Information

Wie kann ich die Reinheit von Zellen bestimmen, die aus Rattenhirnen isoliert wurden, wenn ich FACS, Immunhistochemie oder REM-Analyse nicht verwenden kann?

Wie kann ich die Reinheit von Zellen bestimmen, die aus Rattenhirnen isoliert wurden, wenn ich FACS, Immunhistochemie oder REM-Analyse nicht verwenden kann?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Bitte helfen Sie.

Ich weiß, wie man die verschiedenen Zellen (Astrozyten, andere Gliazellen, Neuronen und Synaptosomen) aus Hirngewebe mit einer Ficoll-basierten Trennung isolieren kann, aber wie bestimme ich die Reinheit der Fraktionen, die ich isoliert habe, wenn ich immunologische Techniken, FACS, nicht anwenden kann? oder REM-Analyse.


Sie können qPCR für bestimmte Marker aus dem Extrakt durchführen. GFAP für Astrozyten, Tuj1 für Neuronen, Myelin für Oligodendrozyten usw. und berechnen ihre Prozentsätze, um eine Schätzung der relativen Populationen zu erhalten. Wenn Sie mit der Mikroskopie und dem Studium dieser Zellen vertraut sind, können Sie die verschiedenen Zellpopulationen auch mit normaler Lichtmikroskopie identifizieren; dies ist nicht quantitativ und anfällig für Verzerrungen.


Eine Kombination aus drei umfunktionierten Medikamenten, die bei der Reperfusion als vielversprechende Therapie für postischämische Hirnverletzungen verabreicht werden

Eine zerebrale Ischämie führt zu einer vielfältigen Schädigung des Gehirns. Ein polytherapeutisches Arzneimittel, das unmittelbar nach der Reperfusion verabreicht werden kann, kann den Schutz des Gehirns erhöhen, indem es gleichzeitig auf mehrere schädliche Kaskaden abzielt. Diese Studie untersuchte die Wirksamkeit der Kombination von drei klinisch zugelassenen Arzneimitteln: Lamotrigin, Minocyclin und Lovastatin, unter Verwendung von zwei Mausmodellen: globale und fokale zerebrale Ischämie, die durch vorübergehenden Verschluss der Arteria carotis communis bzw. der Arteria cerebri media media induziert wird. In vitro schützte das Kombinationsmedikament, aber nicht das einzelne Medikament, Neuronen vor dem durch Sauerstoff-Glukose-Mangel (OGD) induzierten Zelltod. Das Kombinationspräparat zielte gleichzeitig auf Zellapoptose und durch Ischämie induzierte DNA-Schäden ab. Neben der Wirkung auf Neuronen unterdrückte das Kombinationsarzneimittel durch Ischämie induzierte Entzündungsprozesse in Mikroglia und Hirn-Endothelzellen. In einem transienten globalen Ischämiemodell unterdrückte das Kombinationsmedikament, aber nicht das einzelne Medikament, die Aktivierung von Mikroglia und die Produktion von entzündlichen Zytokinen und reduzierte neuronale Schäden. In einem Modell für vorübergehende fokale Ischämie schwächte das Kombinationsarzneimittel, aber nicht das Einzelarzneimittel, einen Hirninfarkt ab, unterdrückte die Infiltration peripherer Neutrophilen und reduzierte neurologische Defizite nach einem ischämischen Schlaganfall. Zusammenfassend lässt sich sagen, dass das Kombinationspräparat einen Breitbandschutz gegen Ischämie/Reperfusions-(I/R)-Schäden bietet und ein vielversprechender Ansatz für eine frühzeitige Neuroprotektion nach einem Herzstillstand außerhalb des Krankenhauses oder einem ischämischen Schlaganfall sein könnte.

Dies ist eine Vorschau von Abonnementinhalten, auf die Sie über Ihre Institution zugreifen können.


Einführung

Das humane Cytomegalovirus (HCMV) ist ein hochprävalentes Herpesvirus, das weltweit einen großen Teil der Menschen infiziert. Die Primärinfektion gesunder Personen verläuft in der Regel asymptomatisch, gefolgt von der Etablierung einer Latenz. Jedoch kann eine HCMV-Infektion oder -Reaktivierung bei immungeschwächten oder immunologisch unreifen Individuen zu einer schweren oder lebensbedrohlichen Erkrankung führen. Die angeborene HCMV-Infektion ist eine der führenden infektiösen Ursachen für langfristige neurologische Entwicklungsstörungen, einschließlich geistiger Behinderung und Innenohrschwerhörigkeit 1 . HCMV ist ein streng speziesspezifisches Virus, daher werden tierische Cytomegaloviren häufig verwendet, um die Immunbiologie und Pathogenese einer Infektion zu untersuchen. Die Infektion von Mäusen mit Maus-Cytomegalovirus (MCMV) ist das häufigste Modell der HCMV-Infektion 2 . Da MCMV die Plazenta nicht passiert, verwenden wir ein Modell der angeborenen Infektion, bei dem neugeborene Mäuse am 1. postnatalen Tag (PND 1) 3 intraperitoneal mit MCMV infiziert werden. Es ist erwähnenswert, dass das ZNS bei neugeborenen Mäusen in der 15. Schwangerschaftswoche entwicklungsmäßig dem menschlichen Fötus entspricht, einem Zeitraum, in dem die HCMV-Infektion beim Menschen am häufigsten während der Schwangerschaft erworben wird 4 . Bei einer MCMV-Infektion von neugeborenen Mäusen verbreitet sich das Virus in verschiedene Gewebe, einschließlich des Gehirns, wo die Infektion zu einer weit verbreiteten, fokalen, nicht-nekrotisierenden Enzephalitis führt 3 . Die ZNS-Pathologie bei infizierten neugeborenen Mäusen rekapituliert genau die Pathologie, die während der kongenitalen HCMV-Infektion auftritt, am deutlichsten in einer kleineren Kleinhirngröße und einer dickeren äußeren Körnerschicht 3, 5 . Darüber hinaus verursacht die Infektion einen Hörverlust, der mit einer Innenohrentzündung und dem Verlust von Spiralganglienneuronen verbunden ist 6 . Wir und andere haben gezeigt, dass eine MCMV-Infektion bei neugeborenen Mäusen eine starke Entzündungsreaktion im Gehirn auslöst, die durch die Aktivierung von Mikroglia, die Rekrutierung aktivierter peripherer Immunzellen und die Expression proinflammatorischer Zytokine gekennzeichnet ist 3, 4, 7 . Tatsächlich ist eher eine virusinduzierte Entzündung als die zytopathische Wirkung des Virus auf infizierte Zellen für neurologische Entwicklungsanomalien verantwortlich 7 . Die dominierende Population von Lymphozyten, die das Gehirn nach einer Infektion infiltrieren, sind CD8 + T-Zellen 8 . Wir haben zuvor gezeigt, dass CD8 + T-Zellen für die Kontrolle der MCMV-Infektion im Gehirn und für das Überleben neugeborener Mäuse nach einer Infektion essentiell sind 8 . Virus-spezifische CD8 + T-Zellen verbleiben im Gehirn auch nach Abklingen der produktiven Infektion 8-10 . Die Dynamik dieser Zellen und ihre Biologie sind jedoch noch wenig charakterisiert.

Gedächtnis CD8 + T-Zellen werden klassisch in zwei Gruppen eingeteilt: zentrales Gedächtnis (TCM) und Effektorspeicher (TEM). TCM zirkulieren zwischen den Lymphknoten und dem Blut und lassen bei Antigen-Wiederbegegnung die neuen Effektorzellen entstehen, während TEM zirkulieren zwischen lymphoidem und nicht-lymphoidem Gewebe und können bei Antigen-Begegnung unmittelbare Effektorfunktionen ausführen 11 . Eine neue Gruppe von Gedächtnis-CD8+-T-Zellen, geweberesidenten Gedächtnis-T-Zellen (TRM Zellen) wurde identifiziert, das einen überlegenen Schutz gegen lokale Sekundärinfektionen bietet 12 . Tatsächlich befindet sich die Mehrheit der Gedächtnis-T-Zellen in nicht-lymphoiden Geweben 13 . TRM Zellen sind durch die Expression der Oberflächenmarker CD69 und CD103 und unterschiedliche molekulare, funktionelle und metabolische Merkmale 12, 14-16 gekennzeichnet. Obwohl das ZNS als immunprivilegierter Ort gilt, wurden Infektionen des ZNS mit mehreren Viren mit der Infiltration von Lymphozyten und der Entwicklung von T . in Verbindung gebrachtRM Zellen 17. Dies ist besonders wichtig bei chronisch persistierenden Infektionen, die eine konstante Antigenversorgung bieten, die bereits geprimte Gedächtnis-T-Zellen stärken kann. Unter solchen Bedingungen muss ein empfindliches Gleichgewicht zwischen Viruskontrolle und Vermeidung von Hirnpathologien hergestellt werden.

Hier haben wir CD8 + T-Zellen charakterisiert, die im Gehirn von perinatal mit MCMV infizierten Mäusen persistieren. Wir zeigen, dass bei einer MCMV-Infektion neugeborener Mäuse virusspezifische CD8 + T-Zellen einen Pool von T . bildenRM Zellen, die lebenslang im Gehirn verbleiben. Adoptiv übertragene virusspezifische CD8 + T-Zellen bieten Schutz vor einer primären MCMV-Infektion, reduzieren die Pathologie des Gehirns und verbleiben als T . im GehirnRM Zellen. Wichtig ist, CD8 + TRM Zellen reagieren auf eine Herausforderung und verhindern die Reaktivierung des latenten Virus sowie die durch die Reaktivierung induzierte Pathologie.


Ergebnisse

Die systemische Verabreichung von Kaininsäure induziert Neurodegeneration, Entzündung und verzögerte Monozyteninfiltration.

Um zu bestimmen, ob zirkulierende CCR2-exprimierende Monozyten das Gehirn nach SE infiltrieren, wurden heterozygote Ccr2 +/rfp Mäusen wurde intraperitoneal Kochsalzlösung oder eine Einzeldosis Kainsäure (KA 30 mg/kg) injiziert. Der Schweregrad der Anfälle wurde alle 5 min für 5 h gemäß einer für KA modifizierten Racine-Skala aufgezeichnet (Abb. 1 .).E). Hirngewebe wurde histologisch auf Anzeichen von Hippocampus-Neuraldegeneration, Mikrogliose und Invasion von zirkulierenden Monozyten 1, 3 und 14 Tage nach der KA-Verabreichung untersucht. Im Vergleich zu mit Kochsalzlösung behandelten Tieren zeigten Mäuse, die in SE eintraten, eine starke Ausdünnung und Zerstörung der pyramidalen Zellschicht im CA3-Unterfeld des Hippocampus durch Kresylviolett-Färbung, was auf eine neuronale Degeneration zu den untersuchten Zeitpunkten hindeutet (Abb. 1EIN). Diese Daten bestätigen den gut erkannten CA3-Schaden nach systemischer KA (29, 30). Bei den mit Kochsalzlösung behandelten Mäusen waren Mikroglia, die das ionisierte Calcium-bindende Adaptermolekül 1 (Iba1) exprimieren, gleichmäßig im Hippocampus-Gewebe verteilt, wobei sich dünne, lange Fortsätze vom Zellsoma weg erstrecken. Im Gegensatz dazu zeigten die Iba1 + myeloischen Zellen, die bei Mäusen gefunden wurden, die in den SE eintraten, ein ganz anderes Muster, das aus einer zellulären Clusterung um die beschädigten Neuronen und einer Verkürzung und Verdickung ihrer Fortsätze zu jedem Zeitpunkt bestand (Abb. 1 .).EIN). Anti-Red-Fluoreszenz-Protein (RFP)-Färbung benachbarter Hirnschnitte zeigte eine beträchtliche Anzahl von CCR2-RFP-exprimierenden Monozyten im Hippocampus von SE-Mäusen 3 Tage nach SE, jedoch nicht in mit Kochsalzlösung behandelten Kontrollen oder in Tieren, die an der KA 1-d- und 14-d-Zeitpunkte (Abb. 1EIN).

Hippocampuszellverlust und Mikrogliose gehen der Infiltration von CCR2 + Monozyten voraus. Zwei Monate alte männliche CCR2-RFP-Mäuse erhielten intraperitoneale KA (30 mg/kg) oder Kochsalzlösungs-Kontrollinjektion und wurden 1, 3 oder 14 Tage später getötet. (EIN) Die mit KA behandelten Mäuse zeigten zu allen untersuchten Zeitpunkten einen neuronalen Zellverlust in der CA3-Hippocampus-Region. Dies wurde von einer Mikrogliose begleitet, die zum 3-D-Zeitpunkt robust war. Die Anti-RFP-Immunhistochemie zeigte isolierte CCR2-RFP + -Zellen zum 1- und 14-Tage-Zeitpunkt. Der 3-d-Zeitpunkt zeigte eine massive Infiltration von CCR2-RFP + Monozyten. In den mit Kochsalzlösung behandelten Tieren wurden wenige CCR2-RFP + -Zellen angetroffen. (Skala: 100 μm.) (B) Die stereologische Analyse der gesamten Hippocampus-Iba1+-Zellen zeigte einen mehr als dreifachen Anstieg zum 3- und 14-Tage-Zeitpunkt. 1 Tag nach der KA-Injektion kam es zu einer etwa zweifachen Zunahme (n = 5 für jede Bedingung Einweg-ANOVA, gefolgt von Dunnetts Post-hoc-Tests). (C) Die stereologische Analyse ergab ∼80.000 Monozyten zum 3-D-Zeitpunkt im Hippocampus. Eine ANOVA gefolgt von Tukeys Post-hoc-Tests zeigte einen signifikanten Unterschied der gesamten Hippocampus-CCR2-RFP + -Monozyten zwischen 1 Tag und 3 Tag sowie 3 Tag und 14 Tag (***P < 0,001 n = 5). (D) Die meisten CCR2-RFP-exprimierenden Zellen (rot) waren auch CD11b + (grüne Pfeile). Gelegentlich wurde eine CCR2-RFP + CD11b − -Zelle angetroffen (Pfeilspitze). Verzweigte CCR2-RFP – CD11b + Mikroglia wurden ebenfalls beobachtet (Sternchen). (Skala: 50 μm.) (E) Alle mit KA behandelten Mäuse zeigten einen Anfallsschwere-Score von mindestens 5.

Die stereologische Analyse von Iba1 + -Zellen im Hippocampus von mit Kochsalzlösung behandelten Kontrollmäusen zeigte ungefähr 4,7 × 10 4 Zellen. Einen Tag nach SE erhöhte sich die Zahl der Hippocampus-Iba1+-Zellen auf 8,8 × 10 4 Zellen und weiter auf 1,7 × 10 5 Zellen zu den Zeitpunkten 3 und 14 (Abb. 1 .).B). Wir fanden nur gelegentlich eine CCR2 + -Zelle zu den Zeitpunkten 1-d und 14-d. Im Gegensatz dazu wurden 3 d nach SE 8,0 × 10 4 CCR2 + Monozyten im Hippocampus gefunden (Abb. 1C). Somit gab es 3 Tage nach SE ungefähr die gleiche Anzahl von aktivierten Mikroglia und Monozyten im Hippocampus.

Um zu verifizieren, dass in das Gehirn eindringende CCR2-RFP + -Zellen Monozyten und keine Lymphozyten sind, wie T-Zellen oder natürliche Killerzellen, untersuchten wir die Expressionsmuster des myelomonozytären Markers CD11b. Wie erwartet waren CCR2-RFP-exprimierende Zellen überwiegend CD11b + , mit wenigen bis keinen Anhängseln, die sich vom Zellsoma aus erstreckten (Abb. 1D, Pfeile). CCR2-RFP + , CD11b − -Zellen, die wahrscheinlich T-Lymphozyten sind, wurden nur selten innerhalb des monozytären Infiltrats beobachtet (Abb. 1D, Pfeilspitze). Wie erwartet beobachteten wir auch CD11b + -Zellen mit stark verzweigter Morphologie, die durch zahlreiche kurze Fortsätze vom Zellsoma aus typisch ist und keine nachweisbare CCR2-RFP-Expression zeigten (Abb. 1 .).D, Sternchen). Die stark verzweigten CCR2-RFP – , CD11b + -Zellen sind wahrscheinlich aktivierte hirnresidente Mikroglia. Angesichts der Knappheit von T-Zellen in der CCR2 + -Population liefern diese Ergebnisse Hinweise darauf, dass KA-induzierte SE neben neuronalen Schäden und Entzündungen auch die Rekrutierung von CCR2 + -Monozyten in Hippocampus-Gewebe verursachen kann. Darüber hinaus ist die Rekrutierung von Monozyten kein unmittelbares oder frühes Ereignis. Vielmehr erfolgt die Monozyteninfiltration zwischen 1 und 3 d nach SE-Beginn und ist somit relativ zum Beginn der Neurodegeneration und Mikroglia-Aktivierung verzögert.

Expression von CCL2 nach SE.

Das Chemokin CCL2 ist ein Hauptligand für CCR2, der Monozyten zu entzündeten Geweben rekrutiert. Um CCL2-exprimierende Zellen im Gehirn zu identifizieren, wurden CCL2::RFP-Transkriptionsreportermäuse einer Kochsalzlösung oder KA (30 mg/kg) ausgesetzt, um SE zu induzieren, und 1 oder 3 Tage später getötet. Die Verwendung dieser transkriptionellen Reporterlinie ermöglicht die intrazelluläre Markierung und Identifizierung von Zellen, die Ccl2 mRNA (31). Bemerkenswert ist, dass CCL2::RFP im Hippocampus von mit Kochsalzlösung behandelten Mäusen nur wenig angefärbt wurde. Im Gegensatz dazu wurde die CCL2::RFP-Färbung im Hippocampus von Mäusen 1 Tag nach SE angetroffen, und die CCL2::RFP-Färbung wurde 3 Tage nach SE weiter verstärkt (Abb. 2EIN). Einen Tag nach SE beobachteten wir überwiegend zwei zelluläre Strukturen, die Ccl2 mRNA, die an Blutgefäße oder stark verzweigte Mikroglia erinnert (Abb. 2EIN, rote Sternchen und B).

Parenchymale Iba1 + myeloische Zellen und perivaskuläre Makrophagen exprimieren CCL2 1 und 3 Tage nach Kainat-Verabreichung. CCL2::mRFP-Mäuse erhielten KA (30 mg/kg, i.p.) oder Kochsalzlösungs-Kontrollinjektion und wurden 1 oder 3 Tage später getötet. (EIN) Die mit KA behandelten Mäuse zeigten zu den untersuchten Zeitpunkten einen neuronalen Zellverlust in der CA3-Hippocampus-Region. Anti-RFP-Immunhistochemie zeigte CCL2-RFP + -Zellen zu den 1- und 3-d-Zeitpunkten. Zum 3-d-Zeitpunkt werden viele CCL2-RFP + -Mikroglia im Hippocampus beobachtet. (Skala: 100 μm.) (B) Höhere Vergrößerung (∼8× Panels in Abb. 2EIN) Bilder von Zellen zum 1-d-Zeitpunkt, die Strukturen zeigen, die Blutgefäßen ähneln (rechtes Sternchen, EIN) und verzweigte Mikroglia (linkes Sternchen, EIN). (C) Repräsentative Bilder bei 1 d mit Iba1 (Mikroglia Oberteil), CD31 (Endothelzellen Mitte) und CD206 (perivaskuläre Makrophagen)-Färbung mit CCL2-RFP-Signal. Mikroglia und perivaskuläre Makrophagen exprimieren CCL2. (Skala: 25 μm.) (D) Die quantitative Analyse der gesamten hippocampalen CCL2::RFP + myeloischen Zellen (Iba1 + ) im Hippocampus zeigte einen signifikanten Anstieg der Anzahl doppelt positiver Zellen zwischen dem 1-d- und 3-d-Zeitpunkt (mit Kochsalzlösung behandelt, n = 2 1-d, n = 3 3-d, n = 3 *P = 0,047, ungepaart T Prüfung). Die Balken zeigen den Mittelwert ± SEM.

