Information

8.12B: Deinococcus und Thermus - Biologie

8.12B: Deinococcus und Thermus - Biologie


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Lernziele

  • Vergleiche Deinococcus und Thermus Bakterien

DEINOKOKUS

Dies ist die eine von drei Gattungen der Deinococcales-Gruppe aus dem Deinococcus-Thermus-Stamm und ist sehr widerstandsfähig gegen Umweltgefahren. Es gibt mehrere Arten, die gegen Strahlung resistent sind (sie sind berühmt für ihre Fähigkeit, Atommüll und andere giftige Materialien zu fressen), im Vakuum des Weltraums und bei extremer Hitze und Kälte zu überleben. Laut NCBI am 25. August 2011 wurden 47 Arten von Deinococcus beschrieben.

Diese Bakterien haben dicke Zellwände, die ihnen Gram-positive Färbungen verleihen, aber sie enthalten eine zweite Membran und sind daher in ihrer Struktur denen von Gram-negativen Bakterien näher. Cavalier-Smith nennt diese Klade Hadobakterien (aus Hades, der griechischen Unterwelt).

Sie zeichnen sich auch durch das Vorhandensein des Carotinoidpigments Deinoxanthin aus, das ihnen ihre rosa Farbe verleiht, und eine hohe Beständigkeit gegen Gamma- und UV-Strahlung. Sie werden in der Regel nach diesen beiden Kriterien isoliert.

D. RADIODURANE

Deinococcus radiodurans ist ein extremophiles Bakterium, einer der strahlenresistentesten Organismen, die bekannt sind. Es kann Kälte, Austrocknung, Vakuum und Säure überleben und ist daher als polyextremophil bekannt und wurde als das härteste Bakterium der Welt in eingestuft Das Guinness-Buch der Rekorde.

D. radiodurans ist ein ziemlich großes, kugelförmiges Bakterium mit einem Durchmesser von 1,5 bis 3,5 µm. Normalerweise kleben vier Zellen zusammen und bilden eine Tetrade. Die Bakterien lassen sich leicht kultivieren und scheinen keine Krankheiten zu verursachen. Kolonien sind glatt, konvex und rosa bis rot gefärbt. D. radiodurans bildet keine Endosporen und ist unbeweglich. Es ist ein obligat aerobes Chemoorganoheterotroph, d.h. es nutzt Sauerstoff, um Energie aus organischen Verbindungen in seiner Umgebung zu gewinnen.

Es kommt häufig in Lebensräumen vor, die reich an organischen Materialien wie Erde, Kot, Fleisch oder Abwasser sind, aber auch aus getrockneten Lebensmitteln, Raumstaub, medizinischen Instrumenten und Textilien isoliert. Es ist extrem beständig gegen ionisierende Strahlung, ultraviolettes Licht, Austrocknung sowie oxidierende und elektrophile Mittel. Sein Genom besteht aus zwei kreisförmigen Chromosomen, von denen eines 2,65 Millionen Basenpaare lang und das andere 412 Tausend Basenpaare lang ist, sowie ein Megaplasmid von 177 Tausend Basenpaaren und ein Plasmid von 46 Tausend Basenpaaren. Es hat etwa 3.195 Gene. In ihrer stationären Phase enthält jede Bakterienzelle vier Kopien dieses Genoms; bei schneller Vermehrung erhöht sich dies auf acht bis 10 Kopien.

D. radiodurans ist in der Lage, einer akuten Dosis von fünftausend Gy (fünfhunderttausend rad) ionisierender Strahlung fast ohne Verlust der Lebensfähigkeit standzuhalten, und einer akuten Dosis von 15000 Gy mit 37% Lebensfähigkeit. Es wird geschätzt, dass eine Dosis von 5000 Gy mehrere hundert Doppelstrangbrüche (DSBs) in die DNA des Organismus einführt (~0,005 DSB/Gy/Mbp (haploides Genom)). Zum Vergleich: Eine Thorax-Röntgen- oder Apollo-Mission umfasst etwa ein mGy, fünf Gy können einen Menschen töten, zwei- bis achthundert Gy töten E. coli und über viertausend Gy töten das strahlungsresistente Bärtierchen.

Inzwischen sind mehrere Bakterien mit vergleichbarer Strahlenresistenz bekannt, darunter auch einige Arten der Gattung Chrookokzidiose (Stamm Cyanobakterien) und einige Arten von Rubrobacter (Stamm-Actinobakterien); unter den Archaeen, die Arten Thermococcus gammatolerans zeigt eine vergleichbare Strahlenresistenz.

D. radiodurans hat auch eine einzigartige Fähigkeit, beschädigte DNA zu reparieren. Es isoliert die beschädigten Segmente in einem kontrollierten Bereich und repariert sie. Dieses Bakterium kann auch viele kleine Fragmente eines ganzen Chromosoms reparieren.

THERMUS

Eine Gattung thermophiler Bakterien, die hohe Temperaturen vertragen können, ist eines von mehreren Bakterien der Deinococcus-Thermus-Gruppe und umfasst die folgenden drei Arten: T. aquaticus, T. antranikianii, und T. igniterrae. Thermus aquaticus ist die Quelle des hitzebeständigen Enzyms Taq-DNA Polymerase, eines der wichtigsten Enzyme in der Molekularbiologie aufgrund seiner Verwendung in der DNA-Amplifikationstechnik der Polymerase-Kettenreaktion (PCR).

Es gedeiht bei 70 ° C (160 ° F), kann aber bei Temperaturen von 50 ° C bis 80 ° C (120 ° F bis 175° F) überleben. Dieses Bakterium ist ein Chemotroph – es führt eine Chemosynthese durch, um Nahrung zu gewinnen. Da sich sein Temperaturbereich jedoch etwas mit dem der photosynthetischen Cyanobakterien überschneidet, die seine ideale Umgebung teilen, lebt er manchmal zusammen mit seinen Nachbarn und bezieht Energie für das Wachstum aus deren Photosynthese.

Wichtige Punkte

  • Die Deinococcales umfassen zwei Familien mit drei Gattungen, Deinokokken und Truepera, erstere mit mehreren strahlungsresistenten Arten; Sie sind berühmt für ihre Fähigkeit, Atommüll und andere giftige Materialien zu fressen, im Vakuum des Weltraums und bei extremer Hitze und Kälte zu überleben.
  • Die Thermik umfassen mehrere hitzebeständige Gattungen, einschließlich Therme.
  • Diese Bakterien haben dicke Zellwände, die ihnen Gram-positive Färbungen verleihen, aber sie enthalten eine zweite Membran und sind daher in ihrer Struktur denen von Gram-negativen Bakterien näher.

Schlüsselbegriffe

  • Strahlenbeständigkeit: Jede Form von Resistenz, die ein Organismus hat, um sich gegen die schädliche Wirkung ionisierender Strahlung zu schützen
  • Klade: Eine Gruppe von Tieren oder anderen Organismen, die von einer gemeinsamen Vorfahrenart abstammen.
  • polyextremophil: Ein Organismus, der zwei oder mehr extreme Umweltfaktoren tolerieren kann.

Die Deinococcus-Thermus sind eine kleine Gruppe von Bakterien, die aus Kokken bestehen und sehr resistent gegen Umweltgefahren sind. Es gibt zwei Hauptgruppen: Die Deinococcales umfassen zwei Familien mit drei Gattungen, Deinococcus und Truepera.

Die Thermik umfassen mehrere hitzebeständige Gattungen (Marinithermus, Meiothermus, Oceanithermus, Thermus, Vulcanithermus).

Obwohl diese beiden Gruppen aus einem gemeinsamen Vorfahren hervorgegangen sind, scheinen die beiden Resistenzmechanismen weitgehend unabhängig zu sein.


Hochwertige Genomsequenz des strahlenresistenten Bakteriums Deinococcus ficus KS 0460

Die genetischen Plattformen von Deinokokken Spezies bleiben die einzigen Systeme, in denen massive Genomschäden durch ionisierende Strahlung (IR) in vivo bei Expositionen untersucht werden können, die dem zellulären Überleben angemessen sind. Wir berichten über die gesamte Genomsequenz des extrem IR-resistenten stäbchenförmigen Bakteriums Deinococcus ficus KS 0460 und seine phänotypische Charakterisierung. Deinococcus ficus KS 0460 wird seit 1987 untersucht, zunächst unter dem Namen Deinobacter grandis, dann Deinococcus grandis. Die D. ficus Das Genom von KS 0460 besteht aus einer 4,019 Mbp-Sequenz (69,7 % GC-Gehalt und 3894 vorhergesagte Gene), die in sechs Genompartitionen unterteilt ist, von denen fünf als zirkulär bestätigt wurden. Die Kreisförmigkeit wurde manuell durch Paarungspaarung bestimmt. Ungefähr 76 % der vorhergesagten Proteine ​​enthielten identifizierbare Pfam-Domänen und 72 % wurden COGs zugeordnet. Von allen D. ficus KS 0460 Proteine, 79 % und 70 % hatten Homologe in Deinococcus radiodurans ATCC BAA-816 und Deinococcus geothermalis DSM 11300 bzw. Die auffälligsten Unterschiede zwischen D. ficus KS 0460 und D. radiodurans BAA-816, die durch den Vergleich der KEGG-Pfade identifiziert wurden, waren wie folgt: (i) D. ficus fehlen neun Enzyme des Purinabbaus, die in D. radiodurans, und (ii) D. ficus enthält acht Enzyme, die am Stickstoffstoffwechsel beteiligt sind, darunter Nitrat- und Nitritreduktasen, die D. radiodurans fehlt. Darüber hinaus fehlen Gene, die bisher als wichtig für die IR-Resistenz angesehen wurden D. ficus KS 0460, nämlich für den Mn-Transporter nramp, und die Proteine ​​DdrF, DdrJ und DdrK, die alle ebenfalls in fehlen Deinococcus Deserti. Andernfalls, D. ficus KS 0460 steht beispielhaft für die Deinokokken Abstammung.

Schlüsselwörter: Deinococcaceae Deinococcus ficus Deinococcus-Thermus Genomanalyse Phänotyp-Charakterisierung Phylogenetische Analyse Strahlenresistent Stäbchenförmig.

Interessenkonflikt-Erklärung

Konkurrierende Interessen

Die Autoren geben an, keine konkurrierenden Interessen zu haben.

Anmerkung des Herausgebers

Springer Nature bleibt in Bezug auf gerichtliche Ansprüche in veröffentlichten Karten und institutionellen Zugehörigkeiten neutral.


Inhalt

Als in den 1960er Jahren Studien über biologische Formen in den heißen Quellen von Yellowstone begannen, dachten Wissenschaftler, dass das Leben thermophiler Bakterien bei Temperaturen über 55 Grad Celsius (131 Grad Fahrenheit) nicht aufrechterhalten werden kann. Bald stellte sich jedoch heraus, dass viele Bakterien in verschiedenen Quellen nicht nur überlebten, sondern auch bei höheren Temperaturen gediehen. 1969 berichteten Thomas Brock und Hudson Freeze von der Indiana University über eine neue Art thermophiler Bakterien, die sie nannten Thermophilus aquaticus. [1] Das Bakterium wurde erstmals in der Great Fountain-Region des Yellowstone-Nationalparks entdeckt und wurde seitdem in ähnlichen thermischen Lebensräumen auf der ganzen Welt gefunden.


Resultate und Diskussionen

Experimentelle Charakterisierung der Resistenz gegen Gammastrahlung und Austrocknung sowie Bestimmung des intrazellulären Mn/Fe-Verhältnisses für T. thermophilus

Während die strahlungs- und austrocknungsresistenten Phänotypen von DR und die thermischen Anforderungen sowohl von TT als auch von DR ausführlich untersucht wurden ([7, 12, 30] und Referenzen darin), ist uns keine detaillierte Charakterisierung der Reaktion von TT auf bekannt Bestrahlung oder Austrocknung. Daher haben wir versucht, diese Eigenschaften zu untersuchen, um ein vollständigeres Bild der Unterschiede in den Stressreaktionsphänotypen von TT und DR zu erhalten. Nicht unerwartet fanden wir, dass TT viel empfindlicher gegenüber akuter Bestrahlung war als DR. Die Überlebenskurve von TT ist ähnlich der von Esherichia coli K12. Für DR ist die Strahlendosis, die ein Überleben von 10 % Koloniebildungseinheit (KBE) ergibt (D10) ist

16 kGy, wohingegen für TT und E coli, Das D10 Dosis ist

0,7 kGy bzw. (Abbildung 1). TT ist auch sehr empfindlich gegenüber Austrocknung. Die 10 % CFU-Austrocknungsüberlebenshäufigkeit von DR wird nach 30 Tagen aufrechterhalten, während TT die 10 % CFU-Austrocknungsüberlebensrate bei . erreicht

10 Stunden (0,4% Überleben nach 24 Stunden) und erleidet am 5. Tag im Wesentlichen 100% Letalität. Die geringe Austrocknungsbeständigkeit von TT wird unabhängig von Temperatur und Trocknungsgeschwindigkeit beobachtet (siehe Zusatzdatei 1, "Austrocknung von TT bei 65°C"). Die Austrocknungsbeständigkeit von E coli wurde als Zwischenprodukt zwischen denen von TT und DR gefunden (Abbildung 2).

Strahlenbeständigkeit von T. thermophilus (ATCC BAA-163), D. radiodurans (ATCC BAA-816) und E coli (K-12 MG1655, bereitgestellt von M. Cashel, NIH) (60 Co-Bestrahlung). Standardabweichungen für die Datenpunkte sind angegeben.

Austrocknungsbeständigkeit von T. thermophilus (ATCC BAA-163), D. radiodurans (ATCC BAA-816) und E coli (K-12 MG1655) (Raumtemperatur). Beachten Sie, dass für Zellen, die bei 65 °C getrocknet wurden, keine überlebenden Zellen erhalten wurden. Standardabweichungen für fünf Datenpunkte sind gezeigt.

Wir haben kürzlich über einen Trend der intrazellulären Mn/Fe-Konzentrationsverhältnisse bei der bakteriellen IR-Resistenz berichtet, wobei sehr hohe und sehr niedrige Mn/Fe-Verhältnisse mit sehr hohen bzw. sehr niedrigen Resistenzen korrelierten [29]. Wir haben auch gezeigt, dass das Wachstum D. radiodurans unter Bedingungen, die die Mn(II)-Akkumulation begrenzten, senkte die IR-Resistenz der Zellen signifikant [29]. Diese Beobachtungen führten zu der Hypothese, dass das Verhältnis von Mn zu Fe in einer Zelle die relative Häufigkeit verschiedener ROS bestimmen könnte, die während der Exposition gegenüber und der Erholung von IR induziert werden [28, 29]. In hohen Konzentrationen kann Mn(II) als echter Katalysator der Dismutation von Superoxid (O2 •- ), wobei Mn zwischen den zweiwertigen und dreiwertigen Zuständen cyclisiert Mn-Redoxcycling fängt sowohl O2 •- und Wasserstoffperoxid [31]. In diesem Zusammenhang haben wir das intrazelluläre Mn/Fe-Verhältnis von TT mit einer induktiv gekoppelten Plasma-Massenspektrometrie-Methode (ICP-MS) bestimmt, wie zuvor beschrieben [29]. TT-Zellen enthielten 0,211 (± 0,0254) nmol Mn/mg Protein und 4,54 (± 0,778) nmol Fe/mg Protein. Das intrazelluläre Mn/Fe-Verhältnis von TT (D10,

0,8 kGy) beträgt 0,047 im Vergleich zu 0,0072 für E coli (D10,

0,7 kGy), 0,24 für D. radiodurans (D10,

16 kGy) und <0,0001 für Pseudomonas putida (D10,

0,25 kGy) [29]. Somit scheint TT gegenüber akuter IR und Austrocknung etwas empfindlicher zu sein als durch sein Mn/Fe-Verhältnis vorhergesagt, was auf die Möglichkeit komplexerer Beziehungen zwischen diesen beiden Variablen schließen lässt. Insbesondere das Abfangen von O2 •- durch Mn(II) hängt stark von der Verfügbarkeit von H . ab2Ö2, die bei TT während der Erholung bei 65 °C aufgrund der thermischen Zersetzung [32] voraussichtlich limitierend werden würde. Sowohl DR als auch TT kodieren für einen Mn-Transporter vom ABC-Typ und einen Transkriptionsregulator, der wahrscheinlich die Mn-Homöostase reguliert. Darüber hinaus hat DR einen Mn-Transporter der NRAMP-Familie, für den es in TT kein Ortholog gibt.

