRP genes that are classified into short (S) and long (L) transcripts and are often alternatively spliced into up to 19 different proteins (Table 1) [1–5]. PGRPs have also been identified in mollusks, echinoderms, and vertebrates (Table 1), but plants and lower metazoa, including nematodes such as Caenorhabditis elegans, do not have PGRPs. PGRP genes usually form clusters that suggest their origin by gene duplication.

Mammals have a family of four PGRPs, which were initially named PGRP-S, PGRP-L, and PGRP-Iα and PGRP-Iβ (for 'short', 'long', or 'intermediate' transcripts, respectively), by analogy to insect PGRPs [3]. Subsequently, the Human Genome Organization Gene Nomenclature Committee changed their symbols to PGLYRP-1, PGLYRP-2, PGLYRP-3, and PGLYRP-4, respectively. This terminology is also used for mouse PGRPs, and is beginning to be adopted for all vertebrate PGRPs. In this article, the abbreviation PGRP will be used for all invertebrate members and PGLYRP for all vertebrate members of the PGRP family.

Phylogenetic analysis of insect PGRPs reveals an early separation of PGRPs into enzyme-active amidases and the remaining PGRPs, which activate signal transduction pathways and proteolytic cascades (Figure 1). PGRPs from other animals cannot easily be grouped with any individual insect PGRPs, so they are considered separately here. The non-insect PGRPs also evolved into two groups. The first group are all amidases, which in echinoderms, mollusks, fish, and amphibians are evolutionarily older and which more recently evolved into the mammalian amidases (PGLYRP-2 Figure 2). The second group are mammalian bactericidal proteins, which separated into two well defined branches: PGLYRP-1 (present in phagocytic granules) and PGLYRP-3 and PGLYRP-4 (present on skin and mucous membranes Figure 2). The only probable orthologs between non-insect and insect PGRPs are the amidase-active PGRPs (Figures 1, 2 and Table 1).

A phylogenetic tree of insect PGRPs, indicating their known and deduced functions. For branches supported by bootstrap analysis with the proportion of 1000 replications higher than 70%, the percentage is indicated. The bar indicates the p-distance. Abkürzungen: Ag, Anopheles gambiae Am, Apis mellifera Bm, Bombyx mori Ce, Calpodes ethlius Dm, Drosophila melanogaster Glm, Glossina morsitans Gm, Galleria mellonella Hd, Holotrichia diomphalia Ms, Manduca sexta Tm, Tenebrio molitor Tn, Trichoplusia ni. Accession numbers and references are listed in Table 1. PPO, prophenol-oxidase.

A phylogenetic tree of mollusk, echinoderm, and vertebrate PGRPs, indicating their known and deduced functions. Bootstrap analysis and p-distance indicated as in Figure 1. Abbreviations: Ai, Argopecten irradians Ar, Asterias rubens Bt, Bos taurus Cd, Camelus dromedaries Cf, Canis familiaris Dr, Danio Es, Euprymna scolopes Gg, Gallus gallus Hs, Homo sapiens Mm, Mus musculus Pt, Pan troglodytes Rn, Rattus norvegicus Sp, Strongylocentrotus purpuratus Ss, Sus scrofa Ten, Tetraodon nigroviridis Xl, Xenopus laevis Xt, Xenopus tropicalis. Accession numbers and references are listed in Table 1. The asterisk indicates that Es PGRP-4 is not a predicted amidase.


Diskussion

Although no stable marker for the ERGIC is known, the continuous recycling of ERGIC-53 has allowed us to visualize the ERGIC for prolonged times in living cells and to compare the dynamics of sorting of the retrograde marker protein ERGIC-53 and the anterograde markers VSV-G and ssDsRed. Our findings shed new light on the nature of the ERGIC and on protein trafficking early in the secretory pathway. They support the notion of a stationary ERGIC consisting of numerous discontinuous elements that operate in bidirectional sorting to the ER and Golgi. This conclusion is based on three major observations. First, GFP-ERGIC-53 is localized in stationary spots displaying short-range non-directional movement. Unlike VSV-G-GFP spots, GFP-ERGIC-53 spots do not show a preferential movement toward the Golgi region and hence do not exhibit typical features of anterograde carriers (ACs). Their short-range movement is dependent on intact microtubules as it is lost in nocodazole-treated cells. Second, many of the stationary GFP-ERGIC-53 structures are long-lived and persist for more than 30 minutes, another feature that is inconsistent with an exclusive AC function. ER to Golgi transport is a rapid event. The ERGIC spots can undergo splitting and occasionally fuse with one another some appear de novo, others disappear. Interestingly, similar features have been observed for ERES (Stephens, 2003 Bevis and Glick, 2002) suggesting that the dynamics of ERES and ERGIC clusters may be regulated in concert. Third, the ERGIC spots are not consumed by the sorting of GFP-ERGIC-53 and ssDsRed. They can undergo multiple rounds of sorting of anterograde and retrograde cargo.

Our conclusion regarding the nature of the ERGIC is different from previous live-imaging studies on VSV-G-GFP transport (Presley et al., 1997 Scales et al., 1997). These authors concluded that the ERGIC clusters are transport vehicles for protein delivery to the Golgi, rather than a stable compartment (Lippincott-Schwartz et al., 2000). In accord with these studies, we observed that the ACs moving to the Golgi, containing ssDsRed (or VSV-G-GFP), are rather large and cannot be small transport vesicles. However, they derive from the stationary ERGIC defined by ERGIC-53. Only by visualization of the sorting of anterograde and retrograde traffic from the ERGIC in living cells did the stationary nature of this compartment become apparent.

Quantification of the directionality of movement by a numerical processing procedure supports our visual impression that GFP-ERGIC-53 largely escapes packaging into ACs. Unlike VSV-G-GFP, GFP-ERGIC-53 shows no preferential movement to the Golgi upon exit from the ERGIC: it moves in the opposite direction. Considering the apparently random distribution of ERGIC clusters in the peripheral cytoplasm one would expect no preferred directionality for GFP-ERGIC-53 cycling back to the ER. However, low temperature blocks tend to concentrate the ERGIC clusters closer to the Golgi apparatus (Klumperman et al., 1998). Therefore, the measured net flow for ERGIC-53 results from a combined effect: repositioning of ERGIC clusters and recycling of ERGIC-53. At first glance, the measured difference of 13.5% between anterograde and retrograde movements of VSV-G-GFP appears to be small. It should be noted, however, that the quantification time was short (10 seconds) and that extrapolation to a longer time results in a net flow to the Golgi within a few minutes. Thus, directed transport is the consequence of a slight preference in movement towards one direction. Overall, this novel vector field method based on the optical flow estimation validates previous conclusions derived from fixed cells (Klumperman et al., 1998), proposing that ERGIC to ER retrograde transport largely bypasses the Golgi. It is also consistent with our ssDsRed/GFP-ERGIC-53 dual-imaging data showing preferential sorting of anterograde and retrograde traffic in the ERGIC.

ERGIC clusters defined by ERGIC-53 and COP I are localized in close proximity to ERES (Bannykh et al., 1996 Klumperman et al., 1998 Martinez-Menarguez et al., 1999 Stephens et al., 2000), which precludes the visualization of protein transport from ERES to ERGIC in live cells owing to the insufficient resolution of light microscopy. Therefore, a simple alternative interpretation of our data would be that GFP-ERGIC-53, unlike endogenous ERGIC-53, is trapped in ERES and has no access to the ERGIC. Accordingly, the dispersal of GFP-ERGIC-53 induced by H89 could reflect diffusion within the plane of the ER membrane. Several observations argue against this interpretation. Like endogenous ERGIC-53, GFP-ERGIC-53 co-localizes with the COP I subunit β-COP but shows only partial overlap with COPII subunits, Sec13 and Sec31, in fixed cells analyzed by confocal microscopy. Likewise, our biochemical analysis indicates normal folding of GFP-ERGIC-53. Furthermore, NEM blocks the H89-induced dispersal of ERGIC-53 from the stationary structures indicating discontinuity with the ERES. The combined data suggest that the GFP-ERGIC-53 stationary structures correspond to the tubulovesicular ERGIC clusters defined by ERGIC-53 and COP I at the ultrastructural level (Schweizer et al., 1988 Klumperman et al., 1998).

By imaging at high temporal resolution of 5 frames per second (fast imaging) we have uncovered a third pathway not previously described. This pathway is mediated by fast-moving carriers (FCs) a fraction of which contains both GFP-ERGIC-53 and ssDsRed. The pathway is highly sensitive to microtubule-disrupting drugs as well as H89, and requires the existence of stationary ERGIC structures as unveiled by H89 wash-out experiments. As FCs do not exhibit preferential movement to the Golgi area and can occasionally be seen to originate from and fuse with stationary ERGIC structures, we propose that they functionally connect ERGIC clusters by lateral exchange. Although a majority of the FCs remains unsorted and appears to eventually fuse with a stationary structure, some can separate into a GFP-ERGIC-53-containing and an ssDsRed-containing dot, which move in opposite directions. The GFP-ERGIC-53 dot tends to rapidly disappear, whereas the ssDsRed dot moves to the Golgi. This suggests that some FCs are involved in anterograde/retrograde sorting.

Integrating our new data with previously published findings, the following picture regarding the organization and traffic routes in the early secretory pathway emerges (Fig. 7). Newly synthesized secretory proteins and ERGIC-53 are transported from the ER to stationary ERGIC clusters that are lying close to, but separate from ERES (Bannykh et al., 1996 Mezzacasa and Helenius, 2002). Although there is agreement that ER exit is COP II-dependent (Horstmann et al., 2002 Mironov et al., 2003), the precise mechanism of membrane traffic from ERES to ERGIC remains to be elucidated. Once in the ERGIC, anterograde cargo is sorted from ERGIC-53 into rather large ACs by a dissociative process. The size of ACs may vary according to cargo flux and can be considerable under conditions of massive synchronized release of VSV-G from the ER (Horstmann et al., 2002). ACs then rapidly move to the Golgi in a microtubule-dependent way. In contrast, ERGIC-53 is packaged into retrograde carriers (RCs), the size and shape of which can also vary. RCs must also be of a considerable size to be visible. When traffic is inhibited at 15°C followed by rewarming to 37°C, RCs emanating from the ERGIC clusters are often tubular. It appears that conditions of massive cargo transport favor the formation of tubules regardless of the pathway. Like ERGIC to Golgi anterograde transport, efficient ERGIC to ER retrograde transport requires intact microtubules.