Information

Warum ist das Referenzgenom eine Referenz?

Warum ist das Referenzgenom eine Referenz?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ich habe gehört, dass ein Referenzgenom wie das des Menschen durch zufällige Auswahl von Proben aus einer Gruppe von Spendern generiert wird. Aber warum nennen wir die generierte DNA-Sequenz als Referenz? Warum sollten wir glauben, dass diese wenigen Proben alle Menschen repräsentieren können, an denen wir uns orientieren müssen?


Der Hauptgrund ist, dass die genetischen Unterschiede zwischen Individuen derselben Art sehr klein. Für die allermeisten Studien können sie einfach ignoriert werden.

Unterschiede zwischen Individuen sind normalerweise (nicht immer, aber meistens) Unterschiede in den SNP-Genotypen. Dies sind einzelne Nukleotidunterschiede, die, obwohl sie phänotypische Auswirkungen haben können, die Fähigkeit der Sequenzen, sich auszurichten, nicht wirklich beeinflussen. Die Software zur Sequenzausrichtung wurde entwickelt, um mit solchen kleinen Unterschieden umzugehen. Betrachten Sie zum Beispiel diese beiden Zufallsfolgen:

>Seq1 ACCTTGCATCGGATCGAATTCGCGTTAGCGATCG >Seq2 GCCTAGCATCGGACCGAATTCCCGTTAGCAATCG

Wenn wir sie ausrichten, erhalten wir:

seq1 ACCTTGCATCGGATCGAATTCGCGTTAGCGATCG seq2 GCCTAGCATCGGACCGAATTCCCGTTAGCAATCG *** ******** ******* ******** ****

Wie man sieht, lassen sich die beiden trotz der kleinen Unterschiede in der Reihenfolge sehr gut ausrichten. Das gleiche gilt, wenn Sie echte Daten betrachten. Mein Hämoglobin-Gen zum Beispiel passt perfekt zu Ihrem und dem im Referenzgenom. Tatsächlich werden sie mit ziemlicher Sicherheit identisch sein oder bestenfalls ein paar unterschiedliche Rückstände aufweisen.

Wenn wir also Arbeiten durchführen, bei denen es nicht darum geht, spezifische Polymorphismen zu untersuchen, brauchen wir ein repräsentatives Genom. Jeder wird es tun, es sei denn, er hat eine besonders schwerwiegende Mutation wie eine chromosomale Translokation.


Referenzgenome stellen nicht genau den Satz von Genen einer einzelnen Person dar. Sie werden aus Fragmenten verschiedener Spender erstellt, die, wenn sie gebaut werden, als Vorlage für die Erstellung des echten Genoms verwendet werden. Obwohl wir feststellen werden, dass alle Menschen zu 99,9 Prozent identisch sind und von diesen winzigen 0,1 Prozent Unterschied das Referenzgenom möglicherweise nicht zu 100% mit dem echten Genom identisch ist. Jedes Referenzgenom kann erneut sequenziert und die Lücken jedes Mal reduziert werden. Wir können einen Punkt erreichen, an dem wir sagen können, dass die Genauigkeit hoch genug ist, um als Referenzplattform für die Konstruktion des echten Genoms verwendet zu werden


Die gleiche Frage ging mir vor einem Monat durch den Kopf. Sogar @terdon eine erklärende Antwort gegeben hat, möchte ich einen kleinen Beitrag leisten.

Als ich eine ähnliche Frage auf seqanswers * stellte, gab einer der Benutzer den Link zur Studie Ashley Lab in Stanford. Sie erzeugten die "Synthetische Hauptallel-Referenzgenome des Menschen". (1)

Sie kombinierten die aktuelle Referenzsequenz (damals hg19) mit den 1000Genomes-Daten von Varianten mit hohen Allelfrequenzen. Diese Kombination erzeugt drei verschiedene Referenzgenome von drei menschlichen Populationen (YRI, CEU und CHBJPT).