Rekonstruktion des Geninhaltsbaums und des Genrepertoires des gemeinsamen Vorfahren von Deinococcus und Thermus

Informationen über das Vorhandensein oder Fehlen von orthologen Genen in einem Satz von Genomen können verwendet werden, um einen Geninhaltsbaum zu erstellen [33, 34]. Die Topologie eines Geninhaltsbaums kann nicht nur die phylogenetischen Beziehungen zwischen den verglichenen Arten widerspiegeln, sondern auch Ähnlichkeiten und Unterschiede in der Lebensweise [33, 35, 36]. Angesichts der dramatischen Unterschiede in den Lebensstilen und Resistenz-Phänotypen von TT und DR waren wir daran interessiert, festzustellen, ob der Gengehalt von TT dem von DR oder dem anderer thermophiler Bakterien oder vielleicht sogar Archaeen am ähnlichsten war oder nicht. Zu diesem Zweck ordneten wir die im TT-Genom kodierten Proteine ​​den Clusters of Orthologous Groups of Proteins (COGs) zu [37] und rekonstruierten unter Verwendung der Darstellungsmuster von Arten in COGs zur Berechnung von Distanzen zwischen Arten einen Geninhaltsbaum wie zuvor beschrieben [35]. Im resultierenden Geninhaltsbaum, der 62 sequenzierte Genome von Prokaryoten und einzelligen Eukaryoten umfasste, wurden TT und DR sicher als Schwesterarten wiedergefunden, und die DR-TT-Linie wurde innerhalb eines Unterbaums positioniert, der auch Actinobakterien und Cyanobakterien umfasste, von denen mehrere sind für ihre extreme Strahlungs- und Austrocknungsbeständigkeit bekannt [38–40] (Abbildung 3). Für diesen Zweig ahmt die Topologie des Geninhaltsbaums die Topologien von Bäumen nach, die mit anderen Ansätzen basierend auf genomweiten Daten konstruiert wurden [34, 35], was darauf hindeutet, dass die Genrepertoires dieser Bakterien, und insbesondere TT und DR, auseinanderlaufen, grob, uhrenartig. Um zu bestimmen, welche Gene in jeder Abstammungslinie wahrscheinlich verloren und hinzugewonnen wurden, rekonstruierten wir ein sparsames Evolutionsszenario vom letzten gemeinsamen bakteriellen Vorfahren (LBCA) zu TT und DR bis hin zu seinem letzten gemeinsamen Vorfahren. Die Rekonstruktion erfolgte auf der Grundlage der Zuordnung von TT- und DR-Proteinen zu COGs, zusammen mit COG-basierten phyletischen Mustern von 62 anderen sequenzierten bakteriellen und archaealen Genomen [37] unter Verwendung einer zuvor entwickelten gewichteten Sparsamkeitsmethode [41] (siehe Methoden und zusätzliche Datei 2). Dieser Ansatz ordnet dem gemeinsamen Vorfahren von DR-TT 1.310 Gene (COGs) zu (Abbildung 4). Davon 1.081 (

80%) wurden sowohl in TT als auch in DR beibehalten und gehören zu ihrem gemeinsamen Genkern. Da TT (2210 Gene) weit weniger vorhergesagte Protein-kodierende Gene hat als DR (3191 Gene), scheint es wahrscheinlich, dass die Divergenz der beiden eine wesentliche Genomreduktion bei TT und/oder Genomexpansion bei DR beinhaltete. Die Rekonstruktionsergebnisse deuten jedoch darauf hin, dass TT keine massive Genomreduktion erfahren hat, obwohl der gesamte Genfluss (d

25% des Genkomplements. Im Gegensatz dazu gewann DR 272 COGs, wobei nur 59 verloren gingen, was auf ein erhebliches Genomwachstum nach der DR-TT-Divergenz hinweist (Abbildung 4).

Geninhaltsbaum für 66 Arten, die in die COG-Datenbank aufgenommen wurden, basierend auf den Mustern der Präsenz-Abwesenheit in den COGs. Die Thermus-Dinokokken clade ist durch Fettdruck gekennzeichnet. Schwarz, Bakteriengelb, Archaeenblau, Eukaryoten.

Das rekonstruierte Evolutionsszenario für die Thermus-Dinokokken klade. LBCA – Letzter gemeinsamer Bakterieller Vorfahre DR-TT – der gemeinsame Vorfahre von Thermus-Dinokokken Klasse TT – T. thermophilus DR- D. radiodurans. Die Gesamtzahl der COGs wird in Kästchen für jeden Knoten angezeigt. '+' zeigt den abgeleiteten Gengewinn (COG) an und '-' zeigt den abgeleiteten Verlust an.

Wir waren ferner daran interessiert, festzustellen, ob Ähnlichkeiten zwischen den Genrepertoires von TT und zwei tiefverzweigten bakteriellen Hyperthermophilen bestehen. Aquifex aeolicus (AA) und Thermotoga Maritima (TM). Wir fanden, dass Gene, die in TT, aber nicht in DR vorhanden sind, mit signifikant höherer Wahrscheinlichkeit in AA und TM vorhanden sind als Gene, die in DR, aber nicht in TT vorhanden sind (Tabelle 1). Im Gegensatz dazu waren von den 170 TT-Genen, von denen angenommen wurde, dass sie verloren gegangen sind, nur 20 sowohl in AA als auch in TM vorhanden. Somit weist das Genrepertoire von TT eine signifikant größere Ähnlichkeit mit hyperthermophilen Bakterien auf als das Genrepertoire von DR, möglicherweise resultierend aus direktem oder parallelem HGT (siehe auch unten).

Die Mehrheit der Gene, die TT und DR gemeinsam haben, kodieren für Haushaltsproteine ​​und sind in Bakterien weit verbreitet. Unter diesen sind 14 COGs insofern ungewöhnlich, als sie in keinem anderen Bakterium gefunden werden, sondern stattdessen von TT und DR mit Archaeen oder Eukaryoten geteilt werden. Dieses Set enthält 8 Untereinheiten der Archaealen/vakuolären H+-ATPase und sechs weitere COGs, die aus charakteristischen archaealen Genen bestehen (Phosphoglyceratmutase, COG3635 2-Phosphoglyceratkinase, COG2074 SAR1-like GTPase, COG1100 GTP:Adenosylcobinylamid-Phosphat, COG22 Vorhergesagtes Membranprotein, COG3374 Vorhergesagte DNA-Modifikationsmethylase, COG1041).

Wie bereits erwähnt, zeigten einige DR-Gene, die zu Familien gehören, die sowohl in Bakterien als auch in Archaeen gut vertreten sind, eine klare archaeale Affinität [42]. Um zu beurteilen, wie viele Gene scheinbar "thermophiler" Abstammung (entweder archaeal oder bakteriell) bereits im gemeinsamen DR-TT-Vorfahren vorhanden gewesen sein könnten, führten wir eine phylogenetische Analyse von Genen durch, die dem DR-TT-Vorfahren zugeordnet wurden und 3 von die 5 besten Treffer zu den Genen von Thermophilen (sowohl archaeal als auch bakteriell siehe Zusatzdatei 1: "Phylogenetische Analyse der Gene des rekonstruierten DR-TT gemeinsamen Vorfahren"). Wir fanden heraus, dass mindestens 122 Gene (

10% des vorhergesagten Genrepertoires des gemeinsamen DR-TT-Vorfahren) der ursprünglich ausgewählten 205 Gene zeigten eine Affinität zu thermophilen Spezies, dh entweder ein Zweig zweier orthologer Gene aus DR und TT oder ein DR- oder TT-Gen (in Fälle, in denen das entsprechende Orthologe offensichtlich in der anderen Abstammungslinie verloren ging) mit Thermophilen geclustert (siehe Zusatzdatei 1, Tabelle 1S und Zusatzdatei 6). Aufgrund der Tatsache, dass viele Baumtopologien durch mehrere HGT-Ereignisse stark gestört werden und aufgrund von Unterschieden in den Evolutionsraten zwischen den Abstammungslinien ungenau sein können, ist dies nur eine grobe Schätzung der Anzahl der "thermophilen" Gene im DR-TT-Vorfahren. Insbesondere kann nicht ausgeschlossen werden, dass einige der angestammten "thermophilen" Gene, die derzeit in TT, aber nicht in DR vorhanden sind (10 solcher Gene von 122 getesteten Genen), von TT über XGD erworben wurden (siehe Zusatzdatei 1 , Tabelle 1S). Zusammengenommen legen diese Beobachtungen die Möglichkeit von ökologischen Kontakten zwischen dem DR-TT-Vorfahren und hyperthermophilen Archaeen und/oder Bakterien nahe, was zu einem wesentlichen Erwerb von "thermophilen" Genen über HGT führt.

Gengewinn und -verlust in Therme

Unsere Rekonstruktion der evolutionären Ereignisse, die nach der Divergenz der TT- und DR-Linien vom gemeinsamen Vorfahren auftraten, skizzierte die Sätze von Genen, die wahrscheinlich von jeder Linie gewonnen und verloren wurden (Abbildung 4). Wir betrachten zunächst das Muster des Genverlusts und -gewinns bei TT genauer. Das Fehlen bestimmter Stoffwechselgene in TT führt zu Lücken in seinen Stoffwechselwegen, von denen einige essentiell sind. TT ist jedoch in der Lage, alle Aminosäuren, Nukleotide und einen Großteil der Cofaktoren zu synthetisieren, was darauf hindeutet, dass die Lücken durch analoge oder zumindest nicht-orthologe Enzyme gefüllt werden. Mehrere solcher Fälle wurden beschrieben. Beispielsweise codieren TT und DR nicht verwandte Thymidylat-Synthasen, DR2630 (COG0207) und TTC0731 (COG1351). Die klassische, Folat-abhängige Thymidylat-Synthase (COG0207), die in DR vorhanden ist, ist wahrscheinlich in Bakterien angestammt und wurde anscheinend über HGT in der verdrängt Therme Abstammung durch die Flavin-abhängige Thymidylat-Synthase, die typisch für Archaeen und bakterielle Thermophile ist. In anderen Fällen bleiben die substituierten analogen Enzyme oder Wege uncharakterisiert. So korreliert die Verdrängung der Folat-abhängigen Thymidylat-Synthase durch den Flavin-abhängigen Typ in der TT-Linie und in anderen Bakterien und Archaeen mit dem scheinbaren Verlust der Dihydrofolat-Reduktase (folA, COG0262), die den letzten Schritt des Tetrahydrofolats katalysiert Biosyntheseweg. Da Tetrahydrofolat ein essentieller Cofaktor ist, erscheint eine Verdrängung am wahrscheinlichsten. Kürzlich wurde gezeigt, dass das halobakterielle FolP-FolC-Fusionsprotein a Haloferax volcanii folA Mutante [43]. Somit erscheint es wahrscheinlich, dass FolC und FolP in TT und anderen Organismen die Aktivität von FolA ergänzen, obwohl die Existenz einer nicht verwandten, noch nicht charakterisierten Dihydrofolatreduktase nicht ausgeschlossen werden kann.

Darüber hinaus kodiert TT nicht zwei Enzyme für die Pyridoxalphosphat-Biosynthese (pdxK, COG0259 und pdxH, COG2240), während DR einen vollständigen Satz von Enzymen dieses Stoffwechselwegs besitzt. Das legen unsere Rekonstruktionen nahe pdxK ging wahrscheinlich in der TT-Linie verloren, während DR wahrscheinlich unabhängig erworben wurde pdxH. Es ist jedoch wahrscheinlich, dass der Weg in beiden Organismen funktionsfähig ist. Da ähnliche Lücken in der Pyridoxalphosphat-Biosynthese bei einer Vielzahl von Prokaryonten beobachtet werden [44], scheint es, dass zumindest für einige Schritte dieses Stoffwechselwegs eine Reihe unterschiedlicher Enzyme existiert, die nicht identifiziert werden.

Einige Systeme gingen anscheinend in der TT-Linie vollständig verloren. Dazu gehören der Urease-Komplex, der Ramnose-Stoffwechselweg, Acyl-CoA:Acetat/3-Ketosäure-CoA-Transferase, Fruktosetransport und -verwertung sowie der Glycerinstoffwechsel. Bemerkenswerterweise fehlen die meisten dieser Systeme auch in thermophilen Bakterien und vielen thermophilen Archaeen.

Im Gegensatz zu DR zeigen die Gene, die bei TT scheinbar erworben wurden, einen klaren Zusammenhang mit der thermophilen Lebensweise. Insbesondere scheint TT 23 Genfamilien aus dem Satz mutmaßlicher thermophiler Determinanten erworben zu haben [17], während der gemeinsame DR-TT-Vorfahre 5 Gene aus der Liste hatte und DR nur eines erworben zu haben scheint (siehe Zusätzliche Datei 3) . Die Mehrheit dieser Proteine ​​(17 von 31) wird im TT-Megaplasmid kodiert und 11 gehören zum vorhergesagten mobilen DNA-Reparatursystem, das für Thermophile charakteristisch ist [16, 45] (Abbildung 7A siehe Details unten). Darüber hinaus hat TT 4 "archaeale" Gene erworben, die in keinem der COGs zugeordneten Genome mesophiler Bakterien kodiert sind (Peptid Chain Release Factor 1, COG1503 DNA-Modifikationsmethylase, COG1041 und zwei Membranproteine, COG3462 und COG4645).