Die Iba1-Färbung wurde mit dem CCL2::RFP-Signal kolokalisiert (Abb. 2C). Darüber hinaus haben wir CCL2::RFP + -Zellen nachgewiesen, die mit zerebralen Blutgefäßen assoziiert sind. Um zu bestimmen, welcher Gefäßzelltyp CCL2-mRNA exprimierte, färbten wir Endothelzellen mit Antikörpern gegen CD31 (32) und verwendeten Antikörper gegen CD206, um perivaskuläre Makrophagen anzufärben (33, 34), ein myeloischer Zelltyp, der sich im perivaskulären Raum befindet. Es gab keine Kolokalisation von endothelialem CD31 und CCL2::RFP, aber wir beobachteten eine starke Kolokalisation von CD206 und CCL2::RFP (Abb. 2C), was darauf hinweist, dass auch perivaskuläre Makrophagen CCL2 exprimierten. CCL2-Expression wurde in Astrozyten oder Neuronen 1 d nach SE nicht beobachtet. Diese Ergebnisse weisen darauf hin, dass Mikroglia und perivaskuläre Makrophagen CCL2 zunächst am 1-Tage-Zeitpunkt nach SE vor der Monozyteninvasion exprimieren. Die Anzahl der Hippocampus-doppelt markierten CCL2-exprimierenden Iba1 + myeloischen Zellen stieg von einer gelegentlichen doppelt positiven Zelle in mit Kochsalzlösung behandelten Mäusen auf 52 Zellen pro Quadratmillimeter Hippocampus 1 Tag nach KA-induzierter SE und 161 Zellen pro Quadratmillimeter 3 d nach SE (Abb. 2D).

Ccr2 Ein Mangel reduziert die Zahl der infiltrierenden Monozyten.

Zur Interpretation der phänotypischen Konsequenzen von SE in der Ccr2 rfp/rfp Knockout-Mäuse verglichen wir zunächst die zeitliche Entwicklung von Verhaltensanfällen bei defizienten und heterozygoten Ccr2 +/rfp Mäuse nach KA. Wir fanden heraus, dass beide Genotypen Verhaltensanfälle mit ähnlicher Intensität und Zeitverlauf entwickelten (Abb. 3 .).EIN). Drei Tage nach SE untersuchten wir erneut Hirngewebe auf neuronale Degeneration, Mikrogliose und Hirninvasion von zirkulierenden CCR2 + Monozyten. Neuronale Schäden und Mikroglia-Aktivierung wurden bei KA-behandelten Ccr2 rfp/rfp Knockout-Mäuse und Wurfgeschwister Ccr2 +/rfp kontrolliert. Allerdings war die Zahl der Iba1+-Zellen und CCR2+-Monozyten bei den CCR2-Knockout-Tieren im Vergleich zu den heterozygoten Kontrollen reduziert (Abb. 3 .).B). Tatsächlich wurde eine stereologische Analyse von Iba1 + -Zellen im Hippocampus von KA-behandelten Ccr2 +/rfp Mäuse zeigten etwa 1,7 × 10 5 Zellen 3 Tage nach SE, verglichen mit ∼1,0 × 10 5 Zellen in Ccr2 Knockout (Abb. 3C). Darüber hinaus wurde die Zahl der CCR2 + Monozyten um 5,5 × 10 3 in der reduziert Ccr2 Knockout-Mäuse im Vergleich zu den Ccr2 +/rfp Tiere (Abb. 3D) unterstützt die Idee, dass CCR2 eine wichtige Rolle bei der Monozyteninfiltration in das Gehirn spielt. Iba1 wird von in das Gehirn eindringenden Monozyten exprimiert, aber erst nachdem die Monozyten in das Gehirn eingedrungen sind und gereift sind (35), so dass die reduzierte Anzahl von Iba1 + myeloischen Zellen in den CCR2-defizienten Mäusen (Abb. 3 .)C) kann quantitativ durch den Verlust eindringender Monozyten erklärt werden (Abb. 3D). Nur selten wurde festgestellt, dass CCR2-RPF-positive Zellen im Gehirn in das Gehirn gelangten Ccr2 KO-Tiere. Diese Zellen waren positiv für den myelomonozytären Marker CD11b, was darauf hindeutet, dass es sich bei diesen Zellen um Monozyten handelte (Abb. 3 .).E), die vermutlich in Abwesenheit von CCR2-Signalen in das Gehirn gezogen wurden.

Ccr2 Knockout-Mäuse haben nach SE eine reduzierte Anzahl von Iba1 + -Zellen und CCR2-RFP + -Monozyten. Zwei Monate alt Ccr2 +/rfp (n = 5) und Ccr2 rfp/rfp (n = 4) Mäuse erhielten KA (30 mg/kg) und wurden 5 Stunden lang auf die Schwere der Anfälle überwacht. Die Mäuse wurden 3 Tage später getötet. (EIN) Der Schweregrad der Anfälle war bei den Ccr2-Knockout-Mäusen im Vergleich zu den heterozygoten Ccr2-Tieren nach KA-induzierter SE ähnlich. (B) 3 Tage nach SE ergab die histologische Untersuchung, dass beide Genotypen neuronale Schäden in der CA3-Region des Hippocampus zeigten, wie durch Cresylviolett-Färbung sichtbar gemacht wurde, obwohl die Schäden in der weniger ausgeprägt erschienen Ccr2 rfp/rfp Mäuse. Die Analyse benachbarter Schnitte zeigte, dass die Degeneration von einer Aktivierung von Iba1 + Mikroglia in . begleitet war Ccr2 +/rfp und Ccr2 rfp/rfp Mäuse. Eine robuste Infiltration von CCR2-RFP-exprimierenden Monozyten wurde jedoch nur in den Ccr2 +/rfp Mäuse. (Skala: 100 μm.) (C) Die stereologische Analyse der gesamten Hippocampus-Iba1+-Zellen ergab eine 36 %ige Verringerung der Anzahl der Iba1+-Zellen in Ccr2 rfp/rfp Mäuse im Vergleich zu Ccr2 +/rfp . (D) Stereologische Zählungen von CCR2-RFP-exprimierenden Monozyten zeigten eine robuste Reduktion der Monozytenzahl 3 d nach SE im Ccr2 rfp/rfp Mäuse im Vergleich zu Ccr2 +/rfp Mäuse unterliegen SE. Die Balken zeigen den Mittelwert ± SEM (*P = 0,025 und ***P < 0,001, ungepaart T Prüfungen). (E) Die gelegentliche kleine CCR2-RFP–exprimierende Zelle im Ccr2 rfp/rfp Mäuse war CD11b + (grüne Pfeile) und ist daher wahrscheinlich ein Monozyten, der durch ein Signal ins Gehirn gerufen wurde, das kein CCR2 benötigt. Die Sternchen identifizieren CCR2-RFP – , CD11b + -Zellen. (Skalenbalken: 50 μM.)

Pilocarpin-induzierte SE verursacht auch eine CCR2-abhängige Monozyten-Hirninfiltration.

Bisher haben unsere Experimente KA als chemokonvulsives Mittel verwendet, um SE zu verursachen. Um auszuschließen, dass die Monozyteninfiltration von KA als Epilepsiemodell abhängig ist, haben wir Ccr2-ausreichend und -defizienten Mäusen gegenüber Pilocarpin, einem anderen weit verbreiteten Chemokonvulsivum, und tötete die Mäuse 3 Tage später. Hippocampus-Gewebeschnitte wurden dann auf CCR2-RFP-exprimierende Monozyten untersucht. Wie erwartet, wurde das CCR2-RFP-Signal im Hippocampus von mit Kochsalzlösung behandelten nicht nachgewiesen Ccr2 heterozygote Mäuse (Abb. 4EIN). Ähnlich wie bei mit KA behandelten Mäusen wurde eine signifikante Infiltration von CCR2-RFP + -Monozyten bei CCR2-heterozygoten Mäusen beobachtet, die einer Pilocarpin-induzierten SE unterzogen wurden (Fig. 4 .).B). Darüber hinaus wurde die Monozyteninfiltration stark reduziert Ccr2 Knockout-Mäuse mit Pilocarpin-induzierter SE (Abb. 4C), in ähnlichem Maße bei KA-behandelten Mäusen beobachtet (Fig. 3 B und D). Diese Ergebnisse zeigen, dass CCR2 + Monozyten das Gehirn nach Pilocarpin-induzierter SE infiltrieren und zeigen, dass die CCR2-Abhängigkeit der Monozyteninfiltration unabhängig vom verwendeten Chemokonvulsivum ist.

Die Monozyteninfiltration wird stark reduziert in Ccr2 Knockout-Mäuse nach Pilocarpin-induzierter SE, und SE verändert die Blutspiegel der zirkulierenden Leukozyten nicht. Zwei Monate alt Ccr2 +/rfp und Ccr2 rfp/rfp Mäuse wurden mit Methylscopolamin (2 mg/kg, i.p.) und Terbutalin (2 mg/kg, i.p.) vorbehandelt und 20 min später mit Pilocarpinhydrochlorid (280 mg/kg, i.p.) injiziert, um SE oder Kochsalzlösung zu induzieren. Die SE wurde 1 h lang bestehen gelassen, bevor sie durch Diazepam (10 mg/kg, i.p.) unterbrochen wurde. Drei Tage nach SE ergab die histologische Untersuchung des Hippocampusgewebes eine Hirninfiltration von CCR2-RFP + Monozyten in Ccr2 +/rfp unterliegt Pilocarpin (B), aber nicht in Ccr2 +/rfp Tiere, die Kochsalzlösung erhalten haben (EIN) oder in Ccr2 rfp/rfp KO Tiere (C). (Skala: 50 μm.) (D) Die Blutwerte von Lymphozyten (gekennzeichnet als „L“), Monozyten („M“) und Neutrophilen („N“) waren zwischen mit Kochsalzlösung behandelten Kontroll- und Pilocarpin-behandelten Mäusen nicht verändert (n = 6 pro Behandlung). (E und F) Isolierte myeloische Gehirnzellen von CCR2-reichen Mäusen wurden auf CD11b (E) und unterteilt in Ly6C-Low- und Ly6C-High-Populationen (F). (g) Ly6C-Expression wurde an der CD11b + -Population in Mäusen 4 Tage nach SE quantifiziert. Eine einfache ANOVA gefolgt von Tukeys Post-hoc-Test zeigte signifikante Unterschiede zwischen mit Kochsalzlösung behandelten Ccr2 +/+ und Pilocarpin-behandelt Ccr2 +/+ Mäuse sowie Pilocarpin-behandelte Ccr2 +/+ und Ccr2 KO Tiere (****P < 0,0001 n = 5 pro Gruppe). Die Balken zeigen den Mittelwert ± SEM.

Um die Möglichkeit zu untersuchen, dass das Auftreten von Monozyten im Gehirn nach Pilocarpin-induzierter SE einfach auf eine erhöhte Anzahl von im Blut zirkulierenden Monozyten zurückgeführt werden kann, wurde Vollblut auf die Steady-State-Spiegel von Lymphozyten, Monozyten und Neutrophilen analysiert 3 d nach SE. Bemerkenswerterweise veränderte die Pilocarpin-induzierte SE die Blutspiegel eines der untersuchten Leukozyten-Subtypen, einschließlich der Monozyten, nicht (Abb. 4 .).D). Diese Ergebnisse weisen darauf hin, dass eine systemische Wirkung von Pilocarpin-induzierter SE die Zahl der zirkulierenden Lymphozyten, Monozyten und Neutrophilen nicht verändert.

Um weitere Einblicke in diagnostische Proteine ​​zu gewinnen, die von myeloischen Zellen nach SE exprimiert werden, verwendeten wir die Durchflusszytometrie. Zusätzlich zu CCR2 wird Ly6C auch in hohen Konzentrationen in Monozyten exprimiert, die in entzündetes Gewebe rekrutiert werden (11, 36). Die myeloische Zellpopulation wurde im Gehirn 4 Tage nach SE mit CD11b identifiziert (Abb. 4E). In diesen Studien wurde Ly6C high verwendet, um hirninfiltrierende, aus Blut stammende Monozyten zu identifizieren, während Ly6C low residente Mikroglia identifizierte (Abb. 4 .).F). Bei mit Kochsalzlösung behandelten Kontrolltieren exprimierten nur 2 % der CD11b + -myeloischen Zellen hohe Ly6C-Werte, was mit der Erkenntnis übereinstimmt, dass infiltrierende CCR2 + -Monozyten in naiven Gehirnen selten vorkommen, so dass hirnresidente Mikroglia das vorherrschende CD11b + . darstellen Population im Kontrollhirn (Abb. 4g). Im Vergleich dazu exprimierten 4 Tage nach SE ∼41% der CD11b+-myeloischen Zellen hohe Ly6C-Spiegel, was die Schlussfolgerung basierend auf der Zählung von Iba1+- und RFP+-Zellen im KA-Modell bestätigte, dass aktivierte Mikroglia und infiltrierende Monozyten ungefähr zu gleichen Teilen vorhanden sind Nummern 3–4 d nach SE. Schließlich zeigten Pilocarpin-behandelte CCR2-Knockout-Mäuse im krassen Gegensatz zu CCR2-reichen Tieren mit SE eine 99%ige Reduktion des Prozentsatzes an Ly6C-starken CD11b+-Zellen, nicht zu unterscheiden von mit Kochsalzlösung behandelten CCR2-reichen Kontrollen (Abb. 4 .).g).

Zusammenfassend liefern diese Ergebnisse überzeugende Beweise dafür, dass die phänotypischen Eigenschaften der myeloischen Komponente des Gehirns nach SE erheblich verändert sind, wobei myeloische Zellen, die das Gehirn infiltrieren, hohe Mengen an Ly6C exprimieren, einem kanonischen Marker für peripher abgeleitete Monozyten (37, 38). Darüber hinaus hängt das Auftreten von Ly6C-hoch CD11b + myeloischen Zellen nach SE von CCR2 ab.

Induktion von IL-1β nach SE ist im monozytenarmen Hippocampus reduziert.

Um einen Einblick in den Beitrag von CCR2 + -Monozyten zur Entzündung nach SE zu erhalten, untersuchten wir das Expressionsprofil einer Reihe von Entzündungsmediatoren in Wildtyp- und Ccr2 Knockout-Mäuse 4 Tage nach Pilocarpin-induzierter SE, wenn CCR2 + -Monozyten infiltriertes Hippocampusgewebe aufweisen (Fig. 4). Ähnlich wie bei mit KA behandelten Mäusen führte die Verabreichung von Pilocarpin zu nahezu identischen Anfallsschwere-Scores, unabhängig von Ccr2 Genotyp (Abb. 5EIN). Eine quantitative Real-Time-PCR (qRT-PCR) wurde an Hippocampus-Gewebe durchgeführt, um die Spiegel von fünf Entzündungsmediatoren zu messen, die zuvor nachweislich nach SE induziert wurden (30, 39). Die basalen mRNA-Spiegel dieser Entzündungsmediatoren waren in mit Kochsalzlösung behandelten Wildtyp- und Ccr2 Knockout-Tiere (Abb. 5B). Die mRNA-Spiegel der Entzündungsmediatoren iNOS, CCL2, TNF-α und IL-6 wurden alle in CCR2-ausreichenden und -defizienten Tieren auf nahezu identischen Niveaus induziert. Allerdings war die Induktion von IL-1β um ∼50 % in der abgeschwächt Ccr2 Knockout-Tiere mit Pilocarpin-induzierter SE im Vergleich zu Wildtyp-Mäusen (P = 0,028 Abb. 5C).

Zytokinexpression in Hippocampus und myeloischen Zellen nach SE. (EIN) Nach der Pilocarpin-Injektion wurde der verhaltensbezogene Anfalls-Score alle 5 Minuten tabellarisch erfasst, bis der Anfall 1 h nach Beginn der SE im Wildtyp durch Diazepam unterbrochen wurde (n = 14) und Ccr2-Knockout (n = 11). (B) Die basalen Hippocampusspiegel der mRNA, die für Entzündungszytokine und Mediatoren kodiert, waren im Wildtyp ähnlich (n = 6) und Ccr2 rfp/rfp (n = 6) Tieren, denen Kochsalzlösung injiziert wurde. (C) Die mediane fache Induktion der inflammatorischen Zytokine und Mediatoren im Hippocampus wird durch die horizontale Linie dargestellt und ist für Wildtyp (n ≥ 11) und Ccr2-Knockout (n ≥ 10) Mäuse 4 Tage nach SE. Jedes Symbol steht für eine einzelne Maus, wobei sich die Induktion auf den Mittelwert der entsprechenden mit Kochsalzlösung behandelten Gruppe bezieht. (D) Mäuse wurden 1 h lang einer Pilocarpin-induzierten SE ausgesetzt und 4 Tage später getötet. mRNA wurde aus durchflusssortierten CD11b + Ly6C Low Microglia isoliert (n = 9) und CD11b + Ly6C stark hirninfiltrierende Monozyten (n = 5) und durch qRT-PCR gemessen. Die mRNA-Veränderungen für SE-aktivierte Mikroglia wurden auf den Mittelwert der hirnresidenten Mikroglia (n = 5) von mit Kochsalzlösung behandelten Tieren, während hirninfiltrierende Monozyten nach SE auf Blutmonozyten (n = 5). Die horizontale Linie repräsentiert die mediane Falteninduktion jedes Entzündungsmediators. Jedes Symbol repräsentiert eine Population von myeloischen Zellen, die von einer einzelnen Maus hergestellt wurden. (E) mRNA-Veränderungen für die myeloischen Zellen wurden auf den Mittelwert der mit Kochsalzlösung behandelten Mikroglia normalisiert. Balken zeigen den Mittelwert ± SEM (*P = 0.028, **P < 0,01, ***P < 0,001 und ****P < 0,0001 durch Einweg-ANOVA mit Sidák-Mehrfachvergleichstest).

Das Entzündungsprofil von myeloischen Zelluntergruppen.

Um die Entzündungsreaktion von hirnresidenten Mikroglia und hirninfiltrierenden Monozyten zu bewerten, wurden mRNA-Spiegel der proinflammatorischen Zytokine IL-1β und TNF-α und des Chemokins CCL2 in FACS-gereinigten myeloischen Zellpopulationen untersucht, die 4 Tage nach SE aus dem Gehirn gewonnen wurden. Mikroglia und Monozyten wurden 4 Tage nach SE aus Gehirnhomogenaten isoliert, basierend auf ihrer differentiellen Expression von Ly6C und CD11b, wobei Mikroglia CD11b + sind und niedrige Ly6C-Spiegel aufweisen und in das Gehirn eindringende Monozyten ebenfalls CD11b + sind, jedoch mit höheren Ly6C-Spiegeln als Mikroglia (Abb. 4F).