Diese synthetischen Referenzsequenzen repräsentieren die Varianten, die in dieser Population häufig vorkommen. Es ist möglich, diese Genome von ihrer Seite herunterzuladen.

Dewey FE, et. al. (2011)Phasenweises genetisches Risiko des gesamten Genoms in einem Familienquartett unter Verwendung einer Hauptallel-Referenzsequenz. PLoS Genetics 7(9): e1002280. http://dx.doi.org/10.1371/journal.pgen.1002280


Das Humangenomprojekt: Große Wissenschaft verändert Biologie und Medizin

Das Humangenomprojekt hat die Biologie durch seinen integrierten Big-Science-Ansatz zur Entschlüsselung einer menschlichen Referenzgenomsequenz zusammen mit den vollständigen Sequenzen wichtiger Modellorganismen verändert. Das Projekt veranschaulicht die Kraft, Notwendigkeit und den Erfolg großer, integrierter, fachübergreifender Bemühungen – der sogenannten „Big Science“ –, die auf komplexe Hauptziele ausgerichtet sind. In diesem Artikel diskutieren wir, wie dieses ehrgeizige Unterfangen zur Entwicklung neuartiger Technologien und Analysewerkzeuge führte und wie es die Expertise von Ingenieuren, Informatikern und Mathematikern mit Biologen zusammenbrachte. Es etablierte einen offenen Ansatz für die gemeinsame Nutzung von Daten und Open-Source-Software und machte damit die aus dem Projekt resultierenden Daten für alle zugänglich. Die Genomsequenzen von Mikroben, Pflanzen und Tieren haben viele Wissenschaftsbereiche revolutioniert, darunter Mikrobiologie, Virologie, Infektionskrankheiten und Pflanzenbiologie. Darüber hinaus hat das tiefere Wissen über die Variation menschlicher Sequenzen begonnen, die medizinische Praxis zu verändern. Das Human Genome Project hat nachfolgende groß angelegte Datenerfassungsinitiativen wie das International HapMap Project, 1000 Genomes und The Cancer Genome Atlas sowie das kürzlich angekündigte Human Brain Project und das aufkommende Human Proteome Project inspiriert.


Das Genome in a Bottle-Konsortium hat mehrere Genome ausgewählt, die als Referenzmaterialien hergestellt und charakterisiert werden sollen. Das National Institute of Standards and Technology (NIST) entwickelt NIST-Referenzmaterialien aus diesen Genomen, bei denen es sich um DNA handelt, die aus einem großen homogenisierten Wachstum von B-Lymphoblastoid-Zelllinien des Coriell Institute for Medical Research extrahiert wurde. Beachten Sie, dass es kleine Unterschiede zwischen der NIST-DNA und der Coriell-DNA geben kann, da sie aus unterschiedlichem Zellwachstum stammen, obwohl wir nicht erwarten, dass diese Unterschiede für die meisten Anwendungen groß sind.

Die verfügbaren und geplanten NIST-Referenzmaterialien sind unten aufgeführt, zusammen mit Links zu ihren Daten.

Eine Beschreibung der von GIAB generierten Daten für alle unten aufgeführten Genome wird hier veröffentlicht, und die Charakterisierung kleiner Varianten wird hier veröffentlicht. Laufende Arbeiten zur Charakterisierung schwierigerer Varianten und Regionen werden in der Google-Gruppe des GIAB-Analyseteams angekündigt.


Warum ist das Studium der Genetik wichtig?

Das Studium der Genetik ist wichtig, weil es Wissenschaftlern hilft, Krankheiten zu erkennen und zu verstehen. Durch ein tieferes Verständnis des Körpers können Wissenschaftler bestimmen, wie wahrscheinlich es ist, dass Mitglieder der Bevölkerung eine Krankheit erben, und den Menschen dabei helfen, ihre Risiken entsprechend zu managen.

Etwa neun von zehn Erkrankungen entstehen durch genetische Anfälligkeit. Mit dem Studium der Genetik ist es möglich, einige davon vorherzusagen und die Risiken zu reduzieren. Obwohl Wissenschaftler nicht alle genetischen Determinanten von Krankheiten vollständig verstehen, hilft ihnen die Forschung, mehr Informationen zu gewinnen, was ihnen wiederum die Möglichkeit gibt, wirksamere Medikamente und Behandlungen zuzuweisen.

In Bezug auf die Familiengesundheit ermöglicht das Studium der Genetik den Menschen, sich auf vererbbare Krankheiten vorzubereiten. Sowohl die Sichelzellenanämie als auch die Mukoviszidose haben beispielsweise starke genetische Komponenten. Darüber hinaus erkranken bestimmte Menschen aufgrund ihrer Gene eher aufgrund ihrer Umgebung oder der Nahrung, die sie zu sich nehmen. Das Verständnis der Genetik hilft Ärzten zu verstehen, warum ansonsten gesunde Menschen in jungen Jahren an ernsthaften Erkrankungen leiden.

Ein besonders nützliches Beispiel für ein genetisches Screening ist der BRCA-1- und BRCA-2-Genmutationstest. Frauen, die eine der beiden Formen dieser Genmutation erben, entwickeln weitaus häufiger als andere Frauen in jungen Jahren aggressiven Brust- oder Eierstockkrebs. Wenn sie sich dessen bewusst sind, können sie sich für eine präventive Mastektomie entscheiden und ihre Eizellen einfrieren, um sich auf zukünftige Fruchtbarkeitsbehandlungen vorzubereiten.


Analyse des Rhesusaffen-Genoms deckt genetische Unterschiede bei Menschen und Schimpansen auf

DNA-Vergleich liefert neue Hinweise für die Primatenbiologie.

Ein internationales Forscherkonsortium hat die Genomsequenz des Rhesusaffen veröffentlicht und mit dem Schimpansen- und dem menschlichen Genom abgeglichen. Veröffentlicht am 13. April in einem Sonderteil der Zeitschrift Wissenschaft, zeigt die Analyse, dass die drei Primatenarten etwa 93 Prozent ihrer DNA teilen, jedoch einige signifikante Unterschiede zwischen ihren Genen aufweisen.

In seinem Papier verglich das Rhesus Macaque Genome Sequence and Analysis Consortium, das teilweise vom National Human Genome Research Institute (NHGRI), einem der National Institutes of Health (NIH), unterstützt wird, die Genomsequenzen von Rhesusaffen (Macaca mulatta) mit dem des Menschen (Homo sapiens) und Schimpanse (Pan troglodytes), der mit dem Menschen am engsten verwandte Primat. In derselben Ausgabe erscheinen auch vier Begleitpapiere, die sich auf die Rhesus-Sequenz stützten.

Das Rhesus-Genom ist nach dem Schimpansen der zweite nicht-menschliche Primat, dessen Genom sequenziert wurde, und ist der erste Affe der Alten Welt, dessen DNA entschlüsselt wurde.

„Die Sequenzierung des Rhesus-Makaken-Genoms in Kombination mit der Verfügbarkeit des Schimpansen- und menschlichen Genoms bietet Forschern ein weiteres leistungsstarkes Werkzeug, um unser Verständnis der menschlichen Biologie in Bezug auf Gesundheit und Krankheit zu verbessern“, sagte NHGRI-Direktor Francis S. Collins, MD, Ph .D. "Während wir auf der Grundlage des Human Genome Project aufbauen, ist klar geworden, dass der Vergleich unseres Genoms mit dem Genom anderer Organismen entscheidend ist, um herauszufinden, was das menschliche Genom einzigartig macht."

Der Rhesus wird aufgrund seiner Reaktion auf das Affen-Immunschwächevirus (SIV) weithin als das beste Tiermodell für die Infektion mit dem menschlichen Immunschwächevirus (HIV) anerkannt. Die Rhesus-Genomsequenz wird auch dazu dienen, die grundlegende Forschung in den Neurowissenschaften, Verhaltensbiologie, Reproduktionsphysiologie, Endokrinologie und kardiovaskulären Studien zu verbessern. Darüber hinaus dient der Rhesus als wertvolles Modell für die Untersuchung anderer Infektionskrankheiten des Menschen und für die Impfstoffforschung.

Die Sequenzierung des Rhesus-Genoms wurde am Baylor College of Medicine Human Genome Sequencing Center in Houston, am Genome Sequencing Center an der Washington University School of Medicine in St. Louis und am J. Craig Venter Institute in Rockville, Maryland, durchgeführt Teil des NHGRI-unterstützten Large-Scale Sequencing Research Network. Die für die Sequenzierung verwendete DNA wurde von einem weiblichen Rhesusaffen am Southwest National Primate Research Center (NPRC) in San Antonio gewonnen, das vom National Center for Research Resources, einem Teil des NIH, unterstützt wird.

Unabhängige Assemblierungen der Rhesus-Genomdaten wurden an jedem der drei Sequenzierungszentren mit unterschiedlichen und komplementären Ansätzen durchgeführt und dann zu einem einzigen "Melced Assembly" kombiniert. In ihrer Analyse verglichen Wissenschaftler von 35 Institutionen diese verschmolzene Anordnung mit der Referenzsequenz des menschlichen Genoms, einem neueren, unveröffentlichten Sequenzentwurf des Schimpansengenoms, der Sequenz von mehr als einem Dutzend anderer, weiter entfernter Arten, die bereits in öffentlichen Datenbanken enthalten sind, der menschlichen HapMap und die Human Gene Mutation Database, die bekannte menschliche Mutationen auflistet, die zu genetischen Krankheiten führen.

"Diese Studie des Rhesus-Genoms ist von unschätzbarem Wert, da sie den Forschern eine Perspektive gibt, um zu beobachten, was in jedem Primatengenom während der Evolution von Rhesus, Schimpanse und dem Menschen von ihren gemeinsamen Vorfahren hinzugefügt oder entfernt wurde", sagte Richard Gibbs, Ph.D ., Direktor des Human Genome Sequencing Center des Baylor College of Medicine in Houston und Projektleiter.

Eine der nützlichsten Eigenschaften des Rhesus-Genoms ist, dass es weniger eng mit dem menschlichen Genom als mit dem Schimpansen-Genom verwandt ist. Dies bedeutet, dass wichtige Merkmale, die bei Primaten im Laufe der Zeit konserviert wurden, leichter zu erkennen sind, wenn man Rhesus mit dem Menschen vergleicht, als den Schimpansen mit dem Menschen.

Durch das Hinzufügen des Rhesus-Genoms zum Primatenvergleich identifizierten die Forscher fast 200 Gene, die wahrscheinlich eine Schlüsselrolle bei der Bestimmung von Unterschieden zwischen Primatenarten spielen. Dazu gehören Gene, die an der Haarbildung, Immunantwort, Membranproteinen und der Spermien-Ei-Fusion beteiligt sind. Viele dieser Gene befinden sich in Bereichen des Primatengenoms, die dupliziert wurden, was darauf hindeutet, dass eine zusätzliche Kopie eines Gens es ihm ermöglichen kann, sich schneller zu entwickeln, und dass kleine Duplikationen ein Schlüsselmerkmal der Primatenevolution sind.

Die Analyse ergab auch einige Fälle, in denen ganze Genfamilien im Rhesus radikal anders waren und mehr Kopien bestimmter Gene enthielten als beim Schimpansen oder Menschen. Diese Genfamilien umfassen wichtige immunbezogene Gene sowie Gene mit noch nicht vollständig bekannten Funktionen.

Neben dem Vergleich des Rhesus mit dem Genom von Schimpansen und Menschen untersuchte die Gruppe auch die genetische Variation in Makakenpopulationen und entwickelte eine Reihe von "Single Nucleotide Polymorphisms" oder SNPs (Single Base DNA Differers), die für zukünftige Analysen der Vererbung verwendet werden können biomedizinisch wichtiger Merkmale bei Rhesus. Die für diese Studien verwendeten genomischen Rhesus-DNA-Proben wurden vom California NPRC, Oregon NPRC, Southwest NPRC und Yerkes NPRC beigesteuert. Dieser Fortschritt in der Makakengenetik wird die Verwendung von Makaken für das Studium genetischer Krankheiten des Menschen verbessern.


Datenmanagement

Das Humangenomprojekt und andere Genomprojekte haben massive Daten zu Genomsequenzen, krankheitsverursachenden Genvarianten, dreidimensionalen Proteinstrukturen und -funktionen, Protein-Protein-Interaktionen und Genregulation generiert. Die Bioinformatik ist eng mit zwei weiteren neuen Feldern verbunden: der Genomik (Identifizierung und funktionelle Charakterisierung von Genen massiv parallel und im Hochdurchsatz) und der Proteomik (Analyse der biologischen Funktionen von Proteinen und ihrer Wechselwirkungen), die ebenfalls aus dem Genom hervorgegangen sind Projekte. Die Früchte des HGP werden große Auswirkungen auf das Verständnis von Evolution und Entwicklungsbiologie sowie auf die Fähigkeit von Wissenschaftlern haben, Krankheiten zu diagnostizieren und zu behandeln. Bereiche außerhalb der traditionellen Biologie, wie Anthropologie und forensisch Medizin, umfassen auch Genominformationen.

Die Kenntnis der Sequenz der Milliarden von Basen im menschlichen Genom sagt den Wissenschaftlern nicht, wo sich die Gene befinden (etwa 1,5 Prozent des menschlichen Genoms kodieren für Proteine). Es sagt den Wissenschaftlern auch nicht, was die Gene tun, wie Gene reguliert werden, wie Genprodukte eine Zelle bilden, wie Zellen Organe bilden, welche Mutationen genetischen Krankheiten zugrunde liegen, warum Menschen altern und wie man Medikamente entwickelt. Bioinformatik, Genomik und Proteomik versuchen, diese Fragen mit Technologien zu beantworten, die möglichst viele Gensequenzinformationen nutzen. Insbesondere die Bioinformatik konzentriert sich auf computergestützte Ansätze.

Die Bioinformatik umfasst die Entwicklung von Datenbanken und Rechenalgorithmen zum Speichern, Verbreiten und schnellen Abrufen von Genomdaten. Biologische Daten sind komplex und reichlich vorhanden. Das US National Center for Biotechnology Information (NCBI), eine Abteilung der National Institutes of Health, beherbergt beispielsweise zentrale Datenbanken für Gensequenzen (GenBank), Krankheitsassoziationen (OMIM) und Proteinstruktur (MMDB) und veröffentlicht biomedizinische Artikel (PubMed). Am besten bekommt man ein Gefühl für die Größe und Vielfalt der Daten, indem man über das World Wide Web ( http://ncbi.nlm.nih.gov ) auf die Homepage des NCBI zugreift. Ein Bioinformatik-Team des NCBI arbeitet am Design der Datenbanken und an der Entwicklung effizienter Algorithmen zum Abrufen von Daten und zum Vergleichen von DNA-Sequenzen.


GENOM IN EINER FLASCHE

Das Genome in a Bottle (GIAB) Consortium ist ein öffentlich-privat-akademisches Konsortium, das vom NIST gehostet wird, um die technische Infrastruktur (Referenzstandards, Referenzmethoden und Referenzdaten) zu entwickeln, um die Übertragung der gesamten menschlichen Genomsequenzierung in die klinische Praxis zu ermöglichen. Die Priorität von GIAB ist die maßgebliche Charakterisierung menschlicher Genome zur Verwendung in der analytischen Validierung und Technologieentwicklung, -optimierung und -demonstration. Im Jahr 2015 veröffentlichte NIST das Pilotgenom-Referenzmaterial 8398, bei dem es sich um genomische DNA (NA12878) handelt, die aus einer großen Charge der Coriell-Zelllinie GM12878 stammt und für hochgradig zuverlässige SNPs, Indel und homozygote Referenzregionen charakterisiert ist (Zook, et al. , Nature Biotechnology 2014 und Zook et al., Nature Biotechnology 2019).

Es stehen vier neue GIAB-Referenzmaterialien zur Verfügung. Mit der Aufnahme dieser neuen Referenzmaterialien (RMs) in eine wachsende Sammlung von „Messstäbchen“ für die Gensequenzierung können wir Labors jetzt noch mehr Möglichkeiten bieten, DNA für Gentests, medizinische Diagnosen und zukünftige maßgeschneiderte Arzneimitteltherapien genau „zu kartieren“ . Die neuen Tools enthalten sequenzierte Gene von Individuen in zwei genetisch unterschiedlichen Gruppen, Asiaten und aschkenasischen Juden, ein Vater-Mutter-Kind-Trio aus aschkenasischen Juden und vier Mikroben, die üblicherweise in der Forschung verwendet werden. Für weitere Informationen klicken Sie hier. Um sie zu kaufen, besuchen Sie:

Daten und Analysen sind öffentlich verfügbar (GIAB GitHub). Eine Beschreibung der von GIAB generierten Daten wird hier veröffentlicht. Um Best Practices für die Verwendung von GIAB-Genomen für das Benchmarking zu etablieren, haben wir mit dem Global Alliance for Genomics and Health Benchmarking Team (Benchmarking-Tools und Manuskript) zusammengearbeitet.

Für NA12878, das Ashkenazim-Trio und den chinesischen Sohn in Bezug auf GRCh37 und GRCh38 sind hochkonfidente kleine Varianten und homozygote Referenzrufe verfügbar (Zook, et al., Nature Biotechnology 2019). Die neueste Version dieser Aufrufe befindet sich im neuesten Verzeichnis für jedes Genom auf dem GIAB-FTP. Die aktuelle Arbeit im GIAB-Analyseteam konzentriert sich auf die Etablierung von Benchmark-Anrufen für große Indel- und Strukturvarianten sowie Anrufe in schwierigen genomischen Kontexten (z. B. schwer zu kartierende Regionen, Tandem-Wiederholungen).

Das Konsortium wurde 2011 und 2012 in einer Reihe von Sitzungen initiiert und veranstaltet in der Regel jährlich offene, öffentliche Workshops an der Stanford University in Palo Alto, Kalifornien, oder am NIST in Gaithersburg, MD. Hier finden Sie Folien von Workshops und Konferenzen. Das Konsortium ist offen und heißt neue Teilnehmer willkommen.


Genom

Das potenzielle Ausmaß des verschwundenen Genoms und die Menge sich wiederholender DNA-Stücke sind „wahnsinnig“, sagt Arjan Banerjee, ein Biologe an der University of Toronto Mississauga, der ebenfalls nicht an dieser Studie beteiligt ist.

Die Forscher verwendeten eine Form von Adenovirus, die sich nicht replizieren und Krankheiten verursachen kann, und fügten das genetische Material, das für das SARS-CoV-2-Spike-Protein kodiert, in sein Genom ein.

Perri und ihre Kollegen verwendeten bereits sequenzierte Genome von alten und modernen Hunden, um zu berechnen, wann sich Populationen geteilt oder gekreuzt hatten, und wiederholten den Vorgang dann mit menschlichen Genomen.

Andere Wirbeltiere haben nur eine Kopie eines mitochondrialen Genoms.

Als die Forscher das Genom der Tigerklapperschlange sequenzierten, stellten sie fest, dass nur etwa die Hälfte der giftigen Gene, die sie besaß, tatsächlich verwendet wurde.

Mein alter Chef, T. Brooks Ellis, der Direktor des Human Genome Project.

Das bedeutet, dass alle Kinder, die er hat, ein typisches Genom haben oder, wie er, symptomfreie Überträger sind.

Die Europäische Union hat gerade 1,2 Milliarden Euro für das Human Brain Project bereitgestellt – eine Art Human Genome Project für das Gehirn.

Bundesgelder halfen dabei, wissenschaftliche Durchbrüche wie das Humangenomprojekt zu erzielen.

Wissenschaftler extrahieren das komplette Neandertaler-Genom aus Fossilien – 97 Prozent stimmen mit der A&E-Programmierung überein.

Das Humangenomprojekt entschlüsselt nun die genetischen Mysterien des Lebens.

Noch in diesem Jahr werden die Forscher den ersten Entwurf des gesamten menschlichen Genoms fertigstellen – den Bauplan des Lebens.


Allgemeine Informationen zu Gentests:

MedlinePlus bietet eine Liste mit Links zu Informationen über Gentests.

Einen Überblick zu diesem Thema bietet das National Human Genome Research Institute in seinen Frequently Asked Questions About Gentests. Zusätzliche Informationen zu Gesetzgebung, Richtlinien und Aufsicht zu Gentests sind beim Institut erhältlich.

Sie können auch nach klinischen Studien mit Gentests suchen. ClinicalTrials.gov, ein Dienst der National Institutes of Health, bietet einfachen Zugang zu Informationen über klinische Studien. Sie können nach bestimmten Studien suchen oder nach Krankheit oder Studiensponsor suchen. Sie können auf eine Liste von Studien im Zusammenhang mit Gentests verweisen, die Teilnehmer akzeptieren (oder akzeptieren werden).


Die Rasse des menschlichen Genoms

Es waren Neuigkeiten, die einige Zuschauer bereit machten, die Wette zu wechseln. Aber tatsächlich ist das Rennen noch zu kurz. Auch das Human Genome Project, das seit 1990 kontinuierlich daran arbeitet, das menschliche Genom zu knacken, steht kurz vor der Fertigstellung eines "Arbeitsentwurfs". Und Celeras Ankündigung bedeutet nicht unbedingt, dass sie den Preis schon erhalten haben.

Celeras Forscher verwendeten einen "Schrotflinten-Ansatz". Sie nahmen die DNA einer Person (das Molekül, das alle Gene enthält), zerhackten sie in kleine Stücke und bestimmten die Sequenz der Basenpaare in jedem Stück. Jetzt müssen sie die Teile jedoch wieder zusammensetzen. Erst wenn sie dieses Puzzle lösen, haben sie das Genom sequenziert. Aber mit riesigen Computern, die Tag und Nacht mit Zahlen arbeiten, kann Celerea diese Montage jede Woche abschließen.

Dann müssen Wissenschaftler herausfinden, was die einzelnen Gene tun. Und hier können Hefen, Würmer und Fliegen helfen: Auch wenn sie nicht so aussehen, teilen diese sogenannten Modellorganismen viele Erbinformationen mit dem Menschen. "Ich denke, dass etwa 40 Prozent aller Hefegene ein menschliches Gegenstück haben oder ein Gen haben, das beim Menschen eine ähnliche Funktion hat", sagt Marc Cockett, Executive Director of Functional Genomics bei Bristol-Myers Squibb. Und diese Organismen sind viel einfacher zu untersuchen als Menschen: Sie vermehren sich schneller und ihre Gene sind leicht zu manipulieren. Im Vergleich zu Tieren wie Mäusen sind sie billiger in der Aufzucht. Wenn wir also herausfinden, wie ihre Gene funktionieren, können wir viel über unsere eigenen Gene lernen.

Bisher haben Genetiker drei solcher Arten auf der „Ark of Genomes“ bestiegen und ihre Genome vollständig sequenziert: Bäckerhefe (Saccharomyces cerevisiae), den Fadenwurm Caenorhabditis elegans und die Fruchtfliege Drosophila melanogaster. (Celera und das Berkeley Drosophila Genome Project haben letzten Monat gemeinsam das Fliegengenom in Science veröffentlicht). Bald wird die Maus – die aus genetischer Sicht fast menschlich ist – diesem Schiff beitreten: Ihr Genom wird in einem weiteren Wettlauf zwischen dem öffentlich finanzierten Mausgenom-Sequenzierungsprojekt und Celera gesucht. Und der Zebrafisch, der in jungen Jahren durchsichtig ist und so den Forschern beim Wachsen seiner Organe zusehen lässt, wird wahrscheinlich als nächstes dran sein.

Die gute Nachricht ist, dass die Gene dieser Organismen unseren eigenen so ähnlich sind, dass sie helfen können, neue Heilmittel für genetische Krankheiten zu finden. Bis zu 60 Prozent der 289 bekannten menschlichen Krankheitsgene haben Gegenstücke in Drosophila. Kevin Fitzgerald, ein Wurmforscher bei Bristol-Myers Squibb, sagt: "Einige der gleichen Gene und Komponenten, die für Krebs, zum Beispiel Brustkrebs oder die Alzheimer-Krankheit verantwortlich sind, werden tatsächlich gefunden, und sie scheinen in beiden sehr ähnlich zu funktionieren." Würmer und Fliegen."

Sogar einfache Bäckerhefe, die nur aus einer Zelle zu unseren Milliarden besteht, spielt eine Rolle in Studien über die Wirkung von Krebsbehandlungen. Bis heute hat Hefe Wissenschaftlern viel über Zellteilung und DNA-Reparatur gelehrt, Prozesse, die bei Krebs schiefgehen. Und Forscher des "Seattle-Projekts", eine vom National Cancer Institute finanzierte Anstrengung, um neue Krebsmedikamente zu finden, mutieren Gene in Hefezellen - wie das ATM-Gen oder die Mismatch-Reparatur-Gene -, die beim Menschen oft zu Krebs führen . Dann setzen sie diese mutierten Hefezellen einer ganzen Reihe chemischer Verbindungen aus, die in der Krebstherapie verwendet werden, um herauszufinden, welche sie töten. Die Ergebnisse geben Hinweise, wie diese Medikamente wirken und wie sie verbessert werden können.

„Nehmen wir an, wir wollen einen neuen antidiabetischen Wirkstoff finden“, erklärt Geoffrey Duyk, CEO von Exelixis, einem auf Modellorganismen spezialisierten kalifornischen Unternehmen. „Wir wissen, dass die meisten Patienten bei Typ-II-Diabetes im Wesentlichen resistent gegen die Wirkung von Insulin sind. In den Modellsystemen erzeugen Sie also eine Mutation oder eine Reihe von Mutationen, die diese Organismen resistent gegen die Wirkung von Insulin machen . Dann sucht man im Wesentlichen Suppressor-Mutationen, Dinge, die andere Gene verändern, die die Empfindlichkeit des Organismus für Insulin verändern. Und dann findet man die entsprechenden Wirbeltier-Gene und fragt, ob sie dasselbe tun." Und Medikamente, die auf die Produkte dieser Gene einwirken, könnten die gleiche Wirkung haben wie die Mutationen – die Insulinreaktion wird wieder normal.

Letztendlich kann das Verständnis der Funktionsweise der Gene eines Wurms oder einer Fliege natürlich nie das menschliche Genom vollständig erklären. „Es gibt eine zweite Phase jedes Projekts, nämlich es muss in Säugerzellen extrapoliert werden. Und das unabhängig davon, ob Sie sich in Hefe, in Fliegen oder in C. elegans befinden“, sagt Stephen Friend, Präsident von Rosetta Inpharmatics in Seattle und früher einer der Koordinatoren des Seattle-Projekts. Aber das Studium der Genome anderer Organismen bietet wertvolle, wenn auch indirekte Lektionen zum Verständnis unserer eigenen Gene, sobald der Wettlauf um sie zu Ende ist.


Schau das Video: Forschungsprojekt Referenz-Genom Blutgruppen (Kann 2022).