A. Organisation der Gene, die für das mutmaßliche thermophylespezifische DNA-Reparatursystem kodieren, in zwei Therme Stämme und das Draft-Genom von D. Geothermie. Die Kästchen oben in der Abbildung zeigen COG-Nummern. Gene werden durch Blockpfeile angezeigt, die die Transkriptionsrichtung angeben, und werden durch ihre systematischen Namen identifiziert. Für jede Spalte des Alignments werden die entsprechende COG-Nummer und die vorhergesagte Funktion angezeigt. D. Geothermie' Gene sind in beiden TT-Stämmen durch eine gerade Linie mit entsprechenden Orthologen verbunden. Im Allgemeinen werden orthologe Gene durch die gleiche Farbe und das gleiche Muster dargestellt. Ausnahmen bilden die RAMP-Proteine ​​der COGs 1336, 1367, 1604, 1337 und 1332, die alle rosa dargestellt sind. Andere, weiter entfernte RAMPs sind ebenfalls in rosa mit unterschiedlichen Mustern dargestellt [16]. Proteine, die nicht zu COGs gehören, aber Homologe in anderen Spezies haben, sind mit Rauten gekennzeichnet. Abkürzungen: HEL, Predicted Helicase, HD Nuklease – HD-konserviertes Motiv, das die vorhergesagte Nuklease-konservierte Region enthält POL – neuartige vorhergesagte Polymerase, RECB – vorhergesagte Nuklease der RecB-Familie B. Vergleich der Genorganisation im Bereich des für reverse Gyrase kodierenden Megaplasmids in zwei TT-Stämmen. Das kürzere Gyrase-Gen in HB27 weist auf eine Trunkierung hin. Abkürzungen: REVGYR, reverse Gyrase, MET_PR – vorhergesagte metallabhängige Protease REC_DNA – Drei-Domänen-Fusionsprotein (DnaQ-Endonuklease, DinG-Helikase und RecQ-Helikase).

Das Sox-ähnliche Schwefeloxidationssystem gehört zu der Gruppe von Genen, die anscheinend in der TT-Linie erworben wurden. Das TT-Sox-Operon ist teilweise dem in AA identifizierten ähnlich (siehe Zusätzliche Datei 1, Abbildung 2S) und könnte horizontal zwischen den AA- und TT-Linien mit nachfolgenden lokalen Umordnungen übertragen worden sein. Das Vorhandensein des Sox-Operons in TT legt nahe, dass dieses Bakterium reduzierte Schwefelverbindungen als Energie- und Schwefelquelle verwenden kann. Ein weiteres wahrscheinlich durch TT erworbenes System ist die Lactoseverwertung (mindestens drei Proteine: LacZ, COG3250 GalK, COG0153 GalT, COG1085 GalA, COG3345). Dieses System ist auch in TM vorhanden, was darauf hinweist, dass Zucker von thermophilen Bakterien als Kohlenstoffquellen genutzt werden können.

Gengewinn und -verlust in Deinokokken

Die DR-Linie hat offenbar viel mehr Gene erworben als verloren (Abbildung 4). Die Mehrheit der durch DR verlorenen Gene kodieren Enzyme des Energiestoffwechsels und der Biosynthese von Cofaktoren. Ein Beispiel ist der Verlust der drei Untereinheiten der Pyruvat:Ferredoxin-Oxidoreduktase, einem von mehreren bekannten Systemen für die Pyruvat-Oxidation, eine Schlüsselreaktion des zentralen Stoffwechsels. Ein weiteres Beispiel für Genverlust bei DR sind die drei Untereinheiten der NAD/NADP-Transhydrogenase, die für die energieabhängige Reduktion von NADP+ verantwortlich ist [46]. Darüber hinaus verlor die DR-Linie vier Enzyme der NAD-Biosynthese und sechs Enzyme der Cobalamin-Biosynthese, und konsequenterweise ist DR für das Wachstum von einer exogenen NAD-Quelle abhängig [28, 47].

Eine auffällige Anzahl von Genen, die anscheinend von der DR-Linie erworben wurden, kodiert für Systeme des Proteinabbaus und des Aminosäurekatabolismus (z.B., Urease, DRA0311-DRA0319 und ein vorhergesagter Harnstofftransporter, DRA0320-DRA0324 Histidin-Abbausystem, DRA0147-DRA0150 Monoaminoxidase, DRA0274 Lysin-2,3-Aminomutase, DRA0027 Kynureninase und Tryptophan-2,3-Dioxygenase, DRA0338-DRA03 E, DR1070 und Carboxypeptidase C, DR0964 und D-Aminopeptidase, DR1843 (siehe zusätzliche Datei 4). Ein ähnlicher Trend wird für die Expansion mehrerer Proteinfamilien in DR beobachtet, wie z. B. sekretierte Subtilisin-ähnliche Proteasen (siehe unten). Darüber hinaus kann DR mit zwei Drei-Untereinheiten-Komplexen der aeroben Kohlenmonoxid-Dehydrogenase (DRA0231-DRA0233 und DRA0235-DRA0237) die Oxidation von CO durch dieses Enzym als Energiequelle verwenden, wie für einige Bakterien gezeigt [48]. Der Erwerb und die Erweiterung dieser Stoffwechselsysteme, zusammen mit dem Verlust bestimmter biosynthetischer Fähigkeiten, unterstützt die Möglichkeit, dass die metabolische Umstrukturierung die Resistenz gegen oxidativen Stress bei DR beeinflussen könnte, indem der Bedarf an energieabhängigen zellulären Aktivitäten verringert wird. Die Energieproduktion über die Atmungskette ist eine Hauptquelle für freie Radikale in der Zelle [49].

DR hat viel mehr Gene für Proteine, die am anorganischen Ionentransport und -metabolismus beteiligt sind als TT. Insbesondere hat DR den Na+/H+-Antiporter mit mehreren Untereinheiten (7 Gene), die K+-transportierende ATPase (3 Gene) und das FeoA/FeoB-Fe-Transportsystem erworben. Diese Fülle an Ionentransportsystemen könnte indirekt mit der Resistenz gegen oxidativen Stress durch die Regulierung der Membranionengradienten und der Mn/Fe-Homöostase (siehe oben) verbunden sein.

DR ist stärker abhängig als TT von Peptid-abgeleiteten Wachstumssubstraten [47] und hat eine komplexere Stressreaktionsschaltung. In Übereinstimmung damit sind die Signaltransduktionssysteme von DR, wie durch Genomanalyse vorhergesagt, erheblich ausgefeilter als die von TT. Insbesondere hat DR mindestens 33 COGs (15 wahrscheinlich erworben nach der Divergenz vom gemeinsamen Vorfahren mit TT) in Bezug auf Signalübertragungsfunktionen, die in TT nicht repräsentiert sind, im Vergleich zu 12 (5 erworben) solcher COGs in TT. Obwohl die meisten Signaltransduktionsdomänen von DR und TT geteilt werden, sind die Domänenarchitekturen der jeweiligen Multidomänenproteine ​​jedoch völlig unterschiedlich ([7] und KSM, unveröffentlichte Beobachtungen).

Unter den Genen, die anscheinend durch DR erworben wurden, kodieren zwei Multidomänenproteine, die unterschiedliche periplasmatische Liganden-bindende Sensordomänen enthalten (DRA0202, COG5278 und DR1174, COG3614). Ein weiteres Protein, DRA0204, enthält die CHASE3-Domäne [50] und befindet sich in einem vorhergesagten Operon mit Superoxiddismutase (DRA0202), was auf eine Funktion bei der oxidativen Stressreaktion hinweist. Das Protein DR0724 enthält die SARP-Domäne, die an Apoptose-bezogenen Signalwegen in Eukaryoten beteiligt ist [51], ihre Funktion in Bakterien ist jedoch unbekannt. Die Rollen der anderen Signaltransduktionsproteine ​​von DR sind noch weniger klar, mit der bemerkenswerten Ausnahme eines Phytochrom-ähnlichen Proteins (DRA0050), das anscheinend von DR aus einer bakteriellen Quelle erworben wurde und mit der UV-Resistenz in Verbindung gebracht wird [52].

Darüber hinaus hat DR viele Gene (25 COGs), die Systeme für die mikrobielle Abwehr codieren. TT hat nur 14 COGs in dieser Kategorie, von denen 13 mit DR geteilt werden. Mindestens 7 Gene für Restriktions-Modifikationssystem-Untereinheiten wurden spezifisch von der DR-Linie erworben, zusammen mit mehreren Antibiotika-Resistenzenzymen. Dieser Unterschied könnte mit den reduzierten metabolischen Fähigkeiten von DR zusammenhängen, die von nährstoffreichen Wachstumsbedingungen abhängig sind und möglicherweise mehr mikrobielle Spezies als TT treffen.

Die vorherige Analyse des DR-Genoms ergab 15 Gene, die anscheinend aus unerwarteten Quellen wie Eukaryoten und Viren horizontal übertragen wurden [7] nur zwei dieser 15 Gene sind in TT, dem austrocknungsbezogenen Protein der Ferritinfamilie, vorhanden und die Proteine ​​der Uma2-ähnlichen Familie (siehe Diskussion dieser Proteine ​​unten). Es wurde gezeigt, dass zwei mit der Austrocknung in Zusammenhang stehende Proteine ​​an der Austrocknung, aber nicht an der Strahlenresistenz beteiligt sind [53]. Bisher wurde keines dieser Gene experimentell mit einer Radioresistenz bei DR in Verbindung gebracht.

Identifizierung der xenologischen Genverdrängung durch phylogenetische Analyse

Es ist allgemein bekannt, dass HGT wichtige Beiträge zum Genrepertoire der meisten thermophilen Bakterien geleistet hat, was durch das Vorhandensein zahlreicher Gene mit unerwartet hoher Ähnlichkeit und/oder phylogenetischer Affinität zu Genen, die für hyperthermophile Archaeen typisch sind, unterstützt wird [56–60]. Diese Fälle umfassen sogar solche Proteine, die Orthologe in mesophilen Bakterien aufweisen, aber, wie durch phylogenetische Analysen gezeigt, eine klare Affinität zu Archaeen oder thermophilen Bakterien aus entfernten Bakterienlinien aufweisen, was auf XGD hinweist [57]. Um den Einfluss von HGT von Thermophilen, die zu XGD führen, auf die Evolution des Genrepertoires von TT zu untersuchen, haben wir die taxonomische Zugehörigkeit der Proteine ​​aus dem gemeinsamen Genkern von TT und DR bestimmt. Wir verwendeten die taxonomische Verteilung der besten Treffer in BLAST-Suchen zur vorläufigen Identifizierung von HGT-Kandidaten, gefolgt von einer detaillierten phylogenetischen Analyse ausgewählter Gene.

Wie erwartet, weist TT im Vergleich zu DR einen bemerkenswerten Überschuss in der Fraktion der besten Treffer auf thermophile Bakterien und Archaeen sowohl für Kern- als auch für Nicht-Kernproteine ​​auf (Abbildung 5A und siehe Zusätzliche Datei 5). Es wurde jedoch berichtet, dass der beste BLAST-Treffer die Phylogenie nicht immer genau widerspiegelt [61]. Insbesondere können Artefakte der Best-Hit-Analyse durch ähnliche Verzerrungen in der Aminosäurezusammensetzung von Proteinen in TT und anderen Thermophilen verursacht werden, wie zuvor gezeigt [62, 63]. Um diese Effekte systematisch zu bewerten, führten wir eine phylogenetische Analyse von 112 TT-Proteinen und 21 DR-Proteinen aus dem gemeinsamen Kern durch, die ihre jeweiligen besten Treffer bei Thermophilen hatten (siehe Zusätzliche Datei 7). Trotz der Tatsache, dass all diese Bäume für Familien gebaut wurden, in denen TT- und DR-Proteine ​​in der nicht-redundanten Proteinsequenzdatenbank (National Center for Biotechnology Information, NIH, Bethesda) keine gemeinsamen Best Hits waren, haben mehr als die Hälfte der Bäume (69 Bäume, 52%) fanden eine DR-TT-Klade, 39 davon gruppierten diese Klade mit Mesophilen und 30 mit Thermophilen (Abbildung 5B). Dennoch wurde bei dieser Analyse der Unterschied der evolutionären Muster von DR und TT deutlich: Für 18 TT-Proteine ​​und nur ein DR-Protein wurde eine zuverlässige Affinität zu Thermophilen nachgewiesen. Die ersteren Fälle repräsentieren wahrscheinlich HGT in der TT-Linie von anderen Thermophilen, während das einzige "thermophile" Gen von DR die umgekehrte Richtung von HGT beinhalten kann, von der DR-Linie zu Thermoanaerobacter tencongiensis (Daten nicht gezeigt).

Taxonomische Affinitäten von TT- und DR-Proteinen. A. Verteilung der Anzahl der besten Treffer auf Proteine ​​von Thermophilen für Core- und Nicht-Core-Proteine ​​von DR und TT. B. Verteilung der phylogenetischen Affinitäten von Proteinen aus dem DR-TT-Kern, die am besten zu Proteinen von Thermophilen getroffen wurden.

Es ist bekannt, dass die Verzerrung der Aminosäurezusammensetzung nicht nur die Suche nach Sequenzähnlichkeiten beeinflusst, sondern auch die Rekonstruktion der Phylogenie [64]. Wir testeten diesen Effekt an unserem Datensatz, indem wir die sequenzbasierten Maximum-Likelihood-Bäume mit den Neighbor-Joining-Bäumen verglichen, die aus den Aminosäurefrequenzen der entsprechenden Proteine ​​rekonstruiert wurden (siehe Zusatzdatei 1, "Einfluss der Aminosäurezusammensetzung auf phylogenetische Rekonstruktionen"). Wir fanden, dass in den meisten Fällen (>80%) die Topologie des sequenzbasierten Baums nicht mit der des Aminosäurezusammensetzungsbaums übereinstimmte, daher ist die Wirkung der Aminosäurezusammensetzung auf den in Abbildung 5B gezeigten Abbau unwahrscheinlich, wesentlich zu sein. Zusammengenommen legen diese Ergebnisse nahe, dass XGD, das Gene von Thermophilen umfasst, einen messbaren Beitrag zur Evolution des Kerngensatzes von TT leistete, nachdem die Divergenz vom gemeinsamen DR-TT-Vorfahren im Fall von DR nicht nachgewiesen wurde. Während diese Interpretation angesichts der ökologischen Nähe von TT und anderen Thermophilen am plausibelsten erscheint, kann nicht ausgeschlossen werden, dass die beobachteten Muster (Abbildung 5B) teilweise durch XGD mit Genen mesophiler Bakterien der DR-Linie erklärt werden. Allgemeiner betonen diese Ergebnisse, dass die taxonomische Verteilung der besten Datenbanktreffer nur als grober und vorläufiger Indikator für HGT angesehen werden kann.

Unter den Fällen von potenzieller XGD, die durch phylogenetische Analyse unterstützt werden, gibt es zwei ribosomale Proteine, L30 und L15, die von benachbarten Genen innerhalb eines konservierten ribosomalen Operons kodiert werden. Die von umgebenden Genen in diesen Operons kodierten Proteine ​​zeigten eine klare Affinität zu den entsprechenden DR-Orthologen (Daten nicht gezeigt). In phylogenetischen Bäumen von L30 und L15 gruppierten sich die TT-Proteine ​​zuverlässig mit Orthologen von bakteriellen Hyperthermophilen und nicht mit den entsprechenden DR-Orthologen (Abbildung 6A und 6B). Die kongruenten evolutionären Muster dieser beiden ribosomalen Proteine, die von benachbarten Genen kodiert werden, legen nahe, dass dieses Genpaar durch XGD . ersetzt wurde vor Ort, ohne Unterbrechung der Operonorganisation [65]. Weitere Fälle von scheinbarer XGD, bei denen sich DR sicher in die mesophile Klade aufteilt, während TT zur thermophilen Klade gehört, sind in Abbildung 6C, D gezeigt (in jedem dieser Fälle enthält die thermophile Klade eine Beimischung mesophiler Spezies, während die mesophile Klade enthält keine Thermophile).

Phylogenetische Bäume für ausgewählte TT-Gene mit scheinbarer XGD, die ein Ortholog einer thermophilen Spezies beinhalten. Entwurzelte Bäume mit maximaler Wahrscheinlichkeit wurden konstruiert und Bootstrap-Wahrscheinlichkeiten wurden mit dem MOLPHY-Programm berechnet. Zweige mit Bootstrap-Wahrscheinlichkeit >70% werden durch schwarze Kreise markiert. Jedes Blatt wird mit dem Standard-Genidentifikator bezeichnet (für die vollständige Liste der Entsprechungen zwischen Genen und Arten siehe Zusatzdatei 1: "Genidentifikatoren und Artnamen für Abbildung 6"). Die DR- und TT-Gene sind eingerahmt. Gene thermophiler Spezies sind rot dargestellt. A. Ribosomales Protein L30. B. Ribosomales Protein L15. C. Thiamin-Biosyntheseprotein ThiC. D. tRNA-Thiolierungsenzym TtcA.

Das offensichtliche linienspezifische HGT in DR und TT war nicht auf XGD oder den Erwerb von Genen von Thermophilen beschränkt. Zusätzliche Beispiele für verschiedene Arten von HGT, die durch phylogenetische Analyse unterstützt werden, sind in Tabelle 2 aufgeführt.

Erweiterte Paralog-Familien

Die meisten Bakterienstämme enthalten einzigartige Sätze von erweiterten paralogen Genfamilien [66]. Diese Vorstellung wurde durch die vorliegende vergleichende Genomanalyse von DR und TT bestätigt. Keine der erweiterten Familien, die während der vorherigen detaillierten Analyse des DR-Genoms [7] entdeckt wurden, wurde in TT erweitert, und viele fehlten ganz.Dies deutet stark darauf hin, dass eine extensive Genduplikation und der Erwerb neuer Pseudoparaloge über HGT, die zur Erweiterung dieser Familien in DR führten, nach der Abweichung vom gemeinsamen Vorfahren mit TT auftrat und zu den spezifischen Anpassungen von DR beitragen könnte (Tabelle 3) . Im Zuge des vorliegenden Vergleichs mit TT wurde eine Erweiterung mehrerer anderer Familien in der DR aufgedeckt. Ein bemerkenswertes Beispiel ist die Familie der vorhergesagten membranassoziierten Proteine ​​(DR2080, DR1043, DR1952, DR1953, DR1738), die neben Transkriptionsregulatoren der PadR-ähnlichen Familie kodiert werden (COG1695 9 Paraloge in DR, keine in TT) (Tabelle 3). PadR-ähnliche Regulatoren sind an der Regulierung der zellulären Reaktion auf chemische Stressstoffe, Derivate der Phenolsäure, beteiligt [67]. Eine weitere bisher unbemerkte paraloge Familie, die in DR erweitert wird, umfasst Proteine, die die MOSC (MOCO Sulfurase C-terminal) Domäne (COG2258, vier Paraloge in DR und einer in TT) enthalten. Es wurde vorhergesagt, dass diese Proteine ​​als Schwefelträger fungieren, die Schwefel für die Bildung von Schwefel-Metall-Clustern liefern, die mit verschiedenen Enzymen assoziiert sind [68]. Eines dieser Gene (DR0273) bildet ein vorhergesagtes Operon mit Genen für eine Nudix-Hydrolase und eine Monooxygenase, was darauf hindeutet, dass diese Proteine ​​einen unterschiedlichen Stressreaktions-/Hausreinigungskomplex umfassen könnten.

Mehrere paraloge Familien werden in TT gezielt erweitert (Tabelle 4). Die größte davon (15 Paraloge im Vergleich zu drei in DR) ist die Uma2-Familie, die bei Cyanobakterien stark expandiert ist, aber ansonsten nur bei wenigen Bakterien zu sehen ist. Die Funktion(en) dieser Proteine ​​ist unbekannt, das Vorhandensein konservierter Säurereste legt nahe, dass es sich um uncharakterisierte DNA-bindende Proteine ​​handelt [69]. Die Ausdehnung der vorhergesagten Zuckertransporter in TT und der Mangel an extrazellulären Proteasen (einschließlich Subtilasen) ist unerwartet, da gezeigt wurde, dass TT eher ein proteolytischer als ein saccharolytischer Organismus ist [70]. Es sollte jedoch beachtet werden, dass im Gegensatz zu DR nicht beobachtet wurde, dass TT Proteasen sezerniert (Daten nicht gezeigt).

Bemerkenswerterweise gehören mehrere Proteinfamilien, die in TT expandiert sind, aber in DR fehlen, zum Satz potenzieller thermophiler Determinanten (HEPN-Nukleotid-Bindungsdomänen-vorhergesagte Phosphoesterasen, die mit dem Icc-Protein verwandt sind) [17] oder werden in thermophilen Archaeen expandiert (PIN-like Nukleasedomäne, minimale Nukleotidyltransferasen, UspA-ähnliche Nukleotidbindungsdomäne) [71], Tabelle 4). Insbesondere hat TT drei Paraloge der Archaea-spezifischen wolframhaltigen Aldehyd-Ferredoxin-Oxidoreduktase (TTC0012, TTC1834, TTP0122, TTP0212), die das erste Vorkommen dieses Enzyms in thermophilen Bakterien ist. Diese Enzyme sind jedoch in mehreren mesophilen Bakterien vorhanden und haben unterschiedliche Substratspezifitäten und könnten am Zucker-, Aminosäure- oder Schwefelstoffwechsel beteiligt sein [72, 73].

Vergleich von DNA-Reparatur- und Stressreaktionssystemen

Eine vergleichende Analyse der gut charakterisierten genetischen Systeme für Replikation, Reparatur und Rekombination und verwandte Funktionen in TT und DR zeigt, dass Fraktionen dieser Gene in den jeweiligen Genomen sehr ähnlich sind (Tabelle 5 siehe Zusatzdatei 1, Tabelle 2S, 3S). Die größten Unterschiede wurden bei den Proteinen beobachtet, die mit direkter Schadensumkehrung assoziiert sind (11 in TT vs. 26 in DR), was auf die außerordentliche Erweiterung der NUDIX (MutT-like) Hydrolasenfamilie in DR zurückzuführen ist [7]. Es sollte beachtet werden, dass die Mehrheit dieser Proteine ​​andere Substrate als 7,8-Dihydro-8-oxoguanin-triphosphat (oder Diphosphat) haben, das von MutT gespalten wird. Konsequenterweise scheint die Mehrheit der NUDIX-Proteine ​​eher "Hausreinigungs"-Enzyme zu sein als Bona Fide Komponenten von Reparatursystemen [74]. Andere bemerkenswerte Unterschiede umfassen den offensichtlichen Verlust des SOS-Antwort-Transkriptionsrepressors LexA [12] und eines anderen SOS-Antwort-Proteins, der Endonuklease VII (XseAB), in der TT-Linie scheinen diese Proteine ​​auch durch ein anderes thermophiles Bakterium, AA, verloren gegangen zu sein. Im Gegensatz dazu hat DR zwei LexA-Paraloge (DRA0344 und DRA0074), deren Funktionen jedoch unklar bleiben. Eine genetische Störung von DRA0344, dem Paralog, das eine größere Ähnlichkeit mit dem kanonischen bakteriellen LexA-Protein zeigt, führt nicht zu einer Empfindlichkeit gegenüber DNA-Schäden oder einer Beeinträchtigung der RecA-Expression [75]. Photolyase (PhrB) und Endonuklease IV (nfo) gehören zu den wenigen DNA-Reparaturproteinen, die wahrscheinlich von TT nach der Divergenz vom gemeinsamen Vorfahren mit DR erworben wurden. Darüber hinaus hat die katalytische Untereinheit der DNA-Polymerase III von TT (DnaE, ​​TTC1806) zwei inserierte Inteine, während die orthologe DR0507 keine hat. Im Allgemeinen scheinen die herkömmlichen DNA-Reparatursysteme von TT und DR eng miteinander und mit den jeweiligen Systemen anderer freilebender Bakterien verwandt zu sein. Somit erklären die einzigartigen, gemeinsamen Merkmale dieser Systeme nicht den sehr großen Unterschied, der in der Resistenz zwischen TT- und DR-Spezies beobachtet wurde.

Die Schlussfolgerung, dass es keine wichtigen Unterschiede zwischen den Reparatursystemen von TT und DR gibt, könnte jedoch verfrüht sein. Kürzlich wurden mehrere zusätzliche Proteine ​​von DR mit der DNA- oder RNA-Reparatur in Verbindung gebracht, entweder in direkten Experimenten oder auf der Basis einer Hochregulierung nach Bestrahlung, ergänzt durch Proteinsequenzanalyse. Zu diesen mutmaßlichen Reparaturenzymen gehören DRB0094, eine RNA-Ligase [76], die als Reaktion auf Bestrahlung stark hochreguliert wird [27] und möglicherweise an einem nicht charakterisierten RNA-Reparaturprozess beteiligt ist ein vorhergesagter Doppelstrangbruch-Reparaturkomplex, der spezifisch für die Erholung nach der Bestrahlung ist, bestehend aus DRB0100, einer DNA-Ligase, DRB0098, einem Protein, das eine Phosphatase der HD-Familie und Polynukleotidkinase-Domänen enthält [7] DRB0099, eine vorhergesagte Phosphatase der H2Macro-Superfamilie ([27] und KSM, unveröffentlichte Beobachtungen) eine doppelsträngige DNA- Bindungsprotein PprA (DRA0346), das die DNA-Endverbindungsreaktion stimuliert in vitro [77] ein vorhergesagtes DNA-Einzelstrang-Annealing-Protein DdrA (DR0423) [78] ein Regulator der Strahlungsantwort IrrE (DR0167) eine metallabhängige Protease, die an eine Helix-Turn-Helix-Domäne fusioniert ist [79, 80] und das uncharakterisierte Protein DR0070, das sich als essentiell für eine vollständige Resistenz gegenüber akuter Bestrahlung erwiesen hat [27]. Von diesen schlecht charakterisierten (vorhergesagten) Reparaturproteinen von DR hat nur DdrA ein Ortholog im TT-Genom. Im Allgemeinen sind diese mutmaßlichen Reparaturgene in Bakterien nur spärlich vertreten, und es scheint sehr unwahrscheinlich, dass sie im gemeinsamen Vorfahren von TT und DR vorhanden waren. Höchstwahrscheinlich wurden diese Gene von der DR-Linie über HGT nach der Divergenz vom gemeinsamen Vorfahren erworben mit TT und könnte zur Entwicklung des Resistenzphänotyps beigetragen haben. Die funktionelle Relevanz dieser Gene für die Strahlenresistenz muss jedoch noch bestätigt werden, da die meisten der entsprechenden Knockout-Mutanten nur eine relativ geringe bis moderate Abnahme der Strahlenresistenz zeigten [27, 78].

Unter den einzigartigen (vorhergesagten) Reparaturenzymen von TT sind die auffälligsten die Komponenten des mutmaßlichen thermophilen spezifischen Reparatursystems, die überwiegend auf dem TT-Megaplasmid kodiert werden (Abbildung 7A). Die funktionellen Merkmale der in diesem System kodierten Proteine ​​(COG1203, eine DNA-Helikase, oft fusioniert mit einer vorhergesagten Hydrolase der HD-Superfamilie COG1468, einer Exonuklease der RecB-Familie COG1353, vorhergesagte Polymerase) legen nahe, dass sie an einer noch nicht charakterisierten DNA-Reparatur beteiligt sind Weg. Es wurde die Hypothese aufgestellt, dass dieser neue Genkomplex funktionell analog zum bakteriell-eukaryotischen System der Transläsion, der mutagenen Reparatur, sein könnte, dessen zentrale Komponenten DNA-Polymerasen der UmuC-DinB-Rad30-Rev1-Superfamilie sind, die typischerweise bei Thermophilen fehlen [16] .

Der Vergleich von Proteinen, die verschiedene (vorhergesagte) Systeme umfassen, die an der Stressreaktion beteiligt sind, zeigt eine größere Anzahl und Diversität solcher Proteine ​​in DR, das 26 COGs mit relevanten Funktionen aufweist, die in TT nicht vertreten sind, im Vergleich zu 3 solcher COGs in TT (siehe Zusätzliche Datei 1 , Tabelle 4S). Insgesamt gibt es 147 Proteine ​​in DR in dieser Kategorie und 86 in TT, was darauf hindeutet, dass einige von ihnen in DR zusätzlich expandiert sind (siehe Abschnitt "Erweiterte Familien").

Enzymatische Abwehrsysteme gegen oxidativen Stress, die in TT und DR vorhergesagt wurden, zeigen ebenfalls wichtige Unterschiede. TT hat eine Mn-abhängige Superoxid-Dismutase (SodA) [81] und eine Mn-abhängige Katalase (ohne Ortholog in DR), während DR drei Superoxid-Dismutasen kodiert (eine davon ist das Ortholog des SodA-Gens von TT) und drei vorhergesagte Katalasen ohne TT-Orthologe [7]. Darüber hinaus hat DR eine Cytochrom-C-Peroxidase (DRA0301) und eine vorhergesagte eisenabhängige Peroxidase (DRA0145), Enzyme, die wahrscheinlich vor toxischen Peroxiden schützen [49]. Orthologe dieser Enzyme sind bei Bakterien selten, was darauf hindeutet, dass die Deinokokken Linie erwarb sie über HGT nach der Divergenz von TT und DR vom gemeinsamen Vorfahren. Die Reduktion oxidierter Methioninreste in Proteinen ist entscheidend für das Überleben von Zellen unter oxidativem Stress [82, 83]. In Übereinstimmung mit dieser Idee werden im DR-Genom zwei Peptid-Methioninsulfoxid-Reduktasen (PMSRs), MsrA (DR1849) und MsrB (DR1378) kodiert [84, 85], während in TT keine vorhanden sind. Interessanterweise fehlen auch beide PMSRs in Aquifex, Thermotoga und die meisten thermophilen Archaeen, was mindestens zwei Möglichkeiten nahelegt: Entweder ist diese Art von oxidativen Schäden bei hohen Temperaturen selten oder die bekannten PMSRs werden aufgrund der Ineffizienz ersterer bei hohen Temperaturen durch uncharakterisierte analoge Enzyme ersetzt.

Zu den Abwehrmechanismen gegen oxidativen Stress könnte auch die Kontrolle der Mn- und Fe-Verteilung in der Zelle gehören [29]. Proteine ​​der Dps/Ferritin-Familie werden für die Speicherung von Eisen in einem nicht reaktiven Zustand benötigt, der die eisenkatalysierte Bildung von Hydroxylradikalen verhindert und so die Zelle vor Eisentoxizität schützt (Fenton-Chemie) [86]. Zwei Dps-verwandte Proteine ​​sind im DR-Genom kodiert (DR2263, DRB0092, COG1528), und es wurde gezeigt, dass eines davon (DR2263) die DNA sowohl vor einer Spaltung durch Hydroxylradikale als auch vor einer DNase I-vermittelten Spaltung schützt [87]. Einige DPS-homologe Proteine ​​können DNA unspezifisch binden und werden daher als DNA-spezifische Protektoren angesehen [88]. Wie die meisten Thermophilen besitzt TT keine Proteine ​​dieser Familie, sondern kodiert ein Ferritin aus einer anderen Familie (TTC1122).

Da Austrocknung auch oxidativen Stress verursacht, gehören Proteine, die an der Austrocknungsresistenz beteiligt sind, zur allgemeinen Kategorie der zellulären Abwehr [89]. Austrocknungsbezogene Proteine ​​aus mindestens zwei verschiedenen Familien wurden in DR nachgewiesen [7]. Diese Familien der Austrocknungsresistenzproteine ​​(Lea 76-Familie, DR0105 und DR1172 und Lea14-Familie, DR1372) sind in TT nicht vertreten. Drei TT-Proteine ​​(TTP0170, TTP0166, TTP0169) sind jedoch Homologe eines anderen Austrocknungsresistenzproteins, das ursprünglich in einer Pflanze charakterisiert wurde, Craterostigma plantagineum [90] DR hat auch zwei Proteine ​​dieser Familie, DRB0118 und DRA0258. Diese Proteine ​​sind entfernt mit COG1633 verwandt und gehören zur Ferritin-Familie der Eisenspeicherproteine ​​(KSM, unveröffentlicht). Hochkonservierte Homologe dieser Proteine ​​sind auch in thermophilen Bakterien und Archaeen vorhanden. Zwei austrocknungsbezogene Proteine ​​(DR1172 und DRB0118) scheinen für die Austrocknungsresistenz, aber nicht für die Strahlenresistenz bei DR essentiell zu sein [53].

Vergleich der Genompartitionen von TT und DR

Sowohl TT als auch DR haben mehrteilige Genome. Um mögliche evolutionäre Beziehungen zwischen den Genompartitionen von TT und DR zu untersuchen, analysierten wir die Verteilung der symmetrischen besten Treffer (mutmaßliche Orthologe) im einzelnen extrachromosomalen Element von TT, dem pTT27-Megaplasmid, und den drei kleineren Genompartitionen von DR (small Chromosom, DR412 Megaplasmid, DR177 und Plasmid, CP1 Tabelle 6). Die Ergebnisse dieser Analyse zeigen, dass pTT27 einen hochsignifikanten Überschuss an Orthologen auf DR177 aufweist, was darauf hindeutet, dass diese beiden Megaplasmide homolog sind. d.h., wahrscheinlich aus einer bestimmten Genomaufteilung des gemeinsamen DR-TT-Vorfahren hervorgegangen. Offenbar haben die Genome der Megaplasmide jedoch seit der Abweichung vom gemeinsamen Vorfahren umfangreiche Umordnungen erfahren, da keine Erhaltung der Genordnung identifiziert werden konnte (Daten nicht gezeigt).

Unter den mutmaßlichen thermophilen Determinanten von TT,

50% sind auf dem Megaplasmid kodiert (18 von 36). Davon gehören 11 zum mutmaßlichen mobilen thermophilen-spezifischen DNA-Reparatursystem [16, 45] (Abbildung 7A). Darüber hinaus trägt das Megaplasmid mindestens vier weitere mit diesem System assoziierte Gene, die noch nicht COGs zugeordnet wurden (Abbildung 7A). Darüber hinaus trägt das TT-Megaplasmid auch ein Pseudogen für die reverse Gyrase, das auffälligste Signaturprotein von Hyperthermophilen [15, 17].

Vor kurzem wurde das Genom eines anderen TT-Stammes (HB8) vollständig sequenziert und in öffentlichen Datenbanken verfügbar gemacht [13]. Ein vorläufiger Vergleich der beiden TT-Stämme (HB27 und HB8) zeigte erhebliche Unterschiede in den Genordnungen und Inhalten der Megaplasmide (siehe Zusatzdatei 1, Abbildung 3S). Interessanterweise werden diese Unterschiede im Gengehalt hauptsächlich von Genen abgeleitet, die mit der thermophilen Lebensweise in Verbindung zu stehen scheinen. Insbesondere der Stamm HB8 kodiert für eine intakte reverse Gyrase. Somit scheint es am wahrscheinlichsten, dass das Gen für die reverse Gyrase von einer hyperthermophilen Quelle von der TT-Linie erworben wurde und in den gemeinsamen Vorfahren von HB27 und HB8 vorhanden war, aber in ersteren zerfallen war. Umgekehrt kodiert HB27 für ein einzigartiges Drei-Domänen-Fusionsprotein (DnaQ-Endonuklease, DinG-Helikase und RecQ-Helikase), während HB8 die DinG- und RecQ-Orthologe fehlen (Fig. 7B). Darüber hinaus gibt es unerwartete Unterschiede in der Organisation der vorhergesagten thermophilen spezifischen Reparatursysteme zwischen den beiden TT-Stämmen. Insbesondere enthält HB27 eine "grampositive Version" (TTP0132-TTP0136), wohingegen HB8 eine "proteobakterielle Version" dieser Gene (TTHB186-TTHB194) hat (Fig. 7A).

Darüber hinaus ist ein nahezu vollständiger Entwurf einer Genomsequenz von Deinococcus geothermalis (DG) ist seit kurzem öffentlich zugänglich [91]. Da DG eng mit DR verwandt ist, aber mäßig thermophil ist, haben wir nach "thermophilen" Genen im DG-Genom gesucht. Unter Verwendung der "thermophilen" Proteinsequenzen ([17] und siehe oben) von TT und DR als Abfragen identifizierten wir Orthologe von 5 der 6 DR-Proteine ​​aus diesem Satz (vier davon sind auch in beiden TT-Stämmen vorhanden) und Orthologe von 7 der verbleibenden 23 "thermophilen" Proteine ​​von TT (alle Komponenten des vorhergesagten thermophilen DNA-Reparatursystems). Diese 7 Proteine ​​hatten die jeweiligen TT-Proteine ​​als die besten Treffer, und ihre Monophylie wurde durch phylogenetische Analyse (Daten nicht gezeigt) gestützt, was darauf hindeutet, dass diese Gene bereits im Genom des gemeinsamen DR-TT-Vorfahren vorhanden waren.

Diese Beobachtungen führen zu zwei Hypothesen: (i) Das TT-Megaplasmid ist für das Überleben des Organismus bei hohen Temperaturen essentiell. In Übereinstimmung mit dieser Idee entdeckten wir eine Erweiterung eines Zweikomponenten-Toxin-Antitoxin-Systems, das aus einer PIN-ähnlichen Nuklease (Toxin) und einem Transkriptionsregulator der MazE-Familie (Antitoxin) besteht [69]. Es ist bekannt, dass ein solches System für die Segregationsstabilität von Antibiotikaresistenzplasmiden und anderen Plasmiden durch selektive Eliminierung von Zellen, die keine Plasmidkopie erhalten haben [92], und/oder Ausschluss konkurrierender Plasmide [93] und (ii) das TT-Megaplasmid ist ein dynamisches Genomkompartiment und eine wahre Senke für horizontal übertragene Gene, von denen einige den thermophilen Phänotyp dieses Bakteriums beeinflussen könnten. Dies ist kompatibel mit den beträchtlichen Unterschieden im Gengehalt, die zwischen den beiden TT-Stämmen beobachtet wurden.

Spezifische Rollen von Plasmid-getragenen Genen bei der Genesung von DNA-Schäden wurden bereits vorgeschlagen, einschließlich Klasse Ib-Ribonukleotid-Reduktase, periplasmatische alkalische Phosphatase und extrazelluläre Nuklease, und anschließende Analysen ergaben, dass mindestens fünf weitere Gene an diesem Prozess beteiligt sind (zwei Operons, DRB0098- DRB0100, DRB0094-DRB0084, siehe oben in „Vergleich von DNA-Reparatur- und Stressreaktionssystemen“) [27, 76]. Es gibt auch ein Toxin-Antitoxin-System-Operon im DR177-Megaplasmid (DRB0012a und ein weiteres Gen, das sich unmittelbar stromaufwärts von DRB0012a befindet und derzeit in der Genom-Annotation fehlt). Darüber hinaus gibt es fünf weitere Toxin-Antitoxin-Systeme, die auf DR412, dem kleineren Chromosom von DR, kodiert sind und mit der Aufrechterhaltung von DR177-Megaplasmid in DR zusammenhängen könnten. Das DR412-Chromosom scheint auch einige Besonderheiten aufzuweisen. Zahlreiche Gene, die offenbar von DR über HGT nach der Divergenz vom gemeinsamen Vorfahren mit TT erworben wurden und an verschiedenen Prozessen des Aminosäure- und Nukleotidabbaus beteiligt sind, kartieren auf diese Genompartition. Somit scheinen die Megaplasmide von TT und DR (und das kleinere Chromosom von DR, DR412) an einer ausgedehnten HGT beteiligt gewesen zu sein, die für die Evolution von Thermophilie und Radioresistenz wichtig gewesen sein könnte, obwohl die Repertoires der jeweiligen erworbenen Gene völlig unterschiedlich sind .


Physiologie und Biologie

Deinokokken sind resistent gegen raue Umgebungen

Deinococcus radiodurans weist eine beispiellose Resistenz gegenüber oxidativem Stress auf (Slade und Radman 2011 Misra et al. 2013). Oxidativer Stress kann durch reaktive Sauerstoffspezies verursacht werden, die durch Atmung, Bestrahlung oder chemische Einwirkungen produziert werden. Deinococcus radiodurans kann hohe Dosen ionisierender Strahlung (bis zu 2000 Doppelstrangbrüche pro Bakterie) ohne nennenswerte irreversible DNA- oder Proteinschäden überstehen und sein Chromosom mit hoher Genauigkeit wieder zusammensetzen. Die Resistenz dieses Bakteriums gegenüber diesen Belastungen beruht auf mehreren konvergierenden Mechanismen.

Zwei verschiedene Wege für die Aufnahme von Glukose, das Pentosephosphat und die Glykolyse, sind vorhanden und aktiv Deinokokken. Liedert et al. ( 2012 ) schlug vor, dass D. Geothermie wächst unter aeroben Bedingungen, indem es Glucose bevorzugt zum Pentosephosphatweg leitet, der im Allgemeinen an der Regeneration von NADPH und nicht von NADH beteiligt ist, in Übereinstimmung mit unseren Beobachtungen über exponentielles Wachstum D. Geothermie (Leonetti, J.-P., unveröffentlichte Ergebnisse). Der Pentosephosphatweg und das gebildete NADPH sind direkt an Reparaturmechanismen und der Resistenz gegen oxidativen Stress beteiligt (Juhnke et al. 1996 Rui et al. 2010). Die unzureichende Ausnutzung der Glykolyse kann ein Mittel sein, um die NADH-Bildung zu begrenzen und die Bildung reaktiver Sauerstoffspezies während seines Recyclings durch die Atmungskette zu vermeiden. Diese Eigenschaft ist ein Korolar des Widerstands von Deinokokken Strahlenbelastung und ist von erheblicher Bedeutung für die Biotechnologie, da NADPH von mehreren anabolen Stoffwechselwegen genutzt wird, wie Aminosäuresynthese (z. B. Arginin, Prolin, Isoleucin, Methionin und Lysin), Vitaminsynthese (z. B. Pantothenat, Phyllochinon und Tocopherol), Polyolsynthese (zB Xylit), Isoprenoidsynthese und Fettsäuresynthese. Darüber hinaus ist NADPH die Quelle von reduzierenden Äquivalenten für die Cytochrom-P450-Hydroxylierung von aromatischen Verbindungen, Steroiden, Alkoholen und Arzneimitteln. Die am häufigsten verwendeten Mikroorganismen in der Bioproduktion, wie z E coli und S. cerevisiae, produzieren hauptsächlich NADH und Deinokokken als bevorzugter Wirt zum Aufbau von NADPH-verbrauchenden Signalwegen verwendet werden könnte. Zuverlässige Stoffwechselmodelle von Deinokokken fehlen noch in der Literatur, was das Metabolic Engineering zeit- und arbeitsintensiver macht, wie bei den meisten neuen alternativen Chassis. Außerdem Deinokokken wurde noch nie in einem mit einer industriellen Anwendung kompatiblen Maßstab fermentiert.

Obwohl Deinokokken ist ein nicht sporenbildendes Bakterium, das extrem widerstandsfähig gegen Austrocknung ist. Mattimore und Battista (Mattimore und Battista 1996) haben das gezeigt D. radiodurans R1 kann 6 Wochen Austrocknung überleben, während die Lebensfähigkeit von E coli wurde nach nur 7 Tagen um sechs Logs reduziert. Es wird angenommen, dass Resistenz gegenüber ionisierender Strahlung und Austrocknung eng miteinander verbundene evolutionäre Prozesse sind, da Austrocknungsresistenz eine umfangreiche DNA-Reparatur zu erfordern scheint (Mattimore und Battista 1996). Deinokokken besitzt einen Syntheseweg für Trehalose aus Malto-Oligosacchariden (Timmins et al. 2005 ) und kann Trehalose produzieren (unveröffentlichte Ergebnisse), einen gemeinsamen Osmolyten. Die schützende Rolle dieses Osmolyten bei osmotischem Stress, Hitzeschock und Austrocknung wurde bei anderen Spezies (Purvis et al. 2005 et al. 2012). Das Überleben der Austrocknung ist ein wichtiges Thema bei der Herstellung von Starterkulturen für industrielle Anwendungen (Hofman und Thonart 2010).

Die Fähigkeit von Zellen, Stress zu tolerieren, ist in industriellen Umgebungen oft limitierend und multifaktoriell. Wang & et al. (Wang et al. 2012, 2013) fanden heraus, dass der Transkriptionsregulator irrE von D. radiodurans, wenn umgewandelt in E coli, verbesserte Toleranz gegenüber Ethanol, Butanol und Acetat (10-100-fach) und verlieh einer signifikanten Kreuztoleranz gegenüber zwei anderen gängigen Inhibitoren, die in Lignocellulosehydrolysaten gefunden werden, 5-Hydroxymethyl-2-furaldehyd und Vanillin. Die irrE Gen kodiert für einen allgemeinen Switch-Transkriptionsfaktor, der für die extreme Strahlenresistenz von D. radiodurans (Graf et al. 2002 ).

Deinokokken hat eine ungewöhnlich dicke Zellhülle

Deinokokken bildet oft Tetraden (Abb. 2a,c). Die meisten Bakterien können aufgrund des Vorhandenseins bzw. Fehlens einer dicken Zellwand (Fig. 2d) von Peptidoglycan, die den Farbstoff nach der Behandlung sequestriert, leicht als Gram-positiv oder Gram-negativ klassifiziert werden. Die Zellhülle von Deinokokken unterscheidet sich je nach Art und weist eine ungewöhnliche Struktur und Zusammensetzung auf. Deinococcus indicus, D. grandis und D. Wüste Stamm YIM 007 T-Färbung Gram-negativ, während die Mehrheit der anderen Deinokokken Arten färben Gram-positiv. Die Gram-positive Färbung vieler Deinokokken erinnert an die dicken Peptidoglycan-Schichten gramnegativer Bakterien, die schwer zu entfärben sind.

Wie von anderen bewertet (Makarova et al. 2001) wurden die folgenden sechs Schichten der Zellhülle durch Elektronenmikroskopie identifiziert: (i) Die innerste Schicht ist die allen Zellen gemeinsame Plasmamembran und besteht aus ungewöhnlichen Lipiden einschließlich Alkylaminketten. (ii) es folgt eine perforierte Peptidoglycan-Zellwand. (iii) die dritte Schicht ist einzigartig und kann aus einer Matrix winziger, nicht charakterisierter Kompartimente bestehen. (iv) die vierte Schicht ist eine weitere Plasmamembran und ist die äußere Membran. (v) die fünfte Schicht ist eine ausgeprägte elektroluzente Zone. (vi) die sechste Schicht besteht aus regelmäßig gepackten hexagonalen Proteinuntereinheiten (der S-Schicht oder hexagonal gepackten Zwischenschicht), die typisch für andere bakterielle S-Schichten ist. Mehrere Stämme von Deinokokken sind von einem dichten Kohlenhydratmantel umgeben.

Ob diese dicke ungewöhnliche Struktur direkt an der Resistenz gegen Xenobiotika beteiligt ist, ist unbekannt, aber D. Geothermie Es wurde berichtet, dass der Stamm T27 in Gegenwart hoher Konzentrationen von Ethylacetat, Toluol und Diethylphtalat überlebt, die als nichtwässrige Schicht einer Zellsuspension zugeführt werden (Kongpol et al. 2008 ).

Deinokokken bildet Biofilme

Deinococcus geothermalis bildet Biofilme (Abb. 2b). Diese Art kommt häufig auf Papiermaschinen vor (Väisänen et al. 1998 Kolari et al. 2001 ) und ist sehr schwer von Stahloberflächen zu entfernen. Deinococcus geothermalis Es wurde berichtet, dass E50051 nach 1 h Waschen mit 0,2% NaOH oder 0,5% Natriumdodecylsulfat im Gegensatz zu anderen Biofilmbildnern, wie z Burkholderia cepacia F28L1, Staphylococcus epidermidis O-47 und D. radiodurans Stamm DSM 20539. Die Befestigung von D. Geothermie beinhaltet fadenartige Strukturen, die mit der Maschinenoberfläche interagieren (Saarimaa et al. 2006). Pili-vermittelte Adhäsion ist bei mehreren gramnegativen und grampositiven pathogenen Bakterien üblich. Saarimaa et al. charakterisiert die Haftfäden von D. Geothermie als glykosylierte Typ-IV-Pili, die eng mit dem Typ-II-Proteinsekretionssystem verwandt sind (Sandkvist 2001 Peabody et al. 2003). Pili-Gene vom Typ IV homolog zu putativen pil Gene in D. radiodurans wurden auch in die natürliche Kompetenz von T. thermophilus HB27, ein naher Verwandter von Deinokokken, und bei der Sekretion diverser extrazellulärer Enzyme (Friedrich et al. 2002 ).

Bakterielle Biofilme können industrielle Prozesse beeinträchtigen oder verbessern. Sehr oft werden Biofilme als Defekt angesehen, da sie Schläuche verstopfen und Fermentationsprozesse beeinträchtigen können. Die Biofilmbildung kann jedoch von Vorteil sein, da sie zur Erhöhung der Biomassedichte in einem Reaktor verwendet werden kann, da sie nicht vom Zellrecycling abhängig ist, bei der wiederholten Fermentation keine erneute Beimpfung erforderlich ist und ein "Auswaschen" verhindert werden kann ' bei kontinuierlichen Verfahren mit hoher Verdünnungsrate. Darüber hinaus sind Biofilme oft widerstandsfähiger gegen extreme Bedingungen. Biofilmbildung ist nicht inhärent Deinokokken Familie oder sogar zu D. Geothermie.


Zugriff auf Dokument

  • APA
  • Autor
  • BIBTEX
  • Harvard
  • Standard
  • RIS
  • Vancouver

In: Genom-Ankündigungen, Bd. 3, Nr. 2, e00202-15, 2016.

Forschungsergebnis : Beitrag zu Zeitschrift › Artikel › peer-review

T1 - Entwurf der Genomsequenz des Deinococcus-Thermus-Bakteriums Meiothermus ruber Stamm A

N1 - Herausgeber Copyright: 2015 Thiel et al. Urheberrecht: Copyright 2018 Elsevier B.V., Alle Rechte vorbehalten.

N2 – Die Entwurfsgenomsequenz des Bakteriums der Deinococcus-Thermus-Gruppe Meiothermus ruber Stamm A, isoliert aus einer Cyanobakterien-Anreicherungskultur, die aus Octopus Spring (Yellowstone National Park, WY) gewonnen wurde, umfasst 2.968.099 bp in 170 Contigs. Es wird vorhergesagt, dass es 2.895 Protein-kodierende Gene, 44 tRNA-kodierende Gene und 2 rRNA-Operons enthält.

AB – Die Entwurfsgenomsequenz des Bakteriums der Deinococcus-Thermus-Gruppe Meiothermus ruber Stamm A, isoliert aus einer Cyanobakterien-Anreicherungskultur, die aus Octopus Spring (Yellowstone National Park, WY) gewonnen wurde, umfasst 2.968.099 bp in 170 Contigs. Es wird vorhergesagt, dass es 2.895 Protein-kodierende Gene, 44 tRNA-kodierende Gene und 2 rRNA-Operons enthält.


Verteilung von F- und A/V-Typ-ATPasen in Thermus scotoductus und anderen eng verwandten Arten

Das Vorhandensein einer ATPase vom A/V-Typ in verschiedenen Thermus-Arten und in den tiefer verzweigten Arten Meiothermus ruber und Deinococcus radiodurans legt nahe, dass das Vorkommen der ATPase vom Archaeen-Typ ein primitives Merkmal der Deinokokken ist, das durch horizontalen Gentransfer erworben wurde ( HGT). Bei zwei neu identifizierten Thermus-Spezies (Thermus scotoductus DSM 8553 und Thermus filiformis DSM 4687) wurde jedoch über das Vorkommen eines Bakterientyps F-ATPasen berichtet. Zwei verschiedene Szenarien können diesen Befund erklären, entweder der kürzliche Ersatz der angestammten A/V-Typ-ATPase in Thermus scotoductus und Thermus filiformis durch eine neu erworbene F-Typ-ATPase oder eine langfristige Persistenz der F- und A-Typ-ATPase im Deinokokken, was mehrere unabhängige Verluste der F-Typ-ATPase in den Deinokokken bedeuten würde. Durch PCR mit redundanten Primern, Sequenzierung und Southern-Blot-Analysen versuchten wir, das Vorhandensein einer F-Typ-ATPase im Genom von Thermus scotoductus und Thermus filiformis zu bestätigen und ihre phylogenetischen Affinitäten zu bestimmen. Anfängliche Experimente schienen das Vorhandensein einer F-Typ-ATPase in Thermus scotoductus zu bestätigen, die den in Bacillus gefundenen F-ATPasen ähnlich war. Weitere Experimente ergaben jedoch, dass der Nachweis einer F-ATPase auf eine Kulturkontamination zurückzuführen war. Bei allen untersuchten Thermus- und Deinococcus-Arten, einschließlich Thermus scotoductus, enthielten kontaminationsfreie Kulturen nur A/V-Typ-ATP-Synthasen.


8.12B: Deinococcus und Thermus - Biologie

Ther.ma.ce'ae. N.L. mask. n. Therme, Typusgattung der Familie L. suff. -gewächse, endend für eine Familie N.L. fem. pl. n. Thermaceae, das Therme Familie.

„Deinococcus–Thermus“ / Deinococci / Thermales / Thermaceae

Zellen sind gerade Stäbchen aus Filamenten variabler Länge, die ebenfalls vorhanden sind. Unbewegliche Geißeln sind nicht vorhanden. Gram-negativ färben. Endosporen werden nicht beobachtet. Die meisten Stämme bilden gelb- oder rotpigmentierte Kolonien, aber einige Stämme sind nicht pigmentiert. Thermophil oder leicht thermophil, mit einem optimalen Wachstumstemperaturbereich von etwa 45–75 °C. Einige Stämme sind leicht halophil. Chemoorganotroph Einige Stämme sind fakultative Chemolithoorganotrophe, die Schwefelverbindungen und molekularen Wasserstoff oxidieren. Aerob oder fakultativ anaerob mit strikt respiratorischem Stoffwechsel. Einige Stämme sind mikroaerophil einige Stämme wachsen anaerob mit Nitrat (NO3 − ), Nitrit (NO2 − ), Fe +3 und elementarer Schwefel (S) als terminale Elektronenakzeptoren. Andere Ionen wie Mn +4 , Co +3 , Cr +6 und U +6 werden ebenfalls durch einige Spannungen reduziert. Oxidase-positiv Die meisten Stämme sind Katalase-positiv. Menachinon 8 ist das vorherrschende respiratorische Chinon. Ornithin ist die wichtigste Diaminosäure von Peptidoglycan. Ein Hauptphospholipid ist in allen Stämmen vorhanden. Ein oder zwei Hauptglykolipide sind ebenfalls vorhanden. Phospholipide und Glykolipide basieren hauptsächlich auf Glycerin, aber einige Organismen besitzen auch Lipide auf 1,2-Diol-Basis. Fettsäuren sind überwiegend iso- und anteiso-verzweigt einige Stämme besitzen 3-Hydroxy-Fettsäuren und 2-Hydroxy-Fettsäuren. Die Familie Thermaceae stellt eine eindeutige Abstammungslinie innerhalb des Stammes „Deinococcus-Thermus“ dar und die Arten der Familie weisen Ähnlichkeiten der 16S-rRNA-Gensequenz im Bereich von 80,0–89,4% zu anderen Taxa im Stamm auf. Isoliert und nachgewiesen in terrestrischen und marinen hydrothermalen Gebieten mit neutralem bis alkalischem pH-Wert, die auch häufig aus künstlichen thermischen Umgebungen isoliert werden.

DNA G + C-Gehalt (mol%): 60.9–71.3 (T m oder HPLC).

Typgattung: Therme Brock und Freeze 1969, 295 AL . emend Nobre, Trüper und da Costa 1996, 605.


Cofaktoren

Leonardo Sorci, . Andrei L. Osterman , in Umfassende Naturprodukte II , 2010

7.08.3.1.1 Biosynthesewege

NaMN ist das häufigste Mononukleotid-Zwischenprodukt (ein Hub) in der NAD-Biogenese. Zum Beispiel in E coli alle drei Pyridinvorläufer werden in NaMN umgewandelt ( Tabelle 1 und Abbildung 3(a) ). Qa produziert von der de novo Asp-DHAP-Weg (Gene nadB und nadA) wird durch QAPRT in NaMN umgewandelt (Gen nadC). Die Bergung beider Formen von Niacin erfolgt über NAPRT (Gen pncB) entweder direkt bei oder nach Desamidierung durch NMDSE (Gen pncA). Insgesamt enthalten mehr als 90 % von etwa 680 analysierten Bakteriengenomen mindestens einen der Pfade, die zur Bildung von NaMN führen. Die meisten von ihnen (∼480 Genome) haben den gesamten Satz von nadBAC Gene für NaMN de novo Synthese aus Asp, die oft auf dem Chromosom geclustert sind und/oder von denselben Transkriptionsfaktoren koreguliert werden (siehe Abschnitt 7.08.3.1.2 ). Unter den Beispielen in Tabelle 1 , F. tularensis ( Abbildung 4(c) ) hat alle drei Gene davon de novo einen einzelnen Operon-ähnlichen Cluster bilden und das Wachstum dieses Organismus in Abwesenheit jeglicher Pyridin-Vorläufer im Medium unterstützen. Mehr als die Hälfte der Genome mit dem Asp-DHAP-Weg enthalten auch einen desamidierenden Niacin-Salvage-Weg (Gene pncAB) sowie viele Vertreter der α-, β- und -Proteobakterien-, Actinobakterien- und Bacillus/Clostridium-Gruppe. Wie bereits betont, bietet der genomische Rekonstruktionsansatz eine Einschätzung des metabolischen Potenzials eines Organismus, das unter gegebenen Bedingungen realisiert werden kann oder nicht. Zum Beispiel, E coli und B. subtilis kann beides nutzen de novo und PncAB Nm Bergungswege unter den gleichen Wachstumsbedingungen, während in M. tuberkulose (mit dem gleichen Genmuster) wurde letzterer Weg als nicht funktionsfähig angesehen, so dass der gesamte NAD-Pool von den de novo NadABC-Route. Eine kürzlich durchgeführte Studie zeigte jedoch die funktionelle Aktivität des Nm-Salvage-Pfads in vivo, unter hypoxischen Bedingungen in infizierten Makrophagen. 221 Diese Studie implizierte auch die beiden nachgeschalteten Enzyme der NAD-Synthese (NAMNAT und NADSYN) als attraktive chemotherapeutische Ziele zur Behandlung akuter und latenter Formen der Tuberkulose.

Bei etwa 100 Arten, darunter viele Cyanobakterien (z. Synechokokken spp.), Bacteroidetes (z. B. Chlorobium spp.) und Proteobakterien (z. B. Caulobacter crescentus, Zymomonas mobilis, Desulfovibrio spp., und Shewanella spp. die α-, β-, δ- bzw. γ-Gruppen darstellen) ist der Asp-DHAP-Weg der einzige Weg zur NAD-Biogenese. Darunter fast alle Helicobacter spp. (außer H. hepaticus), enthalten nur die beiden Gene nadA und nadC aber das erste Gen des Signalwegs fehlt (nadB), die wahrscheinlich Gegenstand eines nichtorthologen Genersatzes ist. Ein Fall von NadB (ASPOX)-Ersatz durch das ASPDH-Enzym in T. Maritima (und methanogene Archaeen) wurde in Abschnitt 7.08.2.1 diskutiert. Es konnten jedoch keine Orthologe der etablierten ASPDH identifiziert werden Helicobacter spp. sowie bei etwa 15 anderen diversen Bakterienarten, die die nadAC aber fehlt die nadB Gen (z. B. alle analysierten Corynebakterium spp. ausser für C. diphtherie). Daher ist die Identität des ASPOX- oder ASPDH-Enzyms bei diesen Spezies noch unbekannt, was einen der wenigen verbleibenden Fälle von „lokal fehlenden Genen“ 220 im NAD-Subsystem darstellt. Alle anderen Bakterienarten enthalten entweder beide nadA und nadB Gene (plus nadC) oder keine.

Bei einer begrenzten Anzahl von Bakterien (∼20 Spezies), meist in den beiden entfernten Gruppen Xanthomonadales (innerhalb von γ-Proteobakterien) und Flavobacteriales (innerhalb von Bacteroidetes), wird der Asp-DHAP-Weg der Qa-Synthese durch den Kyn-Weg ersetzt. Wie in Abschnitt 7.08.2.1.2 beschrieben, sind vier von fünf Enzymen (TRDOX, KYNOX, KYNSE und HADOX) in der bakteriellen Version dieses Stoffwechselwegs enge Homologe der jeweiligen eukaryontischen Enzyme, während das KYNFA-Gen Gegenstand mehrerer nicht orthologer Ersatz. Obwohl die Identität einer alternativen Form von KYNFA (Gen kynB) wurde in einer Gruppe von Bakterien etabliert, die einen partiellen Kyn-Weg für den Trp-Abbau zu Anthranilat haben (z. B. in P. aeruginosa oder B. cereus 57 ), ist keines der bekannten KYNFA-Homologe in Xanthomonadales oder Flavobacteriales vorhanden. Bei einigen Arten (z. Salinispora spp.) tritt ein vollständiger Gensatz der Gene des Kyn-Wegs zusammen mit einem vollständigen Asp-DHAP-Weg auf. Inwieweit und unter welchen Bedingungen diese beiden Wege zur Qa-Bildung beitragen, wären weitere Experimente erforderlich. Wie besprochen wird das QAPRT-Enzym von beiden geteilt de novo Signalwege und ein entsprechendes Gen, nadC findet sich immer in den Genomen, die den einen oder anderen Weg enthalten. Ebenso Gen nadC tritt immer zusammen mit Qa . auf de novo biosynthetische Gene mit einer bemerkenswerten Ausnahme von zwei Gruppen von Streptokokken, S. pneumonie und S. pyogenes. Obwohl allen anderen Mitgliedern der Lactobacillales-Gruppe ebenfalls das Qa . fehlt de novo biosynthetische Maschinerie und verlassen sich ausschließlich auf die Gewinnung von Niacin, nur diese beiden menschlichen Krankheitserreger enthalten a nadC Gen. Die funktionelle Bedeutung dieses aus dem Kontext gerissenen Gens ist unbekannt, aber es ist verlockend zu spekulieren, dass es an einem noch unbekannten Weg der Qa-Bergung aus dem menschlichen Wirt beteiligt sein könnte.

Unter etwa 150 Bakterienarten, denen es fehlt de novo Biosynthesegene und beruhen auf der desamidierenden Bergung von Niacin (über NAPRT), die Mehrheit (∼100) stammt aus der Gruppe der Firmicutes. Eine solche Funktionsvariante (dargestellt für Staphylococcus aureus in Abbildung 4(b) ) ist charakteristisch für viele bakterielle Krankheitserreger, sowohl grampositive als auch gramnegative (z. Brucella, Bordetella, und Campylobacter spp. aus α-, β- und δ-Proteobakterien, Borrelien, und Treponema spp. von Spirochäten). Die meisten Genome dieser Gruppe enthalten beides pncA und pncB Gene, die oft auf dem Chromosom geclustert und/oder koreguliert sind (siehe Abschnitt 7.08.3.1.2 ). In einigen Fällen (z. B. innerhalb von Mollicutes und Spirochaetales) werden nur die pncB, aber nicht die pncA Gen, zuverlässig identifiziert werden kann, was darauf hindeutet, dass eine dieser Spezies nur die desamidierte Form von Niacin (Na) verwenden kann oder dass einige von ihnen eine alternative (noch unbekannte) NMASE enthalten.

Obwohl die nicht-desamidierende Umwandlung von Nm in NMN (über NMPRT) bei etwa 50 Bakterienarten (hauptsächlich in β- und γ-Proteobakterien) vorhanden zu sein scheint, ist dies in diesen Organismen kaum jemals der einzige Weg der NAD-Biogenese. Die einzige mögliche Ausnahme ist in Mycoplasma genitalium und M. pneumoniae die enthalten die nadV Gen als einziger Bestandteil der Pyridinmononukleotid-Biosynthesemaschinerie. Bei einigen Arten (z. B. in Synechozysten spp.) ist die NMPRT-NMNAT-Route in erster Linie der Wiederverwertung von endogenen Nm gewidmet. Auf der anderen Seite in F. tularensis ( Abbildung 4(c) ), NMPRT (Gen nadV) zusammen mit NMNAT (der nadM Familie) bilden den funktionellen nicht-desamidierenden Nm-Salvage-Weg, da er das Wachstum der nadE′-Mutante auf Nm aber nicht auf Na (L. Sorci et al., unveröffentlicht). Ein ähnlicher nicht-desamidierender Nm-Salvage-Pfad, der von NMPRT und NMNAT (der nadR Familie) kommt in einigen (aber nicht allen) Arten von Pasteurellaceae zusätzlich zum (aber nie anstelle) des RNm-Salvage-Wegs (siehe unten) vor, wie ursprünglich für H. ducreyi. 128

Eine zweistufige Umwandlung von NaMN in NAD über ein NaAD-Zwischenprodukt (Route I in Figur 2 ) ist in der überwiegenden Mehrheit der Bakterien vorhanden. Das charakteristische Enzym der Route I, NAMNAT der NadD-Familie, ist in fast allen etwa 650 Bakterienarten vorhanden, von denen erwartet wird, dass sie NaMN über de novo oder Bergungswege (wie veranschaulicht durch Abbildungen 3(a) und 3(b) ). Alle diese Arten enthalten ausnahmslos auch NADSYN (entweder als Kurz- oder Langform des nadE Gen), das für diesen Weg benötigt wird. Die Arten, denen die NadD/NadE-Signatur fehlt, repräsentieren mehrere relativ seltene funktionelle Varianten, darunter:

Route I der NAD-Synthese (NaMNNaADNAD) Variante über ein bifunktionelles NAMNAT/NMNAT-Enzym der NadM-Familie ist bei Archaeen üblich (siehe Abschnitt 7.08.3.2 ), scheint aber nur in einer Handvoll Bakterien vorhanden zu sein, wie z Acinetobacter, Deinokokken , und Therme Gruppen. Ein weiteres ungewöhnliches Merkmal der beiden letztgenannten Gruppen ist das Fehlen des klassischen NADKIN, ein wahrscheinlicher Gegenstand eines nicht orthologen Ersatzes, der noch geklärt werden muss.

Route II der NAD-Synthese (NaMNNMNNAD). Diese Route wird durch eine Kombination der NMNAT der NadM-Familie (wie in F. tularensis) oder die NadR-Familie (wie in M. succinoproducens und A. succinogenes) mit NMNSYN der NadE′-Familie. Der Fall von F. tularensis in Abschnitt 7.08.2.4 beschrieben ist in Abbildung 3(b) . Der Rest der NAD-Biosynthesemaschinerie in beiden Arten aus der Pasteurellaceae-Gruppe, jenseits der gemeinsamen Route II, unterscheidet sich bemerkenswert von der in F. tularensis. Anstatt von de novo Biosynthese, beherbergen sie einen Na-Salvage-Weg über NAPRT, kodiert durch a pncB Gen, das in einem chromosomalen Cluster mit nadE. Keines dieser beiden Gene ist in anderen Pasteurellaceae vorhanden, denen die Amidierungsmaschinerie von Pyridincarboxylat fehlt (siehe unten).

Bergung von RNm (RNmNMNNAD). Eine genomische Signatur dieses Weges, eine Kombination aus dem PnuC-ähnlichen Transporter und einem bifunktionellen NMNAT/RNMKIN der NadR-Familie, ist in vielen Enterobacteriaceae und in mehreren anderen unterschiedlichen Arten (z. B. in M. tuberkulose). Allerdings in H. Influenzae ( Abbildung 3(d) ) und verwandten Mitgliedern der Pasteurellaceae, ist es der einzige Weg der NAD-Biogenese. Wie gezeigt in Tabelle 1 , H. Influenzae sowie viele andere Mitglieder dieser Gruppe haben fast alle Komponenten der reichhaltigen NAD-Biosynthesemaschinerie verloren, die in ihren engen phylogenetischen Nachbarn vorhanden sind (wie z E coli und viele andere Enterobacteriaceae). Dieser Weg ist ein ultimativer Weg zur Nutzung der sogenannten V-Faktoren (NADP, NAD, NMN oder RNm), die erforderlich sind, um das Wachstum von H. Influenzae. Es wurde festgestellt, dass alle anderen V-Faktoren durch eine Kombination von periplasmatischen und membranassoziierten hydrolytischen Enzymen zu RNm abgebaut werden. 222 Obwohl PnuC anfangs als NMN-Transporter galt, 223 wurde in seiner jüngsten detaillierten Analyse in beiden H. influenzae und Salmonellen bestätigten, dass seine tatsächliche physiologische Funktion in der Aufnahme von RNm in Verbindung mit der Phosphorylierung von RNM zu NMN durch RNMKIN liegt. 17.148.224 Wie bereits erwähnt, H. ducreyi und mehrere andere V-Faktor-unabhängige Mitglieder der Pasteurellaceae-Gruppe (H. somnus, Actinobacillus pleuropneumoniae, und Actinomycetemcomitans) beherbergen das NMNAT-Enzym (NadV), das es ihnen ermöglicht, in Gegenwart von Nm (aber nicht Na) im Medium zu wachsen (Abschnitt 7.08.2.2 ).

Aufnahme des intakten NAD. Mehrere Gruppen phylogenetisch entfernter intrazellulärer Endosymbionten mit extrem verkürzten Genomen enthalten nur ein einziges Enzym, NADKIN, aus dem gesamten Subsystem. Darunter sind alle analysierten Arten der Wolbachia, Rickettsien, und Blochmannia Gruppen. Von diesen Arten wird erwartet, dass sie das intakte NAD von ihrem Wirt aufnehmen und verwerten, während sie die Fähigkeit behalten, es in NADP umzuwandeln. Von allen analysierten Bakterien ist nur die Gruppe der Chlamydien hat kein NADKIN und ist auf die Bergung von NAD und NADP über ein einzigartiges Aufnahmesystem angewiesen. 157

Eine umfassende genomische Rekonstruktion des metabolischen Potenzials (Genannotationen und behauptete Pfade) über etwa 680 verschiedene Bakteriengenome hinweg schafft die Voraussetzungen für die genaue genomübergreifende Projektion und Vorhersage von Regulationsmechanismen, die die Realisierung dieses Potenzials in einer Vielzahl von Arten und Wachstum steuern Bedingungen. Im nächsten Abschnitt fassen wir die jüngsten Errungenschaften bei der genomischen Rekonstruktion von NAD-bezogenen Regulonen in Bakterien zusammen.


Methoden

Bakterienstämme und Wachstumsbedingungen

D. Geothermie DSM 11302 und D. murrayi DSM 11303 wurde von der Deutschen Sammlung von Mikroorganismen und Zellkulturen (Braunschweig, Deutschland) bezogen. Sie wurden in 50 ml modifiziertem Luria-Bertani-Medium, pH 7,2, gezüchtet, das 1 g Pepton K, 1 g Hefeextrakt und 7,4 g Meersalz in 1000 ml destilliertem Wasser enthielt. D. Geothermie wurde 30 h bei 50°C gezüchtet und D. murrayi wurde 30 h bei 47°C gezüchtet. Anschließend wurde genomische DNA mit Genomic Mini AX Bacteria (A&A Biotechnology, Polen) isoliert.

Klonen des D. geothermalis recA Gen

Die recA Gen wurde durch PCR mit genomischer DNA aus amplifiziert D. Geothermie DSM 11302 als Vorlage. Die verwendeten Primer waren: DGRAFNde 5' CGAKATZE ATG AGCAAGGAACAACCCCAAGGA 3', mit Erkennungsstelle für Nde I Endonuklease (unterstrichen) und DGRARHnd 5' ACAAAGC TT EIN CTCTGCCAAGGCGGGC 3', mit Erkennungsstelle für Hin dIII-Endonuklease (unterstrichen). Die Start- und Stoppcodons sind fett gedruckt. Die Reaktionsmischung bestand aus 0,13 µg D. Geothermie DNA, 0,2 μM von jedem Primer, 200 μM von jedem dNTP, 2 mM MgSO4 und 1 HE von Delta3 DNA-Polymerase (DNA-Gdańsk, Polen) in 1 × PCR-Puffer (20 mM Tris-HCl pH 8,8, 10 mM KCl, 10 mM (NH4)2SO4, 0,1% Triton X-100). Die PCR-Reaktion wurde unter den folgenden Bedingungen durchgeführt: 95 °C – 2 min (95 °C – 1 min, 61 °C – 1 min, 72 °C – 1 min 30 Zyklen), 72 °C – 5 min. Das PCR-Produkt wurde in den pCR-Blunt-Vektor (Invitrogen, Carlsbad, Kalifornien, USA) kloniert und sequenziert. Das erhaltene pCR-Blunt-NdeI-Dge Das RecA-HindIII-Plasmid wurde dann mit verdaut Nde Ich und Hin dIII-Endonukleasen und das DNA-Fragment, das die recA Gen wurde in den pET-30 Ek/LIC Expressionsvektor (Novagen, Beeston, Nottingham, England) kloniert, der mit den gleichen Restriktionsenzymen verdaut wurde. Das resultierende rekombinante Plasmid pET-30Ek/LIC-Dge RecA wurde für die Herstellung von D. Geothermie RecA-Protein in E coli.

Isolierung und Klonen der D. murrayi recA Gen

Um einen internen Teil der recA Gen von D. murrayi DSM 11303, Sequenzen, die RecA-Proteine ​​von Deinococcus geothermalis DSM 1300, D. geothemalis DSM 11302, Deinococcus radiodurans R1, Thermus aquaticus YT-1, Thermophilus HB8 und T. thermophilus HB27 aus der GenBank-Datenbank wurde mit dem ClustalX-Programm, Version 1.8, abgeglichen. Basierend auf dem Alignment wurden degenerierte Primer InvRecA1 5' GAGTCSGGSGGCAAAGACCAC 3' und InvRecA2 5' TCCTTSCCCTGGCCSAKGC 3' entworfen und synthetisiert. Die PCR-Reaktion wurde in der Mischung durchgeführt, die enthielt: 0,2 μM jedes Primers, 0,2 μg D. murrayi DSM 11303 genomische DNA, 200 μM von jedem dNTP, 3 mM MgCl2 und 1 U DNA-Polymerase Hypernova (DNA-Gdańsk, Polen) in 1 × Puffer Hypernova (10 mM Tris-HCl pH 8,8, 50 mM KCl, 0,15% Triton X-100). Die Reaktionsmischung wurde 2 min bei 95 °C inkubiert, gefolgt von 30 Zyklen bei 95 °C für 1 min, 59 °C für 1 min, 72 °C für 1 min und einer abschließenden Inkubation für 5 min bei 72 °C . Das erhaltene PCR-Produkt wurde dann von einer Agarosegel-Bande unter Verwendung des Gel-Out-Kits (A&A Biotechnology, Polen) gereinigt, in pJET1.2/blunt-Vektor CloneJET TM PCR Cloning Kit (Fermentas, Vilnius, Litauen) kloniert und sequenziert. Anschließend wurde die inverse PCR durchgeführt, um flankierende Regionen zu erhalten. Die D. murrayi genomische DNA wurde zuerst mit verdaut Dra I Restriktionsendonuklease und dann Restriktionsfragmente wurden an sich selbst ligiert, um Kreise zu bilden. Im zweiten Schritt wurde die PCR-Amplifikation unter Verwendung von Ligationsprodukten als Matrize und zwei Primern durchgeführt: recAInvFor 5' CCGCAAGATTGGGCAGCCCGTCAAGA 3' und recAInvRev 5' ACCCGACCGCACGAGCAGCTCCATG 3', entworfen auf Basis der zuvor erhaltenen Teilsequenz von D. murrayi recA Gen. Die Reaktionsmischung enthielt außerdem 200 μM von jedem dNTP, 3 mM MgCl2 und 1 U DNA-Polymerase Hypernova (DNA-Gdańsk, Polen) in 1 × Puffer Hypernova. Die DNA-Amplifikation wurde unter den folgenden Bedingungen durchgeführt: 95 °C – 3 min (95 °C – 1,5 min, 66 °C – 1 min, 72 °C – 5 min) 30 Zyklen und 72 °C – 15 min nach dem letzten Kreislauf. Das PCR-Produkt wurde von einer Agarosegel-Bande gereinigt, in pJET1.2/blunt-Vektor kloniert und sequenziert. Danach Fragmente von D. murrayi genomische DNA-Sequenz wurden Alignment und die vollständige Sequenz von recA Gen erhalten wurde.

Die D. murrayi DSM 11303 recA Gen wurde dann unter Verwendung des Vorwärtsprimers FDMRecANdeI 5' ATTA . amplifiziertKATZE ATG AGCAAGGACAACCCCAAGGACTTC 3' und der reverse Primer RDMRecAXhoI 5' TATTCTCGAG TTA CTCCGCGACAGCGGGCAC 3', enthält Nde Ich und Xho I Erkennungsstellen bzw. (unterstrichen). Die Start- und Stoppcodons sind fett gedruckt. Die PCR-Reaktionsmischung enthielt: 0,2 μM jedes Primers, 0,2 μg D. murrayi genomische DNA, 200 μM von jedem dNTP, 3 mM MgCl2 und 1 U DNA-Polymerase Hypernova (DNA-Gdańsk, Polen) in 1 × Hypernova Puffer. Die Reaktionsmischung wurde 3 min bei 96 °C inkubiert, gefolgt von 5 Zyklen bei 95 °C für 1 min, 58 °C für 1 min, 72 °C für 1 min und 25 Zyklen bei 95 °C für 1 min, 63 °C für 1 Minute, 72 °C für 1 Minute und eine letzte Inkubation für 5 Minuten bei 72 °C. Danach wurde das PCR-Produkt von einer Agarosegel-Bande gereinigt, in pJET1.2/blunt-Vektor kloniert und sequenziert. Das erhaltene pJET-NdeI-Dmu Das RecA-XhoI-Plasmid wurde dann mit verdaut Nde Ich und Xho I-Endonukleasen und das DNA-Fragment, das die recA Gen wurde in den pET-30 Ek/LIC Expressionsvektor (Novagen) kloniert, der mit den gleichen Restriktionsenzymen verdaut wurde. Das resultierende rekombinante Plasmid pET-30Ek/LIC-Dmu RecA wurde für die Herstellung von D. murrayi RecA-Protein in E coli.

Herstellung und Reinigung von rekombinantem Dge RecA und Dmu RecA-Proteine

Überproduktion von Dge RecA und Dmu RecA-Proteine ​​wurden in der E coli BLR(DE3)-Zellen (Novagen), die das pET-30Ek/LIC-Dge RecA oder PET-30Ek/LICDmu RecA-Plasmide. Die Zellen wurden bei 37 °C in 750 ml LB-Medium (1% Pepton K, 0,5% Hefeextrakt, 1% NaCl) mit 20 &mgr;g/ml Kanamycin gezüchtet. Bei OD600 0,5 IPTG wurde bis zur Endkonzentration von 1 mM zugegeben und die Kultivierung wurde 4 Stunden lang fortgesetzt. Anschließend wurden die Kulturen zentrifugiert (4612 × g, 10 min, 4°C) und die Pellets wurden in 75 ml Puffer A . resuspendiert1 (20 mM Kaliumphosphatpuffer pH 6,0, 50 mM KCl, 1 mM EDTA, 1 mM DTT) bei Dge RecA-Proteinproduktion oder Puffer A2 (20 mM Kaliumphosphatpuffer pH 6,5, 50 mM KCl, 1 mM EDTA, 1 mM DTT ) für die Dmu RecA. Die Proben wurden sieben Mal 30 s lang bei 0 °C beschallt und zentrifugiert (4612 × g, 10 Minuten, 4°C). Der Überstand enthält Dge RecA-Protein wurde 20 min bei 60 °C hitzebehandelt, auf Eis gekühlt und erneut zentrifugiert (18000 × g, 30 Minuten, 4°C).

Dge RecA und Dmu RecA-Proteine ​​wurden dann unter Verwendung einer Fractogel EMD DEAE-Säule (Merck, Darmstadt, Deutschland) gereinigt, die mit Puffer A&sub1; äquilibriert war1 oder ein2, bzw. RecA-Proteine ​​wurden mit einem linearen Gradienten von 0,05-1,5 M KCl in dem geeigneten Puffer eluiert. Fraktionen mit D. Geothermie oder D. murrayi RecA wurden gepoolt, gegen Puffer A . dialysiert1 oder ein2 und auf eine ResourceQ-Säule (Amersham Biosciences AB, Uppsala, Schweden) geladen. Die Elution wurde durch einen linearen Gradienten von 0,05–0,425 M KCl in Puffer A . durchgeführt1 oder ein2. Fraktionen, die RecA-Proteine ​​enthielten, wurden gegen Puffer A . dialysiert1 oder ein2 noch einmal und gereinigt unter Verwendung einer MonoQ-Säule (Amersham Biosciences AB). Dge RecA und Dmu RecA wurden mit einem linearen Gradienten von 0,05–0,35 M KCl in einem geeigneten Puffer eluiert. Gesammelte Fraktionen, die gereinigte RecA-Proteine ​​enthielten, wurden dann auf Nukleasenkontaminationen überprüft, indem sie mit M13mp18 RFI-DNA (24 μM Nukleotide), linearer dsDNA M13mp18 (24 μM Nukleotide) und zirkulärer ssDNA M13mp18 (12 μM Nukleotide) in 20 mM Kalium Phosphatpuffer pH 7,5 mit 10 mM MgCl2. Die Konzentration der RecA-Proteine ​​betrug 10 µM. Die Reaktionsmischungen wurden 2 h bei 37 °C inkubiert und dann wurden EDTA, SDS und Proteinase K bis zu den Endkonzentrationen von 10 mM, 1% bzw. 2 mg/ml zugegeben. Die Proben wurden 30 min bei Raumtemperatur inkubiert und durch Elektrophorese in 1% Agarosegelen mit Ethidiumbromid aufgetrennt. DNAs wurden auch nur mit Proteinase K als Kontrollprobe inkubiert. Weder in RecA-Proteinpräparationen noch in Proteinase K konnten wir eine Exo- oder Endonukleaseaktivität beobachten. Anschließend wurden die RecA-Proteine ​​gegen 100 mM (NH4)HCO3 und lyophilisiert für die Langzeitlagerung.

Die Reinheit der Proteine ​​wurde durch SDS-PAGE untersucht. Die Konzentration von RecA-Proteinen bei jedem Produktions- und Reinigungsschritt wurde nach der Bradford-Methode gemessen [54]. Die Proteinkonzentration in den Proben für biochemische Tests wurde bestimmt durch A280 nm unter Verwendung eines Extinktionskoeffizienten von 11.920 M -1 cm -1 , der aus den Aminosäuresequenzen von . berechnet wurde Dge RecA und Dmu RecA-Proteine.

Abschätzung der nativen Molekülmasse

Die Molekülmasse von Dge RecA und Dmu RecA-Proteine ​​wurden mittels analytischer Gelfiltrationschromatographie bestimmt. Proben, die verschiedene Konzentrationen gereinigter Proteine ​​enthielten, wurden auf eine Superdex 200 HR 10/30-Säule (Amersham Biosciences AB) geladen, die mit 25 mM Kaliumphosphatpuffer pH 7,5, der 1,0 M KCl enthielt, äquilibriert und mit demselben Puffer bei einer Flussrate von 0,5 ml/min eluiert wurde . Die Elutionsprofile wurden durch Aufzeichnen der Extinktion bei 214 nm überwacht. Die Molekulargewichte von Dge RecA und Dmu RecA-Oligomere wurden durch Vergleich mit denen von Standardproteinen bestimmt: Thyroglobulin (669 kDa), Apoferritin (443 kDa), β-Amylase (200 kDa), Alkoholdehydrogenase (150 kDa), Rinderserumalbumin (66 kDa) und Kohlensäureanhydrase ( 29kDa).

SsDNA-Bindungsaktivität

Die Fähigkeit von Dge RecA und Dmu RecA-Proteine ​​zur Bindung von ssDNA wurden durch elektrophoretische Mobilitätsverschiebung von Fluorescein 5'-endmarkiertem Oligo(dT) untersucht.35 Nukleotide. 25 µl Reaktionsmischungen enthaltend 5,6 µM (Nukleotide) Oligo(dT)35, 110 μM ATP-γ-S, 300 μM ATP, von 0 bis 10 mM MgCl2 und 9 µM RecA-Protein in 20 mM Kaliumphosphatpuffer pH 7,5 wurden bei 25-75°C für 30 min im Dunkeln inkubiert. Anschließend wurden die Proben durch Elektrophorese in 0,8% Agarosegelen aufgetrennt. Die Ergebnisse wurden unter Verwendung eines UV-Transilluminators visualisiert.

DsDNA-Bindungsaktivität

Die Fähigkeit von Dge RecA und Dmu RecA-Proteine, um dsDNA zu binden, wurde durch elektrophoretische Mobilitätsverschiebung von 600 bp PCR-Produkt (λ DNA, amplifiziert unter Verwendung von 5' GGACAAGGTCGCTGAAGCCTTCG 3' und 5' TCCTGACGGGCGGTATATTTCTCC 3' Primern) untersucht. 25 µl Reaktionsmischungen mit 30 µM (Nukleotide) dsDNA oder 30 µM dsDNA und 14 µM ssDNA (Fluorescein 5'-end-marked oligo(dT)35), 180 μM ATP-γ-S, 500 μM ATP, 0 oder 10 mM MgCl2 und 12 μM RecA-Protein in 20 mM Kaliumphosphatpuffer pH 7,5 wurden bei 37 °C für 30 min inkubiert. Anschließend wurden die Proben durch Elektrophorese in Ethidiumbromid enthaltenden 0,8% Agarosegelen aufgetrennt. Die Ergebnisse wurden unter Verwendung eines UV-Transilluminators visualisiert.

Thermostabilität der RecA-Proteine

Die Thermostabilität von Dge RecA und Dmu RecA wurde durch ssDNA-Bindungsaktivität nach Inkubation von Proteinen bei verschiedenen Temperaturen für eine Reihe von Zeiträumen bestimmt. Die Proben mit 11,8 μM RecA-Protein und 0 oder 10 mM MgCl2 in 20 mM Kaliumphosphatpuffer pH 7,5 wurden bei 50-80°C für 10 s bis 180 min inkubiert, auf Eis gekühlt und zentrifugiert (13500 × g, 10 Minuten). Anschließend wurden Aliquots (19 μl) entnommen und mit Fluorescein 5'-Ende markiertes Oligo(dT)35 Nukleotide, ATP, ATP-γ-S und MgCl2 wurden in den Konzentrationen 5,6 µM, 300 µM, 110 µM bzw. 10 mM im Endvolumen von 25 µl zugegeben. Anschließend wurden die Reaktionsmischungen bei 37 °C für 30 min im Dunkeln inkubiert und durch Elektrophorese in 0,8% Agarosegelen aufgetrennt. Die Ergebnisse wurden unter Verwendung eines UV-Transilluminators visualisiert.

ATPase-Assay

Hydrolyse von ATP (oder dATP) durch Dge RecA und Dmu RecA wurde durch ein enzymgekoppeltes Verfahren überwacht.Die durch Pyruvatkinase katalysierte Regeneration von ATP aus ADP und Phosphoenolpyruvat wurde mit der durch Lactatdehydrogenase katalysierten Umwandlung von NADH zu NAD + gekoppelt, die durch eine Abnahme der Absorption bei 355 nm verfolgt wurde. Die Extinktion wurde mit dem Multilabel-Plattenleser Victor 3 V von PerkinElmer (Exzellenzzentrum ChemBioFarm, Technische Universität Gdańsk, Gdańsk, Polen) gemessen.

Die Reaktionsmischungen bestanden aus: 3,03 μM RecA-Protein, 11,56 mM MgCl2, 1,25 U Lactatdehydrogenase aus Kaninchenmuskel, 0,75 U Pyruvatkinase aus Kaninchenmuskel, 3,3 mM NADH, 2,27 mM PEP, 0,38-2,27 mM ATP (oder dATP) und 20 mM Tris-HCl-Puffer pH 7,5 bis zum Endvolumen von 75 ul. Reaktionen wurden in Abwesenheit von DNA und in Gegenwart von 12,16 μM (Nukleotide) ssDNA von SygB1a-Oligonukleotid 5' CGTTCGAAACGATGAGGAAGACTTATTGGCTGATGGCGCTTTTCGCGGTGCTCATGTTCCCTGAAAAGTTCCTTTGGGGT 3' (80 nt) und/oder 1,312 μM (Nukleotide) durchgeführt Xba I-linearisierte dsDNA von pBADTOPOβAQa-Plasmid (5727 bp), die eine komplementäre Sequenz zum SygB1a-Oligonukleotid enthält. ATP (oder dATP) Hydrolysereaktionen wurden bei 32, 37, 42, 45 und 50 °C durchgeführt.

DNA-Strangaustauschreaktionen

RecA-abhängige DNA-Strangaustauschreaktionen wurden zwischen zirkulärer ssDNA von M13mp18 und linearer dsDNA von M13mp18 durchgeführt, die durch Sma Ich verdaue. Alle Reaktionen wurden in Lösungen durchgeführt, die 20 mM Tris-HCl-Puffer pH 7,5, 5 µM RecA-Protein, 9 µM (Nukleotide) ssDNA, 18 µM (Nukleotide) dsDNA, 0,3 µM . enthielten Dge SSB-Protein [44], 1,2 mM DTT, 10 mM MgCl2, 3 mM ATP und ein ATP-regenerierendes System (0,5 U Pyruvatkinase aus Kaninchenmuskel, 3 mM Phosphoenolpyruvat) in 25 µl. Eine Präinkubation von ssDNA mit Dge RecA bei 45°C oder mit Dmu RecA bei 42°C für 5 min wurde von der Zugabe von ATP oder dATP und SSB gefolgt. Nach weiteren 5 min Inkubation wurde lineare dsDNA zugegeben, um die Strangaustauschreaktionen zu starten. Die Reaktionen wurden bei 45 °C durchgeführt, wenn Dge RecA wurde verwendet oder bei 42 °C im Fall von Dmu RecA für 15, 30, 45, 60, 75 und 90 min und gestoppt durch Zugabe von EDTA, SDS und Proteinase K auf die Endkonzentrationen von 10 mM, 1% bzw. 2 mg/ml. Die Proben wurden 30-90 min bei Raumtemperatur inkubiert und dann durch Elektrophorese in 0,8% Agarosegelen aufgetrennt. Die Ergebnisse wurden visualisiert und mit UV-Licht unter Verwendung des VersaDoc™ Imaging Systems (Bio-Rad Laboratories, Hercules, Kalifornien, USA) nach Färbung der Gele mit Ethidiumbromid fotografiert. Die DNA-Banden wurden mit der Software Quantity One, Version 4.3.1 (Bio-Rad Laboratories) quantifiziert. Die Bande, die dem geknickten zirkulären dsDNA-Produkt entsprach, wurde als Fraktion der Gesamt-DNA in einer gegebenen Gelspur quantifiziert, wobei die Bande, die der ssDNA entsprach, ausgeschlossen wurde. Bei inversen DNA-Strangaustauschreaktionen wurden RecA-Proteine ​​mit der linearen dsDNA und ATP oder dATP für 15-60 min vorinkubiert. Die ssDNA wurde dann hinzugefügt, um die Reaktionen zu starten, und das SSB wurde 5 min später hinzugefügt.