In Mikroglia, die 4 Tage nach SE aus dem Gehirn geerntet wurden, waren die mRNA-Medianspiegel von IL-1β 16-fach höher als in Mikroglia, die aus mit Kochsalzlösung behandelten Kontrollmäusen erhalten wurden. Im Gegensatz dazu war der mediane IL-1β-Spiegel bei in das Gehirn eindringenden Monozyten im Vergleich zu Blutmonozyten nur um das Dreifache erhöht (P = 0,006 für Zelltypvergleich). TNF-α wurde auch in Mikroglia und Monozyten aus dem SE-Gehirn induziert. Monozyten zeigten im Vergleich zu Mikroglia eine geringere Induktion von TNF-α (2,1- vs. 5-fach), dies erreichte jedoch keine statistische Signifikanz (P = 0,067) (Abb. 5D). Die Induktion von CCL2-mRNA war in Monozyten (20-fach) und Mikroglia (18-fach) ungefähr gleich (Abb. 5 .).D).

Als nächstes normalisierten wir die Zytokinexpression in Mikroglia aus dem SE-Gehirn, in das Gehirn eindringende Monozyten und Blutmonozyten auf die von Mikroglia aus mit Kochsalzlösung behandelten Kontrollmäusen. IL-1β und CCL2 wurden in Mikroglia durch SE signifikant induziert (Abb. 5E). Interessanterweise waren die mRNA-Spiegel von IL-1β in zirkulierenden Blutmonozyten 125-fach höher als in Kontrollmikroglia, und die TNF-α-Spiegel waren in Blutmonozyten 486-fach höher (Abb. 5 .).E). Die TNF-α-Spiegel waren somit in Hirnmonozyten nach SE im Vergleich zu SE-aktivierten Mikroglia 79-fach höher (Abb. 5 .).E). Diese Ergebnisse weisen darauf hin, dass Mikroglia und Monozyten unterschiedlich auf SE reagieren. Während Monozyten eine geringe Induktion von IL-1β- und TNF-α-mRNA als Reaktion auf SE und Hirneintritt zeigen, induzieren aktivierte Mikroglia IL-1β und CCL2. Diese Ergebnisse zeigen jedoch auch, dass die Expression von IL-1β und TNF-α in zirkulierenden Monozyten viel höher ist als die von aktivierten Mikroglia.

CCR2 Mangel reduziert SE-induzierte BBB Öffnung.

Ein Abbau der BHS kann nach Verletzungen des Gehirns, einschließlich Krampfanfällen, auftreten (6, 40, 41). Serumalbumin wurde durch Western-Blot-Analyse in dem mit PBS-Lösung perfundierten Kortex vier Tage nach Pilocarpin-induzierter SE bei Wildtyp-Mäusen nachgewiesen, verglichen mit minimalem Albumin bei mit Kochsalzlösung behandelten Wildtyp-Tieren (Fig. 6). Auffallend ist, dass die Albumin-Extravasation in den Kortex fast vollständig abgeschafft wurde Ccr2 Knockout-Mäuse nach SE (Abb. 6). Es gab keinen signifikanten Unterschied in den Albuminspiegeln bei mit Kochsalzlösung behandelten Wildtyp-Mäusen im Vergleich zu mit Kochsalzlösung behandelten Ccr2 Knockout-Mäuse. Diese Ergebnisse legen nahe, dass die Monozyteninfiltration in den Tagen nach SE die BHS-Leakiness weiter verschlimmert.

Die Integrität der BBB bleibt erhalten in Ccr2 Knockout-Mäuse nach SE. (EIN) Serumalbumin-Extravasation in das Gehirn 4 Tage nach Pilocarpin SE wurde verwendet, um die Schädigung der BBB zu bewerten. Albuminproteinspiegel in kortikalen Homogenaten von mit Kochsalzlösung behandelten Kontrollwildtyp (n = 6) und Ccr2-mangelhaft (n = 6) Mäuse und Pilocarpin-behandelter Wildtyp (n = 18) und Ccr2-mangelhaft (n = 11) Mäuse wurden durch Western Blot mit GAPDH als Beladungskontrolle gemessen. Zwei repräsentative Proben aus jeder Gruppe werden gezeigt. (B) Normalisierte Bandenintensität des Albuminproteins relativ zu der von GAPDH und bezogen auf das mittlere Albumin/GAPDH-Verhältnis bei Wildtyp-Mäusen. Das durchschnittliche logarithmische Verhältnis von Albumin wurde zwischen jeder experimentellen Gruppe durch Einweg-ANOVA mit Post-hoc-Sidák-Test mit ausgewählten Paaren (*P = 0,043 und ***P < 0,001). Die auf die mittlere Faltungsänderung der mit Kochsalzlösung behandelten Wildtyp-Gruppe normalisierte Faltungsänderung ist aufgetragen. Kästchen repräsentieren die 25./75. Perzentile. Die horizontale Linie in den Kästchen stellt den Medianwert dar.

CCR2 Ablation verbessert die Gewichtszunahme und reduziert Hippocampus-Schäden nach SE.

Wir haben bereits gezeigt, dass Nager während der 24 h nach SE schnell 10–20 % ihres Körpergewichts verlieren und sich dann in den folgenden Tagen allmählich erholen (6, 8, 39). Wie erwartet verloren Tiere mit SE in den 24 Stunden nach SE-Beginn ∼13% ihres Körpergewichts, unabhängig von Ccr2 Genotyp (Abb. 7EIN). Zwischen 1 und 3 d nach SE begannen die Tiere beider Genotypen, an Gewicht zuzunehmen. Am vierten Tag hatten die Wildtyp-Mäuse jedoch nur 33% ihres ursprünglichen Gewichtsverlusts wiedererlangt, während die Ccr2 Knockout-Mäuse hatten sich deutlich besser verbessert und 61% ihres anfänglichen Gewichtsverlusts wiedergewonnen (P < 0,05 an Tag 4 und P < 0,02 für Genotypvergleich über Tage) (Abb. 7EIN).

Beschleunigte Gewichtszunahme und Neuroprotektion in Ccr2 KO nach SE. (EIN) Auswirkung eines CCR2-Mangels auf die Veränderung des Körpergewichts von Mäusen nach Pilocarpin SE (n = 11–14 Mäuse pro Zeitpunkt, Zwei-Wege-ANOVA, Interaktion P = 0,274, Zeit P < 0,0001, Genotyp P = 0,02, Tag 4 Bonferroni Post-hoc-Test *P = 0.036). (B) Fluoro-Jade B-Färbung in Hippocampus-Gewebeschnitten 4 d nach SE zeigt mehr verletzte Neuronen im CA3-Unterfeld von Wildtyp-Mäusen im Vergleich zu Ccr2-Knockout-Wurfgeschwistern. (Skala: 100 μm.) (C) Ein Diagramm der Anzahl von Fluoro-Jade B + -Zellen in Hippocampus-Zellschichten. Die Balken zeigen den Mittelwert ± SEM jeder Gruppe (*P = 0,016, ungepaart T Tests gefolgt von Holm-Sidák-Test für Mehrfachvergleiche). (D) Die Anzahl der Fluoro-Jade B + pyramidalen Neuronen pro Hippocampus-Schnitt ist für Wildtyp (n = 14) und Ccr2-Knockout (n = 11 *P = 0,018, ungepaart T Prüfung). Jedes Symbol repräsentiert die durchschnittliche Anzahl von Fluoro-Jade B + pyramidalen Neuronen pro Abschnitt in jeder Maus. (E) Vier Tage nach SE werden Fluoro-Jade B-Färbung und TUNEL-Markierung in CA1-Pyramidenneuronen in Wildtyp- und kolokalisiert Ccr2 Knockout-Mäuse. (Skala: 50 μm.)

SE erzeugt bei erwachsenen Nagetieren ein Muster des pyramidalen Neuronenverlusts, das von Tier zu Tier sehr unterschiedlich sein kann (29, 42). Wir untersuchten die Neurodegeneration bei Hippocampi von Wildtyp und Ccr2 Knockout-Mäuse 4 Tage nach Pilocarpin-induzierter SE. Fluoro-Jade B-Färbung wurde im Hippocampus von mit Salzlösung behandelten Mäusen nicht beobachtet (Fig. S1). Obwohl SE die Fluoro-Jade B-Färbung von verletzten Neuronen im Hippocampus sowohl bei Wildtyp- als auch bei CCR2-defizienten Mäusen induzierte (Abb. 7B), war die Anzahl der Fluoro-Jade B + Neuronen in den CA1- und CA3-Subfeldern sowie in der Hilusregion des Gyrus dentatus im CCR2-Knockout reduziert (Abb. 7 .). C und D). Im Durchschnitt wurden bei Wildtyp-Mäusen 130 gefärbte CA3-Neuronen pro Schnitt gezählt, während bei Tieren ohne CCR2 69 gefärbte Neuronen identifiziert wurden (P < 0,05). Ebenso wurde beim Vergleich der Gesamtzahl der Fluoro-Jade B + Hippocampus-Pyramidenneuronen (CA1+CA3) zwischen den beiden Genotypen eine signifikante 50%ige Reduktion der geschädigten Neuronen beobachtet (Abb. 7 .).D) in dem Ccr2 Knockout-Mäuse. Die Fluoro-Jade B + -Neuronen wurden sowohl in Wildtyp- als auch in CCR2-defizienten Mäusen mit dem TUNEL-Signal comarkiert (Fig. 7 .).E), in Übereinstimmung mit unseren früheren Ergebnissen (9). Bei den Wildtyp-Mäusen fanden wir, dass 93% der Pyramidenneuronen von Fluoro-Jade B + CA1 und CA3 TUNEL + waren, und ebenso 92% der Pyramidenneuronen von Fluoro-Jade B + in den Ccr2 Knockout-Mäuse waren TUNEL + . TUNEL-Färbung wurde bei mit Kochsalzlösung behandelten CCR2-ausreichenden und Knockout-Mäusen nicht angetroffen (Fig. S1). Wir fanden keinen Hinweis auf eine gespaltene Caspase-3-Färbung in fünf Hippocampus-Schnitten von jeder von drei Mäusen 4 Tage nach Pilocarpin-induzierter SE oder in Schnitten von einer Maus, die 24 Stunden nach SE getötet wurde (Fig. S2). Trotz des Fehlens einer gespaltenen Caspase-3-Färbung im Hippocampus fanden wir in Übereinstimmung mit früheren Berichten ein gespaltenes Caspase-3-Signal in geschädigten Skelettmuskeln (43).

Fehlen von Fluoro-Jade B-Färbung und TUNEL + Hippocampus-Pyramidenneuronen in mit Kochsalzlösung behandelten Wildtyp- und Ccr2 KO-Tiere. (EIN) Fluoro-Jade B-Färbung in Hippocampus-Gewebeschnitten von mit Kochsalzlösung behandelten Mäusen zeigt keine verletzten Neuronen im CA3-Unterfeld der CCR2-ausreichenden und -defizienten Mäuse. (Skala: 100 μm.) (B) Fluoro-Jade B- und TUNEL-Färbung fehlen in CA1-Neuronen in mit Kochsalzlösung behandelten Mäusen mit CCR2-ausreichend und -defizient. (Skala: 100 μm.)

Fehlen einer gespaltenen Caspase-3-Immunreaktivität in Pyramidenneuronen des Hippocampus nach Pilocarpin. Als Positivkontrolle zeigt der geschädigte Skelettmuskel 7 Tage nach der Verletzung eine gespaltene Caspase-3-Färbung. Im Gegensatz dazu wird 4 Tage nach Pilocarpin-induzierter SE kein gespaltenes Caspase-3-Signal im Hippocampus nachgewiesen. (Skala: 100 μm.)

Diese Ergebnisse zeigen, dass das Fehlen von CCR2 die Erholung des Gewichtsverlusts beschleunigt, vor dem Abbau der BHS schützt und eine signifikante Neuroprotektion im Pilocarpin-Modell der SE bietet. Da der CCR2-Mangel außerdem die Invasion von Monozyten durch Blut in das Gehirn robust einschränkt, legen unsere Ergebnisse nahe, dass die Infiltration von CCR2 + -Monozyten neuronale Schäden und die entzündlichen Folgen von SE verschlimmert.


Materialen und Methoden

Tiere

In dieser Studie verwendeten wir 8–12 Wochen alte männliche C57BL/6-Mäuse aus Taconic (Dänemark). Alle Versuche wurden von der dänischen Tierversuchsaufsicht genehmigt.

FACS von CPE-Zellen

Mäuse wurden durch Isofluran-Inhalation anästhesiert und durch Zervikalluxation eingeschläfert. Die Aderhautplexi (CP) aus allen Hirnventrikeln wurden entfernt und in HEPES-gepufferte Kochsalzlösung (HBS) auf Eis gelegt (Tabelle 1).Gepoolte CP-Gewebe von 6 bis 8 Mäusen wurden in 50 inkubiert μg/ml Concanavalin A Fluorescein (Vector Laboratories) in HBS für 10 min bei 37 °C, verdaut in 4 μg/ml dispase (Invitrogen) und 4 μg/ml Collagenase B (Roche) in kalziumfreier HBS für 30 min bei 37 °C und inkubiert in einer 1:1 Mischung aus TrypLE Select Enzyme (Thermo-Fisher) und Zellkultur-Trypsin/EGTA (Thermo-Fisher) ergänzt mit 1 mg/ml DNase (Sigma) für 10 min bei 37 °C. Das Präparat wurde durch eine 50-μm-Filter, und Propidiumiodid wurde vor der Fluoreszenz-aktivierten Zellsortierung (FACS) zum Ausschluss toter Zellen zugegeben. Die Zellen wurden durch 4-Wege-Reinheitssortierung auf einem FACS Aria III (BD Biosciences) in Fluorescein-positive und Fluorescein-negative Proben sortiert. Die Zellen wurden mit einem 70-μm-Düse, bei 70 psi und 12–20 kHz. Nach FACS wurden die Proben sowie Kontroll-CP-Proben für 1 min in einer Tischmikrozentrifuge zentrifugiert und die Pellets für die Gesamt-RNA-Isolierung verarbeitet. Die Probenreinheit wurde durch RT-PCR mit Primern validiert, die auf den Epithelmarker Claudin-1 (Cldn1) und der Endothelmarker Claudin-5 (Cldn5).

Komponente HBS 0Na + -HBS NH4Cl HBS High-K + HBS BBS
Nein + 145.0 0.0 125.0 10.0 145.0
K + 3.6 3.6 3.6 138.6 3.6
Ca 2+ 1.8 1.8 1.8 1.8 1.8
Mg 2+ 0.8 0.8 0.8 0.8 0.8
NH4 + 0.0 0.0 20.0 0.0 0.0
NMDG 0.0 145.0 0.0 0.0 0.0
Cl − 138.6 138.6 138.6 138.6 114.6
SO4 2− 0.8 0.8 0.8 0.8 0.8
Bestellung4 2− 2.0 2.0 2.0 2.0 2.0
HCO3 0.0 0.0 0.0 0.0 24.0
HEPES 10.0 10.0 10.0 10.0 10.0
Glucose 5.5 5.5 5.5 5.5 5.5
pH 7.4 7.4 7.4 7.4 7.4

Reverse Transkription - Polymerase-Kettenreaktion (RT-PCR)

Mausgewebe wurde in TRI-Reagenz (Ambion) homogenisiert und Gesamt-RNA wurde unter Verwendung des RiboPure TM -Kits (Ambion) gereinigt. RNA-Proben wurden mit DNase behandelt (Invitrogen) und die cDNA-Synthese wurde unter Verwendung des SuperScript II Reverse Transcriptase Systems (Invitrogen) durchgeführt. RT-negative Proben dienten als interne Kontrolle für die DNase-Behandlung. Die PCR wurde auf einem DNA Engine DYAD Peltier Thermal Cycler (MJ Research) mit anfänglicher Denaturierung bei 95 °C für 15 Minuten durchgeführt, gefolgt von 30–35 Amplifikationszyklen, bestehend aus 30 Sekunden Denaturierung bei 95 °C, 30 Sekunden Annealing bei 58 °C –60 °C und 30 Sekunden Verlängerung bei 72 °C (siehe Tabelle 2 für Primersequenzen und Produktgrößen).

Protein Gen Vorwärtsprimer Rückwärtsgrundierung Basenpaare
β-aktin Actb ACTGAGCTGCGTTTTACACCC ACACAGAAGCAATGCTGTCACC 446
V-ATPase A Atp6v1a CCAATCACCCCTTGCTAC TCTACTTTCCCATCAACCTCC 241
V-ATPase B1 Atp6v1b1 AAACTACATCACCCACCCC GCCAGAGCCATTGAAAATCC 298
V-ATPase B2 Atp6v1b2 CAAACCCTACCTCTCAACTCC ACGCAGAAACCGAACCAC 466
V-ATPase C1 Atp6v1c1 CCAAGCTGAACCACAATGAC ATCCACGCAATAAACGCC 316
V-ATPase C2 Atp6v1c2 AAGGGGAAAGCACACGAGAC CTTGACTTGGGGACGACGATGAC 359
V-ATPase a4 Atp6v0a4 CGACTACGATGACTCTTCCAAC AATTCCACCCAATGCAGCC 552
V-ATPase d1 Atp6v0d1 CGCTTTCATCATCACCATCAAC ACAATCCCAGGACAATGCTAC 509
V-ATPase d2 Atp6v0d2 AAAGCCAGCCTCCTAACTC CTTGCAGAATTTGTAGAATGCC 525
Claudin 1 Cldn1 AGGTGCAGAAGATGTGGATGGC AGAGGGAAGCAGCAGTTCACAG 527
Claudin 5 Cldn5 AATCAATTCCCAGCTCCCAGCC TGAGTGCTACCCGTGCCTTAAC 443
Löslich AC 1 Adcy10 TGCATCTGAAATGTGCCCGC TTTCAGCAGCCTTTCTCCCTCG 503
Löslich AC 1 Adcy10 TTTGCAGGTGATGCCTTGCTG TCATGCTCCGATCACAGAGCTG 319

Antikörper

Ein affinitätsgereinigter V-ATPase-Antikörper aus Kaninchen gegen die 70-kDa-A-Untereinheit des Proteins (Hurtado-Lorenzo et al. 2006) und ein monoklonaler Maus-Antikörper gegen sAC (Zippin et al. 2003) wurden in der lernen. Als Sekundärantikörper wurden Cy3-konjugierte Esel-Anti-Kaninchen-IgG (Jackson ImmunoResearch Laboratories) oder Esel-Anti-Kaninchen-Alexa-488-Antikörper (Invitrogen) und Fluorescein-Isothiocyanat (FITC)-konjugiertes Esel-Anti-Maus-IgG (Jackson ImmunoResearch Laboratories) verwendet.

Immunblotting

Mausniere wurde in eiskaltem Dissektionspuffer (0,3 mol/l Saccharose, 25 mol/l Imidazol, 1 mmol/l Ethylendiamintetraessigsäure (EDTA), pH 7,2 mit 8,4 μmol/L Leupeptin (Calbiochem), 0,4 mmol/L Pefabloc [Roche]) und zentrifugiert bei 4000 g 15 Minuten bei 4°C. Der Überstand wurde mit Probenpuffer versetzt (Endkonzentration: 0,1 mol/l Natriumdodecylsulfat und 0,04 mol/l Dithiothreitol), pH 6,8. Der präparierte Plexus choroideus wurde direkt in Probenpuffer gelöst und mit einem Ultraschallgerät Modell 150 V/T (BioLogics Inc.) dreimal mit 5 Stößen bei 60% Leistung beschallt. Die Proteinproben wurden 15 min auf 65 °C erhitzt und die Proteine ​​wurden durch 12,5% Polyacrylamid-Gelelektrophorese aufgetrennt und auf eine PVDF (Ambion)-Membran elektrotransferiert. Die Membranen wurden mit 5% Milch in PBS-T (0,1 mol/L PBS (in mmol/L: 167 Na + , 2,8 H2Bestellung4 - , 7,2 HPO4 2-, pH 7,4) mit 0,1 % Vol/Vol Tween) und über Nacht bei 5 °C mit primärem Antikörper in PBS mit 1 % Rinderserumalbumin (BSA) und 2 mmol/l NaN . inkubiert3. Nach dem Spülen wurden die Blots mit Meerrettichperoxidase-konjugiertem Anti-Kaninchen-Sekundärantikörper (Dako) inkubiert und abgebildet (ImageQuant LAS4000, GE Healthcare).

Gewebepräparation und Immunfärbung

Mäuse wurden durch Isofluran-Inhalation und Perfusionsfixierung mit 4% Paraformaldehyd (PFA) in PBS für 4 min über den linken Herzventrikel anästhesiert. Die Gehirne wurden entfernt und nach dem Eintauchen in 4% PFA in PBS für 1 h bei 4 . fixiert°C. Gewebe wurden in PBS gespült und in steigenden Konzentrationen von Ethanol (70 %, 96 % und 99 %, jeweils 2 h) entwässert, bevor sie über Nacht in Xylol gelegt wurden. Die Gewebe wurden mit Paraffin für 1 Stunde bei 60°C infiltriert. 2-μm Schnitte wurden auf einem Mikrotom (RM 2165 Leica Microsystems) geschnitten.

Gewebeträger wurden in Xylol entparaffiniert, in abnehmenden Konzentrationen von Ethanol (99 %, 96 % und 70 %) rehydratisiert und in PBS gespült. Zur Antigengewinnung wurden die Objektträger mit 1% (w/v) SDS in PBS für 4 Minuten behandelt und in PBS gewaschen. Die Schnitte wurden mit 1 % (w/v) Rinderserumalbumin in PBS, das 0,02 % Natriumazid enthielt, 20 Minuten lang blockiert und mit primärem Antikörper 90 Minuten lang bei Raumtemperatur inkubiert. Die Objektträger wurden in PBS gewaschen, mit sekundärem Antikörper 60 min bei Raumtemperatur inkubiert, erneut gewaschen und mit Deckgläsern unter Verwendung von Vectashield-Eindeckmedium (Vector Laboratories Inc.), das DAPI enthielt, aufgezogen oder mit Topro3 (Invitrogen) Nuklearfärbung vor dem Aufziehen mit Glycergel-Anti- . inkubiert - verblassen (Dako). Ein 80i-Epifluoreszenzmikroskop (Nikon Instruments), ausgestattet mit einer Orca 100 CCD-Kamera (Hamamatsu) oder ein DM IRE2 invertiertes konfokales Mikroskop (Leica Microsystems) wurde verwendet, um die digitalen Bilder zu erfassen.

Analyse der zellulären V-ATPase-Verteilung

Die Quantifizierung der V-ATPase-Verteilung wurde durch Linienscannen (ImageJ-Software, National Institutes of Health) über Zellen mit einem sichtbaren Kern durchgeführt. Die Linie verlief senkrecht zur Basalmembran und erweiterte sich zu einer Bande mit einer Breite von 21 Pixeln und wurde in allen Bildern (2–8 Bilder pro Maus) in der mittleren Kernebene jeder Zelle platziert, die einen Kern enthielt. Die Anzahl der Behälter (Messpunkte) wurde für jede Zelle auf 50 (oder 40 in Fig. 5) komprimiert und die durchschnittliche Färbeintensität für jeden Behälter wurde für jede der zehn Mäuse berechnet, wobei Behälter Nr. 1 das basale Ende von darstellt die Zellen. Am luminalen Ende repräsentieren die letzten 5 Bins höchstwahrscheinlich den Pinselrand. Um die Hintergrundfärbung zu korrigieren, wurde die niedrigste Färbeintensität jeder Maus von jedem der anderen Bins derselben Maus abgezogen. Danach wurde die durchschnittliche Färbeintensität für jeden der 50 (oder 40) Behälter für alle kernhaltigen Zellen für jede Maus berechnet und für jede Gruppe von 5 Mäusen (Hyperthermie-behandelte Mäuse und Kontrollmäuse) gemittelt.

Immunogold-Elektronenmikroskopie

Der mit 4 % Paraformaldehyd in PBS (0,9 % NaCl in 10 mmol/L Phosphatpuffer, pH 7,4) fixierte Plexus choroideus wurde durch eine abgestufte Ethanolreihe zu 100 % Ethanol dehydratisiert und anschließend infiltriert, eingebettet und in LR White Harz . polymerisiert (EMS) bei 50 °C wie zuvor beschrieben (Paunescu et al. 2010). Dünne Aderhautplexus-Schnitte wurden auf einem EM UC7-Ultramikrotom (Leica Microsystems) in ungefähr 70-nm-Schnitte geschnitten und auf Formvar-beschichteten Gittern gesammelt. Die Gitter wurden auf Tropfen von primärem Kaninchen-Anti-V-ATPase-A-Untereinheits-Antikörper, 1:50 in Antikörperverdünnungsmittel (Dako) verdünnt, 2 h bei Raumtemperatur schwimmen gelassen, auf Tropfen von PBS gespült und auf Tropfen von Ziegen-anti-Kaninchen-IgG . schwimmen gelassen Antikörper gekoppelt an 15-nm-Goldpartikel, verdünnt 1:15 in Antikörper-Verdünnungsmittel für 1 h bei Raumtemperatur. Die Gitter wurden gespült, auf Tropfen von 2% Uranylacetat 5 min nachgefärbt, gespült und getrocknet. Die Plexus-Aderhaut-Schnitte wurden in einem JEM-1011-Transmissionselektronenmikroskop (JEOL) bei 80 kV untersucht. Bilder wurden unter Verwendung eines digitalen Bildgebungssystems AMT XR60 (Advanced Microscopy Techniques) aufgenommen.

Intrazellulärer pH-Wert (pHich) Messungen

Die Experimente wurden wie zuvor beschrieben durchgeführt (Damkier et al. 2009). Isolierte CP-Gewebe wurden durch 4 . in einschichtige Zellcluster verdaut μg/ml dispase (Invitrogen) und 4 μg/ml Collagenase B (Roche) in kalziumfreier HBS (Tabelle 1) bei 37 °C für 30 min. Die verdauten Zellcluster wurden auf Cell-Tak-beschichteten (BD Biosciences) Deckgläsern für 10–15 min bei 37 °C montiert und für 10 min mit der pH-sensitiven Sonde BCECF-AM (2 μmol/l, Invitrogen). Deckgläser wurden in einer geschlossenen Perfusionskammer (RC-21BR Harvard Apparatus) angebracht und auf einen umgedrehten Mikroskoptisch in einer 37 °C dunklen Box gelegt. Den Zellen wurde ermöglicht, sich in HBS auf ein Grundlinienniveau zu äquilibrieren, bevor die Zellen durch ein NH&sub4; angesäuert wurden4Cl-Vorpuls für 3–5 min (NH4Cl HBS, Tabelle 1) gefolgt von Na + -freier HBS (0Na + HBS, Tabelle 1). Jedes Experiment wurde mit einer Einpunktkalibrierung in pH 7,0, hoher K + HBS (Tabelle 1) mit 10 μmol/l Nigericin.

Die Till Vision-Software (Till Photonics) wurde verwendet, um die zwischen 490 nm und 440 nm wechselnde Monochromatorwellenlänge, die Belichtungszeit (20 ms), die Frequenz (1 Hz) und das Binning (auf 512 × 512 Pixelbilder) zu steuern. Die Lichtemission bei 510–535 nm wurde mit einer gekühlten 12-Bit-Monochrom-CCD-Kamera (QImaging, Retiga EXi) aufgezeichnet und Daten von benutzerdefinierten Interessenbereichen (ROIs) einzelner Zellen nach Hintergrundsubtraktion gesammelt. Das Fluoreszenzverhältnis (490/440 nm) wurde durch Einklemmen von pH . auf den pH-Wert kalibriertich schrittweise von pH 8–6 in High-K + HBS mit 10 μmol/L Nigericin (Boyarsky et al. 1988). Der pH-Wertich Erholung (dpHich/dt) wurde als pHich Änderung in 30 Sek. nach Peak-Minimum-pHich.

Messung des Membranpotentials (Vm) in isolierten CPE-Zellen

Isolierte CPEC-Cluster wurden in mit Cell-Tak (BD Biosciences) beschichteten Kulturschalen (Falcon, Becton Dickson), die HBS enthielten, ausplattiert. Isolierte Zellen und kleine Epithelstücke wurden 15 min vor der Vm-Aufzeichnung am Kammerboden haften gelassen (Kotera und Brown 1994). Alle Aufzeichnungen wurden bei Raumtemperatur mit Patchpipetten aus Borosilikatglas (Harvard Apparatus) mit Widerständen im Bereich von 2–5 MΩ durchgeführt. Die Aufzeichnungen wurden mit einem Axopatch 200B-Verstärker (Axon Instruments Inc., CA) durch Umschalten vom Spannungsklemm- in den Stromklemmmodus gemacht. Zuerst wurde eine Ganzzellenkonfiguration im Voltage-Clamp-Modus erstellt (Dichtungswiderstand >1 GΩ Zugriffswiderstand 5–10 MΩ) und dann sofort in den Current-Clamp-Modus geschaltet, um Vm zu detektieren. Vm, das unmittelbar nach der Etablierung der Ganzzellkonfiguration (innerhalb von nicht mehr als 1 Minute) nachgewiesen wurde, wurde für weitere Analysen aufgezeichnet. Die Pipettenlösung in diesen Experimenten enthielt (in mM): 140 K + , 4 Na + , 2 Mg 2+ , 120 Aspartat, 24 Cl – , 2 ATP 2 – , 0,5 EGTA, 5 HEPES und auf pH = 7,4 eingestellt, während HBS wurde als Badelösung verwendet.

Respiratorische Alkalose (Hypokapnie) durch Hyperthermie und Hypoxie

Für die Hyperthermie wurde eine Heizlampe verwendet, um die Temperatur eines Behälters auf 42 °C zu erhöhen. Die Mäuse wurden einzeln für 5–7 Minuten in den Behälter gegeben, wodurch Hyperventilation und CO .-Auswaschung induziert wurden2 bevor eine Isofluran-Anästhesie eingeleitet wurde. Die Kontrollen wurden für die gleiche Zeitdauer in die Kammer gegeben, jedoch bei Raumtemperatur. Bei Hypoxie wurden die Mäuse in eine Kammer mit einer Gasmischung von 12% O . gebracht2 in 88% N2 5 min vor Einleitung der Isofluran-Narkose im gleichen Gasgemisch. Die Kontrollmäuse inhalierten normale Luft. Für beide Experimente wurden Blutproben aus dem rechten Vorhof des Herzens entnommen und die Mäuse wurden mit 4% PFA in PBS über den linken Ventrikel perfusionsfixiert. Das Blut wurde auf einem ABL80 Flex-Blutgasanalysator (Radiometer) analysiert.

Stereotaktische Injektion von cAMP in Hirnventrikel von Mäusen

Mäuse wurden durch eine intraperitoneale Bolusinjektion von Ketamin (100 mg/kg) und Xylazin (10 mg/kg) betäubt, gefolgt von kontinuierlichen Injektionen kleinerer Anästhesiedosen nach Bedarf. Jede Maus wurde in eine stereotaktische Ausrüstung (David Kopf Instruments) gelegt und eine Hamilton-Spritze wurde 2,5 mm durch den Schädel in die seitlichen Ventrikel bei Koordinaten von 0,8 mm seitlich und 0,1 mm kaudal zum Bregma eingeführt. Ein Volumen von 5,5 μL 10 mmol/L 8-CPT-cAMP (Sigma-Aldrich) oder Vehikel (künstlicher Liquor/aCSF, Alzet) wurde langsam injiziert (0,5 μl/min). Nach 30 min wurde die Maus perfusionsfixiert und das Gehirn einer Immunhistochemie unterzogen.

Statistiken

Mittelwerte für pHich Wiederfindungsrate wurden durch nichtparametrische ANOVA mit Dunnet-Posttest verglichen, da die Daten den Normalitätstest nicht bestanden. V-ATPase-Färbungsintensitäten und Blutgaswerte wurden durch einen zweiseitigen t-Test analysiert. Für alle Analysen, P < 0,05 wurde als signifikant angesehen.


Materialen und Methoden

Reagenztyp
(Art) oder
Ressource
BezeichnungQuelle oder
Hinweis
BezeichnerZusätzlich
Information
Stamm, Stamm Hintergrund (Muskulatur)ShhCre/+Liu et al., 2010Jackson LabArtikelnummer: 005622
Stamm, Stamm Hintergrund (Muskulatur)Atoh1-CreER+Chow et al., 2006MMRRCArtikelnummer: 029581-UNC
Stamm, Stamm Hintergrund (Muskulatur)vGlut3-iCreER/+Li et al., 2018Auf Anfrage bei Liu Lab erhältlichBitte kontaktieren Sie ([email protected])
Stamm, Stamm Hintergrund (Muskulatur)Scrt2-P2A-tdTomate/+Es ist eine Knockin-Mauslinie, die tdTomato reflektieren kann Scrt2 mRNA-ExpressionsmusterJackson LabLagernr.: 034390 (wird in Kürze hinterlegt)
Stamm, Stamm Hintergrund (Muskulatur)Celf4-3xHA-P2A-iCreER-T2A-EGFP/+Es handelt sich um eine Knockin-Mauslinie, bei der HA am Celf4-Protein-C-Terminus markiert ist. Darüber hinaus werden iCreER und EGFP gesteuert von Celf4 Promoter/VerstärkerJackson LabLagernr.: 034391 (wird in Kürze hinterlegt)
RNA-ExtraktionskitPicoPure RNA-IsolierungskitThermo ScientificKat.-Nr.: KIT0204Extraktion von RNA aus isolierten Zellen
cDNA-GenerierungskitOvation RNA-Seq V2Genomik von TecanKat#:7102-32Umwandlung von RNA in cDNA
BibliotheksbaukastenOvation Rapid DR Multiplex-SystemGenomik von TecanKat.-Nr.: 0319–32Generieren einer Sequenzierungsbibliothek mit acht Samples Multiplexing
VerdauungsenzymProteaseSigmaKat.-Nr.: P5147Verdauung von Innenohrgewebe

Genetische Markierung und Qualitätsprüfungen vor und nach der Sequenzierung von SGNs, HCs und Gliazellen sowie Bibliotheksaufbau

SGNs unterschiedlichen Alters wurden manuell ausgewählt, um die höchste Reinheit unserer Proben zu gewährleisten. Durch die manuelle Entnahme konnten wir nicht nur die tdTomato-Fluoreszenz, -Morphologie und -Gesundheit der Zellen überwachen, sondern auch das Aufnehmen von Zelltrümmern vermeiden. Die entnommenen Zellen wurden dreimal gewaschen, um die Probenreinheit zu maximieren, bevor sie in den Lysepuffer geladen wurden. Wir verwendeten auch manuelles Picking für eine Referenzzellpopulation, P8-Gliazellen. Wir versuchten zunächst, FACS zu verwenden, um Gliazellen zu gewinnen, aber die Reinheit dieser Zellen entsprach nicht unseren Qualitätskriterien. Bei der zweiten Referenzzellpopulation, P12 HCs (sowohl cochleär als auch vestibulär) entsprachen die mittels FACS gewonnenen Proben unseren Qualitätskriterien und wurden somit verwendet.

Drei genetische Modelle wurden verwendet, um jeden Zelltyp mit tdTomato zu markieren. SGNs wurden mit tdTomato genetisch markiert, indem ShhCre/+ Rosa26-CAG-loxp-stop-loxp-tdTomate/+ Dehnung (Abbildung 1). Nach der Mikrodissektion wurde das Cochlea-Gewebe unter einem Fluoreszenzmikroskop untersucht, um festzustellen, ob tdTomato+-Zellen auf die SGN-Region beschränkt waren ShhCre/+: Leckage führt dazu, dass alle Zellen im Innenohr zu tdTomato+ werden. HCs wurden mit tdTomato genetisch markiert, indem Atoh1-CreER+ Rosa26-CAG-loxp-stop-loxp-tdTomate/+ Mäusen, denen Tamoxifen an P0 und P1 verabreicht wurde (Chow et al., 2006). Schließlich wurden Gliazellen und Cochlea-IHCs entwickelt, um tdTomato+ unter Verwendung von . zu exprimieren vGlut3-iCreER/+ Rosa26-CAG-loxp-stop-loxp-tdTomate/+ Mäuse, denen Tamoxifen an P2 und P3 verabreicht wurde (Li et al., 2018), und nur die Gewebe im SGN-Bereich wurden herauspräpariert, um tdTomato+ IHCs zu verwerfen. Wir folgten den gleichen Gewebeverdauungs- und Zellpicking-Protokollen wie zuvor beschrieben (Li et al., 2018 Liu et al., 2015). PicoPure RNA Isolation Kit (KIT0204, Thermo Scientific) wurde verwendet, um RNA zu extrahieren. Für die cDNA-Konvertierung und Bibliothekskonstruktion wurden Ovation RNA-Seq V2 (7102–32, Tecan Genomics) und das Ovation Rapid DR Multiplex System (0319–32, Tecan Genomics) verwendet.

Die Qualitätsprüfung vor der Sequenzierung wurde mittels qPCR durchgeführt. Mafb, Sox10, und Myosin-VI wurden als Gene spezifisch für SGNs, Glia bzw. HCs ausgewählt, und das Kriterium war, dass die Probe für jeden Zelltyp eine mindestens 30-fache Anreicherung bzw Mafb, Sox10, und Myosin-VI, wie in P8 SGNs veranschaulicht (Abbildung 1D-1F). Die qPCR-Daten wurden mit Student’s . statistisch analysiert T Prüfung. Ergänzungsdatei 2 enthält die qPCR-Primersequenzen für jedes Gen. Die Qualitätskontrolle nach der Sequenzierung wurde mit zusätzlichen bekannten Genen durchgeführt, um die Qualität und Reinheit der Zellen zu überprüfen. Neben SGN-, HC- und Gliamarkern haben wir Gene untersucht, die sieben weitere Zelltypen abdecken: hemmende Neuronen, katecholaminerge Neuronen, Oligodendrozyten, Astrozyten, Mikroglia, Plexus choroideus und Blutzellen – sowie Haushaltsgene (Abbildung 2 – Abbildungsbeilage 2 ). Nur Proben, die sowohl die Kontrollpunkte vor als auch nach der Sequenzierung bestanden, wurden in unsere Studie eingeschlossen. Alle Mäuse wurden in Tierräumen mit Lichtschutzfaktor gezüchtet und aufgezogen, und die Tierverfahren wurden gemäß den Richtlinien (NA-032–2019) des IACUC of Institute of Neuroscience (ION), Chinesische Akademie der Wissenschaften, durchgeführt.

Computergestützte Analyse von RNA-Seq-Daten

RNA-Seq-Reads in FASTQ-Dateien wurden mit STAR auf das mm10-Genom der Maus abgebildet (Dobin et al., 2013). Mapping Reads wurden dann mit featureCounts (Liao et al., 2014) unter Verwendung der Maus gencode.vM15 Annotation (Harrow et al., 2012) quantifiziert. Paarweise differentielle Expressionen zwischen den Gruppen wurden berechnet: Gene mit CPM-Werten (counts per million) von >1 für alle Replikate in mindestens einer Gruppe wurden ausgewählt, um für die anschließende Analyse berücksichtigt zu werden (21.293 von 52.550, einschließlich HC und Glia, oder 17, 531 ohne HCs und Glia).

Um SGN-spezifische Gene herauszufiltern, die entweder konstante oder dynamische Expression zeigen (Abbildung 2A und B), wurden die Zähldaten TMM (der gewichtete getrimmte Mittelwert der M-Werte) normalisiert und paarweise differentielle Expressionen wurden für alle Gruppenpaare unter Verwendung der ausgewertet limma-Paket mit seiner voom-Methode (Law et al., 2014). Zuerst wurden SGN-spezifische Gene mit konstanter Expression als Gene am Schnittpunkt dieser vier Bedingungen definiert (Abbildung 2A): 1) unterschiedlich exprimiert zwischen allen SGNs und HC, Glia (mit Faltungsänderung, FC > 4 und qval <0,01) 2) nicht unterschiedlich zwischen SGNs unterschiedlichen Alters ausgedrückt (FC < 2), 3) TPM-Werte (Transcripts per Million) in HC- und Glia-Populationen waren <5 4) mittlerer TPM-Wert in SGNs war >30. Zweitens wurden SGN-spezifische Gene mit dynamischer Expression gemäß den folgenden Bedingungen extrahiert (Abbildung 2B): 1) Es wurde ein signifikanter Unterschied zwischen mindestens einer der SGN-Gruppen und sowohl HC als auch Glia gefunden (qval <0.01 und FC > 4 ) 2) ein signifikanter Unterschied war in mindestens einem paarweisen Vergleich zwischen verschiedenen SGN-Gruppen vorhanden (qval <0,05 und FC > 2) 3) maximaler mittlerer TPM der SGN-Gruppe war >75 4) maximaler mittlerer TPM der SGN-Gruppe betrug mindestens 25 mal so viel wie bei HC und Glia. Die Anwendung relativ weniger strenger Kriterien sollte zur Identifizierung zusätzlicher SGN-spezifischer Gene führen, die konstante oder dynamische Expressionsmuster aufweisen.

Wir analysierten auch die Dynamik von SGN-Genen (CPM > 10 für alle Replikate in mindestens einem Alter von 9349 Genen), ohne ihre Expressionsmuster in HC und Glia zu berücksichtigen (Abbildung 3). Um die Gendynamik zu klassifizieren, werden sie zwischen einem Alter und dem nächsten Alter als hochreguliert (u), herunterreguliert (d) oder unverändert (-) bezeichnet (z. B. SGN_E15.5 bis SGN_P1). Die Auf- oder Abregelung wird basierend auf diesen Werten bestimmt: qval <0,05 und FC >2. Unverändert wird basierend auf qval >0,1, FC <2 und maximal elementweise FC <4 bestimmt. Alle anderen veränderten Gene wurden als „geräuschvoll“ bezeichnet. Der Einfachheit halber wurden die verrauschten Gene in die unveränderte Gruppe aufgenommen (Abbildung 3B). Die Dynamik für den gesamten Zeitraum wurde als Kombination der einzelnen Übergänge klassifiziert (zB 'u---" bedeutet Hochregulierung von E15.5 nach P1, gefolgt von unverändertem Ausdruck von P1 nach P8, P8 nach P14 und P14 nach P30. Beachten Sie, dass sich die Dynamik hier auf Veränderungen zwischen zwei benachbarten Altersgruppen konzentrierte (Abbildung 3C–J). Dies unterscheidet sich von der Dynamik im Kontext von SGN-spezifischen Genen mit dynamischen Expressionsmustern, die als Gene definiert wurden, die sich signifikant unterscheiden Ausdruck zwischen einem der beiden verglichenen Altersgruppen (Abbildung 2B). Celf4 gehörte zur unveränderten (----) Kategorie (Abbildung 3B). Jedoch, Celf4 Expression im Erwachsenenalter (P30) war signifikant höher als bei E15.5 (Abbildung 2C), wie auch durch qPCR-Analyse von Celf4 (Abbildung 2D). Deswegen, Celf4 wurde als ein SGN-spezifisches Gen definiert, das eine dynamische Expression zeigt ( 2B ). Dynamische Muster jedes Gens (Abbildung 3B–J) wurden in Ergänzungsdatei 1 beschrieben.

Um schließlich herauszufinden, welche Art von Genen zu jeder der oben klassifizierten Gruppen gehören, wurden Genanreicherungsanalysen (Abbildung 3K-M) für jede dynamische Gengruppe durchgeführt, wobei 1) die obersten HUGO-Gengruppen verwendet wurden (Braschi et al., 2019 .). ), 2) PANTHER-Klassifizierungssystem (Mi et al., 2017) und 3) die molekulare Funktionskomponente der Gene Ontology Annotation (Ashburner et al., 2000). Anreicherung P-Wert wurde unter Verwendung einer hypergeometrischen Verteilung berechnet. Alle Rohdaten unserer RNA-seq sind in GEO (Gene Expression Omnibus) unter der Hinterlegung: GSE132925 hinterlegt. Die Read-Counts aller Gene sind in der Datei GSE132925-cochlear-SGN-cnts.txt.gz im Anhang von GEO verfügbar.

Generation von Scrt2-tdTomate/+ und Celf4-iCreER/+ Knockin-Mausstämme

Die Scrt2-tdTomato/+ Maus wurde durch Co-Injektion einer vorab getesteten sgRNA gegen Scrt2 . erzeugt, Donor-DNA (Abbildung 4 – Abbildungsergänzung 1) und Cas9-mRNA in Mauszygoten im Einzellstadium. Die Scrt2 Die verwendete sgRNA-Sequenz war 5ʹ- Gcctcggcgggcatcccgca -3ʹ. Detaillierte Donor-DNA-Sequenzen sind auf Anfrage erhältlich. Junction-PCR wurde verwendet, um F0-Mäuse zu screenen, wonach die F0-Mäuse mit Wildtyp-C57BL/6-Mäusen für den Keimbahnübergang gekreuzt wurden und um F1-Mäuse zu produzieren. Die F1-Mäuse wurden unter Verwendung von Junction-PCR und Southern-Blotting weiter gescreent (Abbildung 4 – Abbildungsergänzung 1D und E). Die Southern-Blotting-Ergebnisse bestätigten, dass in den Mausgenomen keine zufällige Insertion von Donor-DNA auftrat. Southern-Blotting wurde gemäß unserem zuvor beschriebenen Protokoll durchgeführt (Li et al., 2018). Schwanz-DNA-PCR ermöglichte es uns, Wildtyp (+/+), heterozygot (KI/+) und homozygot (KI/KI) Mäuse. Wenn die Primer F2 und R1 verwendet wurden, war das erhaltene KI-PCR-Amplikon 894 bp lang, während das erhaltene Wildtyp-PCR-Amplikon mit den Primern F1 und R1 350 bp lang war. Theoretisch sollten die Primer F1 und R1 eine 1844 bp-Bande im KI-Allel erzeugen, aber aufgrund der kurzen Verlängerungszeit unseres PCR-Protokolls wurde diese Bande nicht produziert.

Um die zu produzieren Celf4-iCreER/+ Stamm, ein vorgetesteter Celf4 sgRNA, Donor-DNA und Cas9-mRNA wurden in einzellige Mauszygoten injiziert. Alle anderen Verfahren waren mit den oben beschriebenen identisch und werden daher hier nicht wiederholt. Wir haben das Gen ausgewählt Celf4-201 (ENSMUST00000025117.13 auf der Ensembl-Website) für das Gen-Targeting. Die verwendete Celf4-sgRNA-Sequenz war 5'-tacgggcgattggcgtcttt-3'. Eine Southern-Blotting-Analyse schloss eine zufällige Insertion von Donor-DNA in das Mausgenom aus. Wenn die Primer F1 und R1 verwendet wurden, war das erhaltene Wildtyp-PCR-Amplikon 471 bp lang, mit den Primern F2 und R1 war das KI-PCR-Amplikon 612 bp lang. Wie zuvor produzierten die Primer F1 und R1 aufgrund der begrenzten Verlängerungszeit unseres PCR-Protokolls nicht erfolgreich ein 3402 bp-Amplikon im KI-Allel. Alle Sequenzen, die für die Genotypisierungs-PCR-Primer für die beiden Mausstämme verwendet werden, sind in Supplementary file 2 aufgeführt. Diese beiden Stämme werden im Jackson Laboratory Repository (http://jaxmice.jax.org/query) unter JAX Stock Nos. 034390 und 034391.

Probenverarbeitung, Histologie und Immunfluoreszenz und RNA-in-situ-Hybridisierung

Für die Abstammungsanalyse von Celf4-iCreER/+ Rosa26-CAG-loxp-stop-loxp-tdTomate /+ Mäusen wurde in Maisöl (C8267, Sigma) gelöstes Tamoxifen (T5648, Sigma) bei P1/2 oder P8/9 in einer Dosierung von 3 mg/40 g Körpergewicht oder bei P30/31 in einer Dosierung von 9 mg verabreicht /40 g Körpergewicht. Innenohrgewebe von embryonalen Mäusen oder Mäusen, die jünger als P10 waren, wurden herausgeschnitten und in frischem 4% PFA über Nacht bei 4°C fixiert. Mäuse, die älter als P10 waren, wurden mit 1 × PBS herzperfundiert und dann mit frischem 4% PFA perfundiert, und dies wurde von einer zweiten Fixierung in frischem 4% PFA über Nacht bei 4°C gefolgt. Innenohrgewebe wurde dreimal mit 1 × PBS gewaschen und dann entweder direkt in der Ganzmontage-Analyse verwendet oder in 30% Saccharose bei 4°C über Nacht getränkt, in OCT eingebettet, bei einer Dicke von 14 &mgr;m kryogeschnitten und dann untersucht.

Folgende Primärantikörper wurden verwendet: Anti-Myosin-VI (Kaninchen, 1:200, Kat#: 25–6791, RRID:AB_10013626, Proteus Bioscience), Anti-Mafb (Kaninchen, 1:300, Kat#: HPA005653, RRID :AB_1079293, Sigma), Anti-GFP (Huhn, 1:1000, Cat#: ab13970, RRID:AB_300798, Abcam), Anti-Sox2 (Ziege, 1:1000, Cat#: sc-17320, RRID:AB_2286684, Santa Cruz Biotechnology), Anti-HA (Ratte, 1:200, Cat#: 11867423001, RRID:AB_390918, Sigma), Anti-Tuj1 (Maus, 1:500, Cat#: 801201, RRID:AB_2313773, BioLegend), Anti- Gata3 (Ziege, 1:200, Cat#:AF2605, RRID: AB_2108571, R- und D-Systeme), Anti-Map2 (Kaninchen, 1:400, Cat#: M3696, RRID:AB_1840999, Sigma) und Anti-Sox10 ( Ziege, 1:200, Cat#: sc-17342, RRID:AB_2195374, Santa Cruz Biotechnology). Alle sekundären Antikörper wurden entweder von Thermo Scientific (Molecular Probes) oder Jackson ImmunoResearch Laboratory gekauft. Während des letzten Schrittes der Immunfärbung wurden die Proben mit Hoechst33342 (1:1000, Cat#: 62249, RRID:AB_2651135, Thermo Scientific)-Lösung in 1x PBS gegengefärbt, um die Zellkerne sichtbar zu machen. Die Objektträger wurden mit Prolong Gold-Anti-Fade-Eindeckmedium (Kat.-Nr.: P36930, RRID:SCR_015961, Thermo Scientific) befestigt. Alle Bilder wurden mit einem konfokalen Mikroskop Nikon NiE-A1 plus oder Nikon C2 aufgenommen und mit Image-J analysiert. Für detaillierte histologische Protokolle des Innenohrs verweisen wir auf unsere frühere Studie (Liu et al., 2010). Die RNA-in-situ-Hybridisierung wurde gemäß den zuvor beschriebenen Protokollen durchgeführt (Li et al., 2018). Die detaillierte Sequenz der RNA-Sonde für jedes Gen wurde in Ergänzungsdatei 3 aufgeführt.

Quantifizierung und statistische Analyse von tdTomato+ SGNs in Celf4-iCreER/+ Rosa26-CAG-loxp-stop-loxp-tdTomate /+ Mäuse

Zur Quantifizierung der Anzahl der tdTomato+ SGNs in den verschiedenen Cochlea-Turns von Celf4-iCreER/+ Rosa26-CAG-loxp-stop-loxp-tdTomate /+ Mäuse unterschiedlichen Alters verwendeten wir einen Kryoschnitt-Ansatz (Abbildung 6 und Abbildung 6 – Abbildungsergänzung 2D–E’’). Um SGNs in basalen, mittleren und apikalen Windungen präzise zu unterscheiden, analysierten wir nur die Innenohr-Kryosektionsscheiben, die alle drei Cochlea-Kurven enthielten (Abbildung 6B, E und H und Abbildung 6 – Abbildungsergänzung 2D–E’’). Für jeden von derselben Maus erhaltenen Schnitt haben wir pro Cochlea-Turn die Anzahl der dualen tdTomato+/Tuj1+ (oder Map2+ oder Mafb+) SGNs bestimmt und diese Zahlen dann gegen die Gesamtzahl der Tuj1+ (oder Map2+ oder Mafb+) SGNs auf . normalisiert erhalten Sie einen durchschnittlichen Prozentsatz von tdTomato+ SGNs. Diese Ergebnisse werden als Mittelwerte ± SEM dargestellt (Abbildung 6K–M und Abbildung 6 – Abbildungsergänzung 2F, n = 3 Mauszahlen/Alter). Statistische Analysen wurden mit einer Einweg-ANOVA durchgeführt, gefolgt von einer Student's T Test mit Bonferroni-Korrektur. Für alle statistischen Analysen wurde GraphPad Prism 6.0 verwendet.


Wie kann ich die Reinheit von Zellen bestimmen, die aus Rattenhirnen isoliert wurden, wenn ich FACS, Immunhistochemie oder REM-Analyse nicht verwenden kann? - Biologie

Die Echtzeit-Bildgebung von transplantierten Stammzellen ist für das Verständnis ihrer Wechselwirkungen unerlässlich in vivo mit Wirtsumgebungen, zur Verfolgung von Zellschicksal und -funktion und für eine erfolgreiche Verabreichung und Sicherheitsüberwachung im klinischen Umfeld. In dieser Studie verwendeten wir Biolumineszenz (BLI) und Magnetresonanztomographie (MRT), um das Schicksal von transplantierten humanen embryonalen Stammzellen (hESC)-abgeleiteten humanen neuralen Stammzellen (hNSCs) im Schlaganfall-geschädigten Rattenhirn zu visualisieren. Die hNSCs wurden mit einem lentiviralen Vektor gentechnisch verändert, der ein Doppelfusions-(DF)-Reportergen trägt, das die Reportergene des verstärkten grünen Fluoreszenzproteins (eGFP) und der Glühwürmchen-Luciferase (fLuc) stabil exprimiert. Die hNSCs waren selbsterneuerbar, multipotent und exprimierten Marker für neurale Stammzellen. Das Zellüberleben wurde 2 Monate nach der Transplantation nichtinvasiv durch MRT und BLI verfolgt und histologisch bestätigt. Die elektrophysiologische Aufzeichnung von gepfropften GFP + -Zellen und die Immunelektronenmikroskopie zeigten die Konnektivität. Gepfropfte hNSCs differenziert in Neuronen, in Oligodendrozyten in Schlaganfallregionen, die einer Remyelinisierung unterzogen werden, und in Astrozyten, die Prozesse in Richtung auf Schlaganfall-geschädigte Gefäße ausweiten. Unsere Daten legen nahe, dass die Kombination von BLI- und MRT-Modalitäten eine zuverlässige Echtzeitüberwachung des Zellschicksals ermöglicht.


Diskussion

Unsere Analyse ergab, dass Neuronen im erwachsenen menschlichen zerebralen Neocortex 14 C-Werte in ihrer genomischen DNA aufweisen, die den atmosphärischen Werten zum Zeitpunkt der Geburt des Individuums entsprechen, und wir konnten keine BrdU-markierten Neuronen nachweisen, was gegen die postnatale kortikale Neurogenese beim Menschen spricht .

Es ist wichtig zu betonen, dass beide unserer Ansätze zum Nachweis des Zellumsatzes im adulten Neokortex Nachweisgrenzen haben und wir eine Neurogenese unterhalb dieser Grenze nicht ausschließen können. Die retrospektive 14 C-Geburtsdatierung liefert ein kumulatives Maß, das eine hohe Sensitivität bietet, um eine geringgradige kontinuierliche Generation neuer Zellen zu erkennen, selbst wenn diese Zellen über die gesamte Lebensdauer im analysierten Bereich nur 1% der Neuronen ausmachen würden (23) . Dies erfordert jedoch, dass sich die neugeborenen Zellen stabil integrieren und erhalten bleiben. Es wurde vermutet, dass neugeborene Neuronen im Neokortex von Affen eine kurze Lebensdauer haben und nicht langfristig erhalten werden (5). Wenn solche Neuronen zu einem bestimmten Zeitpunkt <1 % der Neuronen im analysierten Bereich ausmachen, wären sie bei der gegenwärtigen Sensitivität durch retrospektive 14 C-Geburtsdatierung nicht nachweisbar.

In diesem Zusammenhang hat die BrdU-Markierung den Vorteil, dass sie neugeborene Zellen zu einem bestimmten Zeitpunkt markiert, und es wäre leicht, sehr viel weniger als 1% der markierten Neuronen zum Zeitpunkt der Analyse zu erkennen. Der Zeitraum zwischen der Verabreichung von BrdU und dem Tod der von uns analysierten Personen lag zwischen 4,2 Monaten und 4,3 Jahren. Unsere Ergebnisse zeigen somit, dass es im erwachsenen menschlichen Gehirn nur wenig (<1%) oder überhaupt eine stabile Integration von kortikalen Neuronen geben kann, und wenn es eine Produktion von transitorischen Neuronen gibt, haben diese eine Lebensdauer von <4,2 Monaten.

Darüber hinaus können wir die Informationen aus der retrospektiven Geburtsdatierung und der BrdU-Kennzeichnung integrieren, um das maximale Niveau der neokortikalen Neurogenese bei Erwachsenen abzuschätzen, das durch die Kombination beider Methoden unbemerkt bleiben könnte. Mit dem festgestellten Durchschnittsalter aller Zellen wäre die höchste theoretische Anzahl von Zellen, die im Erwachsenenalter erzeugt werden, wenn es zwei Populationen gibt, eine um die Geburt und der Rest zeitgleich. Wenn wir die vor der Geburt generierte Population auf die Geburt zum Zeitpunkt der Geburt setzen (das Durchschnittsalter der kortikalen Neuronen), können wir basierend auf dem Durchschnittsalter aller Zellen berechnen, dass eine Population, die in den letzten 5 Jahren geboren wurde (im Durchschnitt 2,5 Jahre vor der Analyse) würden 37 % aller Zellen in unserer Population ausmachen (wie für jedes Individuum berechnet, wenn das bekannte Durchschnittsalter aller Zellen dieser Person gegeben ist, stellen 37 % den Durchschnitt aller Individuen dar). Angesichts unserer BrdU-Daten wissen wir, dass maximal 1 von 516 erwachsenen Zellen Neuronen sein könnten (in unserer Studie wurden 0 von 515 BrdU-markierten Zellen als Neuronen angesehen, wir können jedoch nicht ausschließen, dass die Stichprobe größer gewesen wäre , haben wir möglicherweise BrdU+/NeuN+-Zellen entdeckt und setzen daher die Anzahl der Neuronen auf 1 von 516). Angesichts der Tatsache, dass maximal 37% der Bevölkerung in den letzten 5 Jahren umgedreht wurden, schätzen wir, dass <0,07% (0,37 von 1 von 516) der Zellen im erwachsenen menschlichen Neocortex ein Neuron darstellen könnten, das während der letzten 5 . gebildet wurde Jahre und das war stabil integriert.

Mehrere Studien haben das Vorhandensein von Zellen mit in vitro neuronales Stammzellpotential im menschlichen Kortex, einschließlich in der subkortikalen weißen Substanz (31). Unsere Ergebnisse schließen die Möglichkeit nicht aus, dass bei bestimmten Pathologien eine neokortikale Neurogenese auftritt oder diese induziert werden kann, wie dies im Nagetierkortex vorgeschlagen wurde (9, 10, 32). Unter normalen Bedingungen gibt es keine oder nur eine minimale Neurogenese im Nagetierstriatum, jedoch werden als Reaktion auf die Verabreichung von Wachstumsfaktoren oder einen Schlaganfall eine große Anzahl von Neuronen gebildet (15, 16, 33, 34). Obwohl unsere aktuelle Studie darauf hindeutet, dass beim Menschen unter normalen Bedingungen keine neokortikale Neurogenese stattfindet, wird es wichtig sein zu analysieren, ob es ein latentes Potenzial gibt, das in pathologischen Situationen zur Neurogenese führt.

Hinsichtlich des Ausmaßes der adulten Neurogenese bei Wirbeltieren gibt es deutliche Artenunterschiede. Eine große Anzahl von Neuronen kann während des gesamten Lebens bei Fischen hinzugefügt werden (35). Fische wachsen jedoch oft weiter, was als Fortsetzung der Entwicklung angesehen werden könnte. Eine beträchtliche Anzahl neuer Neuronen, einschließlich sowohl Interneuronen als auch Projektionsneuronen, werden mehreren Regionen bei Vögeln wie Zebrafinken und Kanarienvögeln hinzugefügt (36). Bei Nagetieren werden Interneurone dem Gyrus dentatus des Hippocampus und dem Bulbus olfactorius bei ausgewachsenen Tieren hinzugefügt (14). Es gibt viele Berichte, die auf mehr minderwertige Neurogenese in anderen Bereichen des Nagetierhirns hinweisen, aber viele dieser Studien warten auf ihre Bestätigung. Die Anzahl der Neuronen, die im Hippocampus und im Riechkolben von Nagetieren hinzugefügt werden, nimmt mit dem Alter erheblich ab, obwohl die Neurogenese während des gesamten Lebens auf niedrigem Niveau anhält. 3 H-Thymidin-Studien zeigten ursprünglich, dass es im Gehirn von Primaten weniger Neurogenese bei Erwachsenen gibt (37, 38), und spätere Studien mit BrdU zeigten im Vergleich zu Nagetieren eine relativ geringere Neurogenese im Gyrus dentatus und im Bulbus olfactorius (39–41). . Eine Studie zeigte Neurogenese im erwachsenen menschlichen Gyrus dentatus (30), aber es bleibt umstritten, ob dem erwachsenen menschlichen Riechkolben Neuronen hinzugefügt werden (42, 43). Somit scheint die Verbreitung der Neurogenese bei Erwachsenen im Laufe der Evolution allmählich eingeschränkter geworden zu sein, obwohl noch immer nur begrenzte Informationen über das Ausmaß und die Verteilung der Neurogenese im erwachsenen menschlichen Gehirn verfügbar sind.

Plastizität ist ein wichtiger Aspekt der kortikalen Funktion und wird beispielsweise für die Integration neuer Erinnerungen benötigt. Es ist auch leicht zu erkennen, wie wichtig Stabilität beispielsweise für die Aufrechterhaltung von Erinnerungen ist. Es muss ein empfindliches Gleichgewicht zwischen Plastizität und Stabilität bestehen, und das Fehlen einer humanen neokortikalen Neurogenese legt nahe, dass die zelluläre Stabilität begünstigt wurde.


Der Handel mit Immunzellen aus dem Gehirn erhält die ZNS-Immuntoleranz aufrecht

1 Laboratory of Neuroinflammation, St. Vincent’s Center for Applied Medical Research und University of New South Wales, Sydney, New South Wales, Australien. 2 School of Biomedical Sciences und Queensland Brain Institute, University of Queensland, Brisbane, Queensland, Australien. 3 Telethon Institute for Child Health Research, University of Western Australia, Perth, Western Australia, Australien. 4 Labor für neuronale Struktur und Funktion, Salk Institute for Biological Studies, La Jolla, Kalifornien, USA.

Adresskorrespondenz an: David A. Brown, Laboratory of Neuroinflammation, St. Vincent’s Center for Applied Medical Research, 405 Liverpool St., Sydney 2010, New South Wales, Australien. Telefon: 61.02.8382.4952 Fax: 61.02.8382.4971 E-Mail: [email protected]

Hinweis zur Autorenschaft: Mohammad G. Mohammad und Vicky W.W. Tsai trug gleichermaßen zu dieser Arbeit bei.

Artikel von Mohammad, M. finden in: JCI | PubMed | Google Scholar

1 Laboratory of Neuroinflammation, St. Vincent’s Center for Applied Medical Research und University of New South Wales, Sydney, New South Wales, Australien. 2 School of Biomedical Sciences und Queensland Brain Institute, University of Queensland, Brisbane, Queensland, Australien. 3 Telethon Institute for Child Health Research, University of Western Australia, Perth, Western Australia, Australien. 4 Labor für neuronale Struktur und Funktion, Salk Institute for Biological Studies, La Jolla, Kalifornien, USA.

Adresskorrespondenz an: David A. Brown, Laboratory of Neuroinflammation, St.Vincent’s Center for Applied Medical Research, 405 Liverpool St., Sydney 2010, New South Wales, Australien. Telefon: 61.02.8382.4952 Fax: 61.02.8382.4971 E-Mail: [email protected]

Hinweis zur Autorenschaft: Mohammad G. Mohammad und Vicky W.W. Tsai trug gleichermaßen zu dieser Arbeit bei.

1 Laboratory of Neuroinflammation, St. Vincent’s Center for Applied Medical Research und University of New South Wales, Sydney, New South Wales, Australien. 2 School of Biomedical Sciences und Queensland Brain Institute, University of Queensland, Brisbane, Queensland, Australien. 3 Telethon Institute for Child Health Research, University of Western Australia, Perth, Western Australia, Australien. 4 Labor für neuronale Struktur und Funktion, Salk Institute for Biological Studies, La Jolla, Kalifornien, USA.

Adresskorrespondenz an: David A. Brown, Laboratory of Neuroinflammation, St. Vincent’s Center for Applied Medical Research, 405 Liverpool St., Sydney 2010, New South Wales, Australien. Telefon: 61.02.8382.4952 Fax: 61.02.8382.4971 E-Mail: [email protected]

Hinweis zur Autorenschaft: Mohammad G. Mohammad und Vicky W.W. Tsai trug gleichermaßen zu dieser Arbeit bei.

Artikel von Ruitenberg, M. finden in: JCI | PubMed | Google Scholar

1 Laboratory of Neuroinflammation, St. Vincent’s Center for Applied Medical Research und University of New South Wales, Sydney, New South Wales, Australien. 2 School of Biomedical Sciences und Queensland Brain Institute, University of Queensland, Brisbane, Queensland, Australien. 3 Telethon Institute for Child Health Research, University of Western Australia, Perth, Western Australia, Australien. 4 Labor für neuronale Struktur und Funktion, Salk Institute for Biological Studies, La Jolla, Kalifornien, USA.

Adresskorrespondenz an: David A. Brown, Laboratory of Neuroinflammation, St. Vincent’s Center for Applied Medical Research, 405 Liverpool St., Sydney 2010, New South Wales, Australien. Telefon: 61.02.8382.4952 Fax: 61.02.8382.4971 E-Mail: [email protected]

Hinweis zur Autorenschaft: Mohammad G. Mohammad und Vicky W.W. Tsai trug gleichermaßen zu dieser Arbeit bei.

Artikel von Hassanpour, M. finden in: JCI | PubMed | Google Scholar

1 Laboratory of Neuroinflammation, St. Vincent’s Center for Applied Medical Research und University of New South Wales, Sydney, New South Wales, Australien. 2 School of Biomedical Sciences und Queensland Brain Institute, University of Queensland, Brisbane, Queensland, Australien. 3 Telethon Institute for Child Health Research, University of Western Australia, Perth, Western Australia, Australien. 4 Labor für neuronale Struktur und Funktion, Salk Institute for Biological Studies, La Jolla, Kalifornien, USA.

Adresskorrespondenz an: David A. Brown, Laboratory of Neuroinflammation, St. Vincent’s Center for Applied Medical Research, 405 Liverpool St., Sydney 2010, New South Wales, Australien. Telefon: 61.02.8382.4952 Fax: 61.02.8382.4971 E-Mail: [email protected]

Hinweis zur Autorenschaft: Mohammad G. Mohammad und Vicky W.W. Tsai trug gleichermaßen zu dieser Arbeit bei.

1 Laboratory of Neuroinflammation, St. Vincent’s Center for Applied Medical Research und University of New South Wales, Sydney, New South Wales, Australien. 2 School of Biomedical Sciences und Queensland Brain Institute, University of Queensland, Brisbane, Queensland, Australien. 3 Telethon Institute for Child Health Research, University of Western Australia, Perth, Western Australia, Australien. 4 Labor für neuronale Struktur und Funktion, Salk Institute for Biological Studies, La Jolla, Kalifornien, USA.

Adresskorrespondenz an: David A. Brown, Laboratory of Neuroinflammation, St. Vincent’s Center for Applied Medical Research, 405 Liverpool St., Sydney 2010, New South Wales, Australien. Telefon: 61.02.8382.4952 Fax: 61.02.8382.4971 E-Mail: [email protected]

Hinweis zur Autorenschaft: Mohammad G. Mohammad und Vicky W.W. Tsai trug gleichermaßen zu dieser Arbeit bei.

1 Laboratory of Neuroinflammation, St. Vincent’s Center for Applied Medical Research und University of New South Wales, Sydney, New South Wales, Australien. 2 School of Biomedical Sciences und Queensland Brain Institute, University of Queensland, Brisbane, Queensland, Australien. 3 Telethon Institute for Child Health Research, University of Western Australia, Perth, Western Australia, Australien. 4 Labor für neuronale Struktur und Funktion, Salk Institute for Biological Studies, La Jolla, Kalifornien, USA.

Adresskorrespondenz an: David A. Brown, Laboratory of Neuroinflammation, St. Vincent’s Center for Applied Medical Research, 405 Liverpool St., Sydney 2010, New South Wales, Australien. Telefon: 61.02.8382.4952 Fax: 61.02.8382.4971 E-Mail: [email protected]

Hinweis zur Autorenschaft: Mohammad G. Mohammad und Vicky W.W. Tsai trug gleichermaßen zu dieser Arbeit bei.

1 Laboratory of Neuroinflammation, St. Vincent’s Center for Applied Medical Research und University of New South Wales, Sydney, New South Wales, Australien. 2 School of Biomedical Sciences und Queensland Brain Institute, University of Queensland, Brisbane, Queensland, Australien. 3 Telethon Institute for Child Health Research, University of Western Australia, Perth, Western Australia, Australien. 4 Labor für neuronale Struktur und Funktion, Salk Institute for Biological Studies, La Jolla, Kalifornien, USA.

Adresskorrespondenz an: David A. Brown, Laboratory of Neuroinflammation, St. Vincent’s Center for Applied Medical Research, 405 Liverpool St., Sydney 2010, New South Wales, Australien. Telefon: 61.02.8382.4952 Fax: 61.02.8382.4971 E-Mail: [email protected]

Hinweis zur Autorenschaft: Mohammad G. Mohammad und Vicky W.W. Tsai trug gleichermaßen zu dieser Arbeit bei.

Artikel von Sawchenko, P. finden in: JCI | PubMed | Google Scholar

1 Laboratory of Neuroinflammation, St. Vincent’s Center for Applied Medical Research und University of New South Wales, Sydney, New South Wales, Australien. 2 School of Biomedical Sciences und Queensland Brain Institute, University of Queensland, Brisbane, Queensland, Australien. 3 Telethon Institute for Child Health Research, University of Western Australia, Perth, Western Australia, Australien. 4 Labor für neuronale Struktur und Funktion, Salk Institute for Biological Studies, La Jolla, Kalifornien, USA.

Adresskorrespondenz an: David A. Brown, Laboratory of Neuroinflammation, St. Vincent’s Center for Applied Medical Research, 405 Liverpool St., Sydney 2010, New South Wales, Australien. Telefon: 61.02.8382.4952 Fax: 61.02.8382.4971 E-Mail: [email protected]

Hinweis zur Autorenschaft: Mohammad G. Mohammad und Vicky W.W. Tsai trug gleichermaßen zu dieser Arbeit bei.

Veröffentlicht am 24. Februar 2014 - Mehr Infos

Verwandter Artikel:

Neurogenese oder Nicht-Neurogenese: Das ist hier die Frage

Neurogenese oder Nicht-Neurogenese: Das ist hier die Frage

Abstrakt

Neurale Stamm-/Vorläuferzellen (NPCs), die sich in Keimnischen des adulten ZNS befinden, haben komplexere Aufgaben als bisher erwartet. Zusätzlich zu ihren gut dokumentierten neurogenen Funktionen deuten neue Erkenntnisse darauf hin, dass NPCs nicht-neurogene Funktionen ausüben, die zur Regulierung und Erhaltung der Gewebehomöostase sowohl unter physiologischen als auch unter pathologischen Bedingungen beitragen. In dieser Ausgabe des JCI beschreiben Mohammad et al. fanden heraus, dass DCs das ZNS nur dann effizient patrouillieren, wenn die Keimnische der subventrikulären Zone richtig funktioniert. Tatsächlich wanderten DCs von den Ventrikeln entlang des rostralen Migrationsstroms zum Bulbus olfactorius (einem Zugangspunkt für zervikale Lymphknoten), um die Anti-ZNS-Immunantworten zu dämpfen. Die Ergebnisse der Autoren unterstützen außerdem eine nicht-neurogene Rolle von NPCs bei der Aufrechterhaltung der Gewebehomöostase und der Förderung des Gewebeschutzes im erwachsenen Gehirn.

Autoren

Gianvito Martino, Erica Butti, Marco Bacigaluppi

Im ZNS wurde kein der Immunüberwachung gewidmeter Weg zur Verhinderung der Anti-ZNS-Immunantworten charakterisiert, die sich bei einer neuroinflammatorischen Autoimmunerkrankung entwickeln. Hier haben wir einen Weg für Immunzellen zum Verkehr vom Gehirn identifiziert, der mit dem rostralen Migrationsstrom (RMS) verbunden ist, der eine Quelle neu erzeugter Neuronen im Vorderhirn ist. Die Auswertung der Migration von fluoreszenzmarkierten Leukozyten bei Mäusen ergab, dass DCs über das RMS vom ZNS zu den zervikalen LNs (CxLNs) wandern, wo sie T-Zellen Antigen präsentieren. Die pharmakologische Unterbrechung des Immunzellverkehrs mit dem mononukleären zellsequestrierenden Medikament Fingolimod beeinflusste die Anti-ZNS-T-Zell-Antworten in den CxLNs und modulierte den experimentellen Schweregrad der autoimmunen Enzephalomyelitis (EAE) in einem Mausmodell für Multiple Sklerose (MS). Die Fingolimod-Behandlung induzierte auch EAE in einem krankheitsresistenten transgenen Mausstamm, indem sie die DC-vermittelten Treg-Funktionen in CxLNs veränderte und die ZNS-Immuntoleranz störte. Diese Daten beschreiben einen Immunzellweg, der vom ZNS ausgeht und in der Lage ist, Anti-ZNS-Immunantworten in der Peripherie zu dämpfen. Darüber hinaus geben diese Daten einen Einblick, wie eine Fingolimod-Behandlung in einigen Fällen eine ZNS-Neuroinflammation verschlimmern könnte und legen nahe, dass fokale therapeutische Interventionen außerhalb des ZNS das Potenzial haben, die Anti-ZNS-Immunität selektiv zu modifizieren.

Seit den Arbeiten von Sheri und denen von Murphy und Sturm ( 1 ) ist das vorherrschende Paradigma, dass der inerte immunologische Status des ZNS-Parenchyms durch den Ausschluss von Schlüsselkomponenten des Immunsystems aufrechterhalten wird. Inzwischen ist jedoch bekannt, dass systemische T-Lymphozyten, die vom Plexus choroideus rekrutiert werden (2), normalerweise das ZNS passieren und an der Immunüberwachung teilnehmen (3). Krankheitsfördernde Th-Zellen durchdringen auch direkt die intakte Blut-Hirn-Schranke (4), und zirkulierende APCs können unter normalen Bedingungen auch in das ZNS-Parenchym eindringen (5), wodurch der Eintritt pathogener T-Zellen vermittelt wird (6). Die Tatsache, dass das periphere Immunsystem bei Gesundheit und Krankheit Zugang zum ZNS ( 7 – 9 ) hat, wirft die Frage auf, ob aktive Mechanismen das ZNS-Immunprivileg regulieren. Außerhalb etablierter neuroendokriner Wege (10) ist jedoch kein Mechanismus definiert, durch den das Gehirn gegen sich selbst gerichtete systemische Immunantworten negativ regulieren kann. In anderen Organen wirken APCs zusammen mit entwässernden LNs, um die T-Zell-Aktivierung zu fördern oder zu verzögern und so organspezifische adaptive Immunantworten zu regulieren (11). Ein herausragendes Beispiel für dieses Konzept ist die Leber, die die Immunität gegen sich selbst so weit regulieren kann, dass MHC-fehlgepaarte Transplantate ohne wesentliche immunsuppressive Therapie akzeptiert werden können (12). Dies geschieht teilweise aufgrund der erhöhten Treg-Funktion, die durch DCs vermittelt werden kann, die in den drainierenden LNs gefunden werden (11, 12).

Während die der Immunüberwachung im normalen ZNS zugrunde liegenden Mechanismen nicht gut verstanden sind, wurde die Rolle des Immunsystems bei der entzündlichen ZNS-Krankheit MS und ihrem Tiermodell, EAE, umfassend untersucht. Diese Studien weisen darauf hin, dass die zervikalen LNs (CxLNs) eine Hauptstelle für die systemische Aktivierung von ZNS-spezifischen T-Zellen sind (13). Die CxLNs erhalten Input vom ZNS in Form von Antigenen und möglicherweise DCs ( 14 ) und sind ein Ort für die Aktivierung destruktiver Anti-ZNS-Immunantworten ( 7 – 9 , 14 ). Es gibt jedoch auch Daten, die auf die Existenz immunregulatorischer Mechanismen hindeuten, die die ZNS-Integrität an dieser Stelle aufrechterhalten und/oder wiederherstellen (15). Tierstudien weisen darauf hin, dass autoreaktive ZNS-T-Zellen an der Aufrechterhaltung der ZNS-Gesundheit beteiligt sind (16, 17). Klinische Daten legen nahe, dass solche autoreaktiven ZNS-T-Zellen sogar an der Genesung von autoimmunen neuroinflammatorischen Erkrankungen wie MS beteiligt sind (15). Interessanterweise unterbricht ein kürzlich zugelassenes MS-Therapeutikum, Fingolimod (auch bekannt als FTY oder FTY720), den Handel mit ZNS-reaktiven T-Zellen. Dieses Medikament, ein Sphingosin-1-Phosphat-Rezeptor (S1PR)-Inhibitor, verhindert den Austritt von Lymphozyten aus LNs (18). Fingolimod verhindert auch die DC-Migration von peripheren Organen zu LNs (19, 20) und steigert die Treg-Funktion (21). Während angenommen wird, dass seine dominante Wirkung auf die Sequestrierung autoreaktiver T-Zellen in den LNs zurückzuführen ist, ist es möglich, dass seine anderen Wirkungen auf den Nicht-T-Zell-Immunzellverkehr ebenfalls folgen.

Hier haben wir mit Fingolimod-Behandlung und einer Vielzahl anderer Methoden den DC-Verkehr vom ZNS zum systemischen Immunkompartiment identifiziert und charakterisiert. Dieser Weg modulierte direkt die Treg-Funktion in den CxLNs und reduzierte autoinflammatorische ZNS-Erkrankungen, was darauf hindeutet, dass er letztendlich das Eindringen von pathogenen T-Zellen in das ZNS verhindert. Die Unterbrechung dieses Signalwegs durch eine lokalisierte Infusion von Fingolimod führte zu einer verringerten ZNS-Immuntoleranz, verstärkten Anti-ZNS-Autoimmunreaktionen und einer entzündlichen ZNS-Erkrankung.

CD11c + -Zellen sind mit dem rostralen Migrationsstrom (RMS) assoziiert. APCs sind im Plexus choroideus und in den Meningen vorhanden ( 22 ), ihre Lokalisation im Gehirnparenchym bei Gesundheit ist jedoch umstritten ( 23 , 24 ). Unsere Untersuchung des normalen Mausgehirns mit dualer Immunmarkierung zeigte eine Assoziation von CD11c + -Zellen mit dem RMS, einem Weg, auf dem Neuroblasten vom lateralen Ventrikel zum Riechkolben (OB) wandern, um olfaktorische Interneurone zu ersetzen (Abbildung 1A). CD11c + -Zellen wurden im gesamten RMS gefunden (Abbildung 1B), einschließlich seines terminalen Felds, der Körnerzellschicht des OB. Darüber hinaus wurden diese Zellen in der glomerulären Schicht neben der kribriformen Platte gefunden. Die Verteilung von CD11c + -Zellen entlang des RMS und bis in den OB hinein deutet darauf hin, dass dies ein wichtiger Bereich für die ZNS-Immunregulation sein könnte. Wir untersuchten daher das RMS und die umgebenden Strukturen der weißen und grauen Substanz auf das Vorhandensein von CD11c + -Zellen. In den Gehirnen normaler, spezifischer pathogenfreier Mäuse wurden CD11c + -Zellen bevorzugt mit signifikant höherer Dichte mit der RMS assoziiert als mit umgebenden Strukturen der weißen oder grauen Substanz (Abbildung 1C). Um diese mutmaßlichen DCs weiter zu charakterisieren, isolierten wir CD11c + -Zellen aus 10 normalen Mäusen und untersuchten sie durch fluoreszenzaktivierte Zellsortierung (FACS). Sie waren überwiegend CD11c + CD11b + DCs, zusammen mit typischen plasmazytoiden DCs (pDCs) und einer Population anderer DC-Phänotypen (Abbildung 1D und ergänzende Abbildung 2 ergänzendes Material online verfügbar mit diesem Artikel doi: 10.1172/JCI71544DS1). Um die Möglichkeit zu untersuchen, dass die spezialisierten Makrophagen-ähnlichen Zellen des Gehirns, die als Mikroglia bekannt sind, CD11c exprimieren könnten, führten wir weitere konfokale Untersuchungen von Hirnschnitten durch, um die anatomische Position der CD11c + -Zellen zu bestimmen und zu bestätigen, dass es sich tatsächlich um DCs handelte. Dies zeigte das Vorhandensein von CD11c + CD11b – Zellen im Plexus choroideus und in Verbindung mit dem RMS (Abbildung 1, E und F) deutete das Fehlen von CD11b auf diesen Zellen darauf hin, dass es sich um echte DCs handelte. Diese Zellen und eine Untergruppe von CD11c + CD11b + -Zellen hatten ein ähnliches Aussehen, das sich deutlich von dem der residenten CD11b + CD11c-Mikroglia unterschied (Abbildung 1F). Schließlich stellten wir fest, dass ein erheblicher Teil dieser RMS-DCs wirklich im Parenchym lokalisiert war (Abbildung 2).

Immunzellen sind mit dem RMS assoziiert. (EIN) Sagittalschnitte wurden mit IHC für CD11c markiert, gefolgt von IF-Färbung für DCX (grün), was den Verlauf des RMS von der subventrikulären Zone zum OB zeigt. AOV, ventraler anteriorer Riechkern ACB, Nucleus accumbens CP, Putamen caudatus. Kästchen zeigt die Region an, die bei höherer Vergrößerung in . angezeigt wird B. (B) Das RMS, das CD11c-Zellen (rote Pfeilspitzen) in enger Verbindung mit wandernden DCX + Neuroblasten zeigt. (C) CD11c + -Zellen im RMS wurden in mindestens 5 Abschnitten gezählt. Das Corpus callosum (CC) und der frontale Cortex (FCx) in den gleichen Schnitten wurden ähnlich untersucht. Die Daten repräsentieren den Mittelwert ± SEM. *P < 0,001 vs. RMS. (D) Phänotypische Analyse von CD11c + -Zellen, die aus 10 Vorderhirnen von Mäusen isoliert wurden (zur Gating-Strategie siehe ergänzende Abbildung 2). CD11c + CD11b + -Zellen machten 70 % der DCs aus, pDCs repräsentierten 10 % und der Rest gehörte zu anderen CD11c + CD11b – DC-Untergruppen (3 unabhängige Experimente). (E) Konfokale ZF-Bilder für DCX (grün), CD11b (blau) und CD11c (rot). CD11c + (rote Pfeilspitze) und CD11b + (blaue Pfeilspitze) werden im Plexus choroideus neben der subventrikulären DCX + -Zone bei normalen Mäusen identifiziert. (F) CD11c + CD11b + DCs (blauer Pfeil), CD11c + CD11b – DCs (roter Pfeil) und CD11b + Mikroglia (weiße Pfeile) in enger Assoziation mit dem RMS (grüner DCX). Maßstabsbalken: 250 μm (EIN) 25 μm (B) 10 μm (E und F).

Die Mehrheit der RMS CD11c + -Zellen ist nicht mit zerebralen Gefäßen assoziiert. Um zu zeigen, dass CD11c + -Zellen im RMS intraparenchymal waren, führten wir mit konfokaler Mikroskopie serielle optische Schnitte (1-μm-Schritte) durch das RMS durch (n = 5). Die Schnitte wurden mit DCX (RMS grün), CD11c (DCs rot) und CD31 (vaskuläres Endothel blau) gefärbt. Gezeigt ist eine repräsentative Serie, die eine typische perivaskuläre CD11c + -Zelle (blauer Pfeil) und 2 Beispiele der verschiedenen CD11c + -Zellen im RMS zeigt, die keinem Gefäßsystem zugeordnet waren (rote Pfeile). Maßstabsbalken: 100 μm.

CD11c + -Zellen im RMS sind DCs, die aus dem Kreislauf stammen. Um den Ursprung der im RMS vorhandenen DCs zu ermitteln, wurden chimäre Mäuse durch Transplantieren von BM aus syngenen C57BL/6-Mäusen, die GFP exprimieren, unter der Kontrolle des Cx3cr1 Promotor, der in Zellen der Monozyten-Linie aktiv ist (25). 12 Wochen nach BM-Transplantation waren GFP + CD11b – Zellen im Verlauf des RMS und seines terminalen Feldes vorhanden. Die parenchymale Verteilung dieser Zellen war der von normalen, nicht manipulierten Mäusen ähnlich, während die Koexpression von GFP einen Hinweis auf ihren peripheren Ursprung (und nicht auf das ZNS) lieferte. Mittels konfokaler Multilabel-Mikroskopie identifizierten wir Untergruppen von GFP + CD11b + und GFP + CD11b – Zellen. Diese Zellen waren wieder im Plexus choroideus neben dem Ursprung des RMS und im gesamten RMS und seinem terminalen Feld vorhanden (Abbildung 3, A und B), was auf das Vorhandensein sowohl konventioneller (CD11c + CD11b + ) als auch nichtkonventioneller ( CD11c + CD11b – ) DCs in dieser Region. Bei Makrophagen wird die Rekrutierung des Plexus choroideus durch VLA4 für die Anheftung und CD73 für die Migration durch das Aderhautepithel vermittelt (26). Tatsächlich führte die systemische Behandlung von Mäusen mit dem CD73-Inhibitor Methylen-ADP zu signifikanten Veränderungen der Makrophagenzahlen, aber nicht der DC-Zahlen (Ergänzende Abbildung 1), was darauf hindeutet, dass die DC-Migration in das ZNS nicht durch CD73 moduliert wird. Nichtsdestotrotz ist das Vorkommen von CD11c + CD11b – Zellen mit peripherem, zirkulierendem Ursprung ein starker Beweis dafür, dass echte DCs tatsächlich im ZNS von Erwachsenen vorhanden sind.

Blutabgeleitete DCs werden für das RMS rekrutiert. Cx3cr1 +/gfp -to-WT BM chimäre Mäuse wurden 12 Wochen nach der BMT getötet. Hirnschnitte wurden für DCX (blau), CD11b (blau oder rot) und/oder CD11c (rot) markiert. Die GFP-Fluoreszenz ist grün dargestellt. (EIN) Konfokale Bilder, die das Vorhandensein sowohl von GFP + CD11c + -Zellen (roter Pfeil) als auch von GFP + CD11b + -Zellen (blauer Pfeil, d. h. von Spender-BM abgeleitet) im Plexus choroideus zeigen. (B) GFP + CD11b – aus dem Blutkreislauf stammende Zellen, vermutlich Nicht-Makrophagen/Mikroglia und daher DCs, wurden erneut in enger Assoziation mit dem RMS (roter Pfeil) neben GFP – CD11b + (weiße Pfeile) und GFP + CD11b + -Zellen gesehen. Maßstabsbalken: 10 µm.

DCs migrieren vom CNS zu den CxLNs. Um zu bestimmen, ob Leukozyten, die zum ZNS rekrutiert werden, zu den CxLNs wandern könnten, infundierten wir CFSE, ein lebenswichtiges Fluorochrom, das Leukozyten stabil markiert und so ihre Migration verfolgen kann. Nach 7 Tagen kontinuierlicher intrazerebroventrikulärer (icv) Infusion von CFSE in einen seitlichen Ventrikel neben dem Plexus choroideus wurden CFSE-markierte Immunzellen in den CxLNs (Abbildung 4A), aber nicht in anderen sekundären peripheren Immunorganen, einschließlich der Leisten-LNs, nachgewiesen (Abbildung 4B) und Milz (Daten nicht gezeigt). Diese Ergebnisse weisen darauf hin, dass sich CFSE-markierte Zellen in den CxLNs aufgrund einer lymphatischen Drainage aus dem ZNS anhäuften.

Leukozyten wandern vom ZNS zu CxLNs. In icv-kanülierten Mäusen wurden nach 7 Tagen CFSE-Infusion CxLN CD45 + -Zellen gegatet und auf CFSE-Markierung untersucht. (EIN) CFSE-markierte Zellen wurden bei allen Mäusen festgestellt. Der Prozentsatz an CFSE + -Zellen ist angegeben. (B) Das gleiche Experiment wiederholt mit Fingolimod oder Vehikel, verabreicht i.p. (n = 6 3 unabhängige Experimente), beginnend 1 Tag vor der Implantation der icv-Kanüle. Zum Gating von CFSE + CxLN- und ILN-Monozyten siehe ergänzende Abbildung 4. Oben: Vehikel-behandelte Mäuse (großer Pfeil) hatten erhebliche Populationen von CFSE + mutmaßlichen Makrophagen (CD45 + CD3 – B220 – CD11c – CD11b + ), die signifikant reduziert waren in CxLNs von Fingolimod-behandelten Mäusen (kleiner Pfeil) und fehlen in ILNs von entweder Vehikel- oder Arzneimittel-behandelten Mäusen. Unten: CFSE + DCs (CD45 + CD3 – CD11c + ) wurden nur in CxLNs von Vehikel-behandelten Mäusen (Pfeil) beobachtet und ihre Akkumulation wurde durch systemische Fingolimod-Behandlung vollständig gehemmt. (C) Mäusen, denen CFSE mit einer icv-Kanüle infundiert wurde, wurde das Gehirn entfernt und mononukleare Zellen wurden für FACS extrahiert. Oben: Ansammlung von DC und Makrophagen/PMN im Gehirn von kanülierten Mäusen. Unten: Um festzustellen, welche Zelltypen sich als Folge einer Verletzung im Zusammenhang mit der icv-Kanülierung angesammelt haben könnten, verabreichten wir auch Fingolimod (6 μg/d) oder Vehikel (n = 6 3 unabhängige Experimente) i.p. bei nicht kanülierten Mäusen, die eine erhöhte Häufigkeit von DCs im ZNS zeigten, wie durch FACS bewertet (P = 0,018), ohne Unterschiede in den entsprechenden Makrophagen/PMN- oder T-Zellzahlen. Die Daten repräsentieren den Mittelwert ± SEM. *P < 0,05.

Wenn CFSE-markierte Zellen das Gehirn verlassen haben, sollte eine pharmakologische Unterbrechung dieses Prozesses zu ihrer Retention im ZNS führen. Wir verwendeten daher Fingolimod, von dem bekannt ist, dass es den Lymphozyten- und DC-Transport verändert (19). Wir wiederholten das vorhergehende Experiment, gaben diesmal aber auch Mäusen täglich i.p. Injektionen von Fingolimod oder Vehikel, beginnend vor der icv-Kanülierung und über den gesamten Zeitraum der CFSE-Infusion. Bei mit Vehikel behandelten Mäusen erschienen CFSE-markierte Leukozyten in den CxLNs von Mäusen, die nach Beendigung der CFSE-Infusion getötet wurden, und diese Akkumulation wurde durch systemische Fingolimod-Behandlung gehemmt ( 4B ). Es gab keine signifikante Akkumulation von CD45 + CFSE + -Ereignissen in den Leisten-LNs (ILNs) von weder mit Fingolimod noch mit Vehikel behandelten Mäusen ( 4B ). Als nächstes charakterisierten wir die Zusammensetzung von Zellen, die mit CFSE im ZNS markiert waren und zu den CxLNs gewandert waren. Angesichts der durch die Kanülierung induzierten Verletzung ist es vielleicht nicht überraschend, dass die Mehrheit der Zellen, die zu den CxLNs wanderten, CD11b + waren, mit Vorwärts- und Seitenstreuungseigenschaften von Makrophagen. In Übereinstimmung mit der Vermittlung der Makrophagenmigration durch S1P ( 27 ) hemmte Fingolimod fast vollständig ihren Transit zu den CxLNs ( 4B ). Der zweithäufigste CFSE-markierte Zelltyp, der in den CxLNs gefunden wurde, war CD3 – CD11c + DCs, deren Akkumulation ebenfalls durch Fingolimod gehemmt wurde (Abbildung 4B). In CxLNs von CFSE-infundierten Mäusen wurden praktisch keine CFSE + CD3 + CD4 + T-Zellen identifiziert (Daten nicht gezeigt). In Übereinstimmung mit diesem Befund führte die systemische Fingolimod-Behandlung zu einer Akkumulation dieser Zelltypen im ZNS (Abbildung 4C). Das Fehlen einer weit verbreiteten CFSE-Färbung in den CxLNs von Mäusen, die mit systemischem Fingolimod behandelt wurden, und die Beschränkung der CFSE-Färbung auf spezifische Leukozyten-Untergruppen deuteten ebenfalls darauf hin, dass ein unspezifischer Farbstoffverlust in die CxLNs kein Störfaktor war.

Eine systemische Behandlung mit Fingolimod führt zu einer Akkumulation von DC im normalen ZNS. Nachdem wir festgestellt hatten, dass die Behandlung mit Fingolimod den Austritt von Leukozyten aus dem Gehirn praktisch beseitigte, bestimmten wir als nächstes, welche Leukozyten in gesunden Gehirnen bevorzugt zurückgehalten wurden. Diese Experimente wurden an Mäusen durchgeführt, die nicht die Verletzung erlitten hatten, die aufgrund der ZNS-Kanülierung auftrat. Mäuse erhielten täglich eine systemische (i.p.) Behandlung mit Fingolimod oder Vehikel. Ähnlich wie bei Mäusen, die sich einer icv-Kanülierung unterzogen, führte die systemische Fingolimod-Behandlung von nicht kanülierten Mäusen zu einer signifikant höheren Akkumulation von DCs im ZNS (Abbildung 4C). Um die Möglichkeit auszuschließen, dass dies aus unvorhergesehenen Gründen mit einer erhöhten Mikroglia-Aktivierung zusammenhängt, haben wir CD3 – CD11c + CD11b – DCs weiter quantifiziert, da diese aufgrund des Fehlens von CD11b keine klassischen Mikroglia sein konnten. Wir fanden auch eine signifikante Zunahme dieser Zellen mit Fingolimod-Behandlung (Abbildung 4C). Diese Ergebnisse deuten darauf hin, dass der Eintritt und Austritt von DC aus dem ZNS wahrscheinlich durch unterschiedliche Mechanismen reguliert werden, da ihr Austritt (aber nicht die Akkumulation) zumindest teilweise durch Fingolimod moduliert wurde. In Ermangelung einer Kanülierung war die Behandlung mit Fingolimod nicht mit signifikanten Unterschieden in der Akkumulation der Untergruppe CD45 hi CD11c – CD11b + Makrophagen/polymorphkernige Zellen (Makrophagen/PMN) verbunden (Abbildung 4C).

Eine systemische Behandlung mit Fingolimod verändert die CD11c + -Zellverteilung entlang des RMS. Unsere früheren Experimente zeigten, dass die Mehrheit der CD11c + -Zellen außerhalb der normalen ZNS-Trägerstrukturen mit dem RMS assoziiert waren (Abbildung 1). Basierend auf diesem Befund kamen wir zu dem Schluss, dass, wenn der Austritt dieser Zellen durch eine systemische Fingolimod-Therapie reguliert wird und wenn sie mit migrierenden Neuroblasten vom proximalen zum distalen RMS wandern, die Fingolimod-Behandlung zu ihrer Akkumulation im distalen RMS führen sollte. Darüber hinaus sollte es keine signifikante Änderung der CD11c + -Zellzahlen im proximalen RMS geben, da die Fingolimod-Therapie ihre Rekrutierung nicht zu beeinflussen schien. Vergleich von Fingolimod- und Vehikel-behandelten Mäusen (n = 6 pro Gruppe) zeigte einen signifikanten Unterschied in der Verteilung von CD11c + -Zellen entlang des RMS. Wie vorhergesagt, wiesen CD11c + -Zellen in beiden Gruppen die gleiche Dichte in proximalen Teilen des RMS auf (Abbildung 5A). Die Dichte der CD11c + -Zellen nahm jedoch in den distaleren Teilen des RMS-terminalen Felds zu und erreichte nach der Fingolimod-Behandlung einen Höhepunkt in der ventralen glomerulären Schicht des OB, angrenzend an die cribrosa Platte (Abbildung 5, A und B). Diese Beobachtungen legen nahe, dass die Wanderung von CD11c + -Zellen entlang der RMS zu diesem Zeitpunkt durch die Fingolimod-Therapie gestoppt wurde. Als nächstes versuchten wir festzustellen, ob DCs tatsächlich entlang des RMS migrieren.

CD11c + -Zellen werden zum proximalen RMS rekrutiert und wandern zum OB, und RMS-Unterbrechungen führen zu ihrer Akkumulation. (EIN) Mit i.p. Fingolimod-Behandlung (n = 5), blieb die Häufigkeit von CD11c + -Zellen im proximalen RMS (RMS O ) unverändert. Allerdings stieg die CD11c+-Zelldichte im terminalen Feld des RMS signifikant an (P = 0,042) und wurde im ventralen Teil des OB weiter angereichert (VOB P = 0.014). (B) Repräsentative Schnitte des ventralen OB, die akkumulierte CD11c + -Zellen in mit Fingolimod behandelten Mäusen im Vergleich zu Vehikelkontrollen zeigen. (C) CFSE-markierte BMDCs wurden icv (n = 3/Gruppe). CFSE + -Zellen (grün) waren nach 16 Stunden (oben) im proximal-mittleren RMS (DCX, rot) vorhanden und hatten nach 24 Stunden (unten) den OB erreicht. (D) Das RMS wurde mit einer 7-tägigen icv-ARA-c-Infusion abgetragen. Es gab signifikant weniger CD11c + DCs im proximalen Bereich des ablatierten RMS (P = 0.04, n = 3/Gruppe). (E) Bei ähnlich behandelten Mäusen zeigte die FACS-Analyse mononukleärer ZNS-Zellen aus dem Vorderhirn jedoch signifikant erhöhte Makrophagen und DCs, ähnlich wie bei einer systemischen Fingolimod-Behandlung (P = 0.03, n = 6 2 unabhängige Experimente). (F) Repräsentative FACS-Plots, die CFSE-markierte DCs zeigen, die vom ZNS zu CxLNs gewandert waren, isoliert 48 Stunden von Mäusen nach 3 icv-Injektionen von Fingolimod-vorbehandelt (100 nM für 24 Stunden), CFSE-markierte BMDCs (1 × 10 6 Zellen/Injektion) in 12-Stunden-Intervallen (n = 7/Gruppe, 2 unabhängige Experimente). (g) Fingolimod-Behandlung von DCs reduzierte ihre Migration in CxLNs signifikant (P = 0.042, n = 7 2 unabhängige Experimente). Maßstabsbalken: 100 μm 10 μm (Einschübe). Die Daten repräsentieren den Mittelwert ± SEM. *P < 0,05.

DCs migrieren über das RMS. DCs wurden durch Kultivieren von Maus-BM mit fms-ähnlichem Tyrosinkinase-3-Liganden (FLT3) ( 28 ) erzeugt, was nach 9 Tagen in Kultur eine hoch angereicherte CD11c + -Zellpopulation (>95% Reinheit) ergab. Diese von BM abgeleiteten DCs (BMDCs) wurden dann ex vivo mit CFSE markiert, wonach 10 6 markierte Zellen icv injiziert wurden. Mäuse wurden 16 oder 24 Stunden nach der Injektion getötet (n = 3 pro Gruppe). Nach 16 Stunden wurden CFSE + BMDCs im proximalen und mittleren RMS beobachtet, wie durch die Färbung auf Doublecortin gezeigt (DCX Fig. 5C und Ref. 29). Nach 24 Stunden hatten markierte Zellen das proximale und mittlere RMS beseitigt und wurden im terminalen Feld des RMS innerhalb des OB gesehen. Um zu bestätigen, dass das RMS eindeutig an der DC-Migration vom proximalen zum distalen RMS beteiligt war, alatierten wir es mit icv-Infusion von Cytosin-β-D-arabinofuranosid (ARA-c) (30). In mehreren Experimenten führte dies zu einer Retention von DCs und Makrophagen im Gehirn (Fig. 5E), ähnlich der systemischen Fingolimod-Behandlung von icv-kanülierten Tieren. Darüber hinaus zeigte die direkte Quantifizierung von DCs im RMS, dass die Ablation der subventrikulären Zone und des RMS zu einem Versagen der Rekrutierung von DCs in das RMS führte (Abbildung 5D). Da CXCL12 normalerweise die Migration von Neuroblasten durch das RMS vermittelt ( 31 ), behandelten wir Mäuse systemisch mit AMD3100, um einen seiner Rezeptoren, CXCR4, zu hemmen. Diese Behandlung führte zu einem isolierten Anstieg der DCs im ZNS der Maus (ergänzende Abbildung 3), ähnlich dem, der bei einer systemischen Fingolimod-Behandlung beobachtet wurde (Abbildung 4C). Schließlich behandelten wir BMDCs ex vivo mit Fingolimod oder Vehikel und injizierten ihnen wie zuvor icv, 48 Stunden danach wurden die CxLNs isoliert. Diese zeigten, dass Fingolimod direkt auf adoptiv übertragene DCs einwirkte und ihren Austritt vom ZNS zu den CxLNs reduzierte (Abbildung 5, F und G). Diese Daten bestätigten, dass DCs durch das RMS wandern, möglicherweise unter Verwendung chemotaktischer Signale, die durch CXCR4 vermittelt werden. Als nächstes untersuchten wir die Wirkung einer Störung dieses zellulären Signalwegs auf eine entzündliche Autoimmunerkrankung des ZNS.

Die Fingolimod-Infusion in das RMS erhöht den Schweregrad der aktiv induzierten EAE. Die systemische Verabreichung von Fingolimod hemmt die EAE-Erkrankung (32). Umgekehrt fanden wir heraus, dass die gezielte Abgabe von Fingolimod an das RMS (Abbildung 6A) zu einer dosisabhängigen Zunahme in der Schwere der aktiv induzierten EAE mit Myelin-Oligodendrozyten-Glykoprotein35–55 (MOG35–55) Peptid (Abbildung 6B). Infusionen der gleichen Fingolimod-Dosis – entweder icv in den Seitenventrikel, an einer vom RMS entfernten Parenchymstelle des ZNS (Hippocampus) oder systemisch – führten zu relativen Reduktionen der klinischen EAE (Abbildung 6, C und D). Zusammengenommen legen diese Daten nahe, dass die Modulation des Immunzellverkehrs durch das RMS zu einer veränderten ZNS-Immunregulation führt. Da die Fingolimod-Behandlung des RMS zu einer Abweichung der regulatorischen Immunantworten und einer verstärkten Anti-ZNS-Immunität führte, untersuchten wir als nächstes, ob die gezielte Abgabe dieses Medikaments spontane EAE induzieren könnte.

Eine gezielte RMS-Fingolimod-Behandlung erhöht den Schweregrad der MOG-induzierten EAE. (EIN) RMS-Fingolimod-Behandlung. Kanülen wurden nahe dem Ursprung des RMS (oben), in den seitlichen Ventrikel (LV unten) oder die Hippocampusformation (nicht gezeigt) implantiert. Fingolimod wurde über einen Zeitraum von 4 Wochen über eine osmotische Minipumpe verabreicht. Sept, septum. (B) Die Behandlung mit RMS-Fingolimod, die 1 Woche vor der EAE-Induktion begann, führte zu einer dosisabhängigen Zunahme der Schwere der Erkrankung (n = 3/Gruppe), wobei die Mäuse, die 300 ng/Tag erhielten, alle bis zum 15. Tag starben. Tiere, die 30 ng/Tag erhielten, waren weniger stark betroffen, aber zuverlässig stärker als mit Vehikel infundierte Kontrollen (P < 0,001). (C) Mäuse, die icv-Fingolimod (300 ng/d n = 3) entwickelten signifikant weniger schwere EAE als die Fahrzeugkontrollen (P = 0.004). (D) Die Infusion von Fingolimod in den Hippocampus oder systemisch führte im Vergleich zur Behandlung mit RMS-Fingolimod ebenfalls zu einer milderen klinischen Erkrankung (n = 3 pro Gruppe P < 0,001). *P < 0,05.

Die Infusion von Fingolimod in das RMS erhöht die spontane EAE-Inzidenz. Während die Mehrheit der Th-Zellen von Vβ11-T-Zell-Rezeptor-transgenen 2D2-C57BL/6-Mäusen auf MOG anspricht, zeigen sie eine geringe Rate an spontanen ZNS-weiten Erkrankungen. Während bis zu 30% der 2D2-Mäuse über einen Zeitraum von 3 Monaten eine Optikusneuritis entwickeln, entwickeln nur etwa 6% eine spontane klassische (eher als optikospinale) EAE (33, 34). Das Aufbrechen der Immuntoleranz bei 2D2-Mäusen (mit Pertussistoxin-Behandlung allein) erhöht die EAE-Inzidenz signifikant auf etwa 60%, während die MOG-Impfung (ohne Pertussistoxin-Behandlung) keine EAE induziert (34). Da eine der Hauptwirkungen des Pertussistoxins darin besteht, die Migration von Immunzellen zu modifizieren ( 35 ), stellten wir die Hypothese auf, dass mit dem RMS assoziierte Immunzellen systemische Anti-ZNS-Immunantworten bei 2D2-Mäusen hemmen können. Um diese Behauptung zu testen, verabreichten wir Fingolimod oder ein Vehikel, das direkt auf das RMS abzielte (hier als RMS-Fingolimod bzw. RMS-Vehikel-Behandlung bezeichnet). Separate Kohorten erhielten Fingolimod oder Vehikel über RMS und icv-Infusion oder direkt an die CxLNs über s.c. Lymphgefäße ( 36 ), wobei letztere das ZNS umgehen. RMS-Fingolimod führte zu einer 63%igen Inzidenz klassischer EAE (10 von 16 Mäusen) im Vergleich zu RMS-Vehikel-Kontrollmäusen (0 von 9 .). P < 0,001). Darüber hinaus gab es keinen Fall von EAE bei Mäusen, denen Fingolimod oder Vehikel in den Seitenventrikel infundiert wurde (n = 4) oder zu den CxLNs (n = 11). Unter den 10 Mäusen, die Symptome von EAE entwickelten, reichten die klinischen Bewertungen von 1 bis 5 (Mittelwert ± SEM, 2,0 ± 0,4 Abbildung 7A). Diese Daten bestätigten die einzigartige Fähigkeit der RMS-Fingolimod-Abgabe, EAE in dieser ansonsten resistenten Mauslinie zu induzieren.

Die RMS-Fingolimod-Behandlung induziert EAE, indem sie die CxLN-Treg-Funktion stört. (EIN) Die EAE-Inzidenz bei 2D2-Mäusen stieg von 0 % bei RMS-Fahrzeugbehandlung (n = 9) bis 63 % (10 von 16 4 unabhängigen Experimenten) mit RMS-Fingolimod-Behandlung. (B) Diese Mäuse hatten auch mehr Antigen-spezifische T-Zellen im Rückenmark (1,7 ± 0,1 × 10 5 vs. 0,4 ± 0,2 × 10 5 P = 0,03 3 unabhängige Experimente) und (C) war das Treg/Teff-Verhältnis in den CxLNs negativ mit antigenspezifischen T-Zellen im Rückenmark (SC n = 6 P = 0,002 3 unabhängige Experimente siehe auch ergänzende Abbildungen 6 und 7). (D und E) Sie hatten auch keine Unterschiede in (D) die Anzahl antigenspezifischer Tregs zwischen CxLNs und ILNs (CxLN, P = 0,9 ILN, P = 0,5) oder in (E) der Anteil antigenspezifischer Teffs an den gesamten T-Zellen (CxLN, P = 0,6 ILN, P = 0.3). (F) Behandlung mit RMS-Fingolimod oder direkter CxLN-Fingolimod-Behandlung hatte keinen Einfluss auf den Anteil der Teffs (P = 0.6 n = 6 2 unabhängige Experimente). (g) Separate RMS-Fingolimod– oder RMS-Vehikel-behandelte 2D2-Mäuse (n = 9 3 unabhängige Experimente) wurde ihre Treg-Aktivität in ihren CxLNs bewertet (siehe Methoden und ergänzende Abbildungen 8 und 9). Es gab einen signifikanten Anstieg der antigenspezifischen T-Zell-Aktivierung, wenn CD25 hi Tregs aus der mononukleären CxLN-Population entfernt wurden (P = 0,023) von RMS-Vehikel-behandelten, aber nicht RMS-Fingolimod-behandelten, CxLN-Isolaten im Gegensatz zu ILNs (n = 18 3 unabhängige Experimente), was auf eine reduzierte Treg-Aktivität in den CxLNs von RMS-Fingolimod-behandelten Mäusen hinweist. Die Daten repräsentieren den Mittelwert ± SEM. *P < 0,05.

Wir quantifizierten auch ZNS-spezifische Vβ11 + T-Zellen im Rückenmark von 2D2-Mäusen, die eine RMS-gezielte Behandlung erhielten. Dieser Bereich ist bei klassischer EAE betroffen, aber entfernt von der Infusionsstelle. Die FACS-Analyse von mononuklearen Rückenmarkszellen zeigte, dass die absolute Anzahl und der Anteil von Vβ11 + -T-Zellen bei Fingolimod- versus Vehikel-infundierten Mäusen signifikant höher waren ( 7B und ergänzende 5B ), was mit einer erhöhten Neuroinflammation übereinstimmt.

Die Treg-Funktion ist in den CxLNs von mit RMS-Fingolimod behandelten Mäusen beeinträchtigt. CxLNs wurden von unbehandelten 2D2-Mäusen oder solchen, die einer RMS-Fingolimod- oder RMS-Vehikel-Behandlung unterzogen wurden, geerntet. Um Tregs zu identifizieren, färbten wir CxLN-Zellen von unbehandelten Mäusen mit CD3, CD4, CD25, CD127 und FoxP3. Dies zeigte, dass die meisten, wenn nicht alle CD25 + CD127 lo-Zellen FoxP3 exprimierten (ergänzende Abbildung 6), was sie als knochen-induzierbare Tregs identifizierte. Anschließend bestimmten wir den Anteil antigenspezifischer T-Effektorzellen (Teffs) und Tregs in den CxLNs von behandelten 2D2-Mäusen. Wir färbten Zellen mit Anti-CD45, -CD3, -CD4, -CD44, -CD62L, -CD25 und -CD127 zusätzlich zu einem Vβ11-Antikörper, um die transgenen MOG-spezifischen T-Zellen zu identifizieren (ergänzende Abbildung 7). Während der Anteil von CxLN CD25 hi CD127 lo Tregs zwischen mit Vehikel oder Fingolimod behandelten Mäusen nicht signifikant unterschiedlich war (Abbildung 7D), war das Verhältnis von Vβ11 + Treg/Teff in den CxLNs signifikant und umgekehrt proportional zum Anteil ZNS-spezifischer Zellen in das Rückenmark (P = 0,002 Abbildung 7C und ergänzende Abbildung 7), wobei letztere ein quantitatives Maß für die Schwere der EAE-Erkrankung ist. Da antigenspezifische T-Zellen in den CxLNs aktiviert werden, bevor sie in das ZNS wandern ( 14 ) und Tregs diese Aktivierung modulieren ( 37 ), stellten wir die Hypothese auf, dass die Behandlung mit RMS-Fingolimod ein Defizit der Treg-Funktion in den CxLNs verursacht und somit die anti- -ZNS-Immunantworten.

Die Verabreichung von RMS-Fingolimod unterbricht die ZNS-Immuntoleranz. Um zu bestimmen, ob die CxLN-Treg-Funktion nach der RMS-Fingolimod-Infusion von behandelten 2D2-Mäusen beeinträchtigt war, verglichen wir direkt die Wirkung der Treg-Depletion auf die in vitro-Antigen-spezifische CxLN-T-Zell-Aktivierung. Die Treg-Depletion wurde entweder durch Zurücklassen oder Entfernen von CD25-hi-Zellen aus der mononuklearen Zellpräparation, die von CxLNs stammt, erreicht (ergänzende Abbildung 8). Dieser Ansatz wurde entwickelt, um die funktionelle Kapazität von DC-induzierbaren CD25 hi CD127 lo Tregs zu messen (überprüft in Lit. 38). Obwohl wir erkennen, dass dieser Ansatz auch CD25 + Teffs entfernt, wirkt sich die Entfernung dieser Zellen einer erhöhten T-Zell-Aktivierung entgegen.Um jedoch ungleiche Verzerrungen auszuschließen, quantifizierten wir die Antigen-spezifische Teff-Häufigkeit in den CxLNs nach RMS-Fingolimod- oder RMS-Vehikel-Behandlung sowie nach ähnlichen Behandlungen, die direkt auf die CxLNs verabreicht wurden, und fanden keine signifikanten Unterschiede (Abbildung 7, E und F). Die Behandlung mit RMS-Fingolimod führte zu einer signifikant geringeren Einschränkung der Teff-Zell-Aktivierung im Vergleich zur RMS-Vehikel, was durch einen geringeren Anstieg der antigenspezifischen Aktivierung mit und ohne CxLN-Tregs angezeigt wird (P = 0,02 Abbildung 7G). Angesichts der Tatsache, dass die CxLNs der RMS-Fingolimod- und RMS-Vehikel-Gruppen die gleiche Anzahl von Tregs zeigten (Abbildung 7D), legen diese Daten nahe, dass CxLN-Tregs nach RMS-Fingolimod-Behandlung weniger effizient bei der Unterdrückung der T-Zell-Aktivierung sind. Im direkten Gegensatz dazu gab es keine signifikanten Unterschiede in der Aktivität von ILN Tregs, unabhängig von der Behandlung (Abbildung 7G). Da eher DCs als T-Zellen daran gehindert wurden, vom ZNS zu den CxLNs zu gelangen, postulierten wir, dass DCs die Veränderungen der Treg-Funktion in den CxLNs vermittelten.

DCs modifizieren die Anti-ZNS-Immunität in den CxLNs über die Regulierung der Treg-Aktivität. Um zu bestimmen, ob ein beeinträchtigter DC-Verkehr vom Gehirn als Ergebnis einer gezielten Fingolimod-Behandlung die veränderte Treg-Aktivität in den CxLNs vermittelt, verwendeten wir ein Modell der Hypersensitivität vom verzögerten Typ (DTH). Dieses Modell ist in der Lage zu bestimmen, ob DCs Antigen-spezifische Teff-Reaktionen in den CxLNs in vivo modifizieren ( 39 ) und ob die CxLN Treg-Aktivität in ähnlicher Weise modifiziert ist. In diesem Fall untersuchten wir, ob die RMS-Fingolimod-Behandlung die Fähigkeit von CxLN-DCs veränderte, Th-Zellantworten auf MOG-Peptid zu modulieren. WT C57BL/6-Mäuse wurden einer 4-wöchigen RMS-Fingolimod- oder RMS-Vehikel-Infusion unterzogen, wonach CxLNs geerntet, mononukleäre Zellen isoliert und oberflächenmarkiert wurden und CD45 + CD3 – CD11 + DCs durch FACS auf mehr als . gereinigt wurden 99% Reinheit (Ergänzende Abbildung 10). Die DCs einer einzelnen Maus (4–8 × 10 4 Zellen) wurden in die Ohrmuschel einer separaten C57BL/6-Maus injiziert, die eine einzelne s.c. Impfung mit MOG-Peptid in komplettem Freund-Adjuvans 7 Tage früher. Als Kontrolle wurde dem anderen Ohr der gleichen Maus das azelluläre Vehikel injiziert. 10 Tage später wurden beide Ohren mit MOG-Peptid herausgefordert, indem es direkt in die Unterhaut injiziert wurde. Um die T-Zell-vermittelten Antigen-Recall-Reaktionen zu beurteilen, wurde die Ohrschwellung 24 Stunden nach der Reizung gemessen ( 39 ), wobei eine zunehmende Ohrschwellung eine stärkere Reaktion anzeigte. Die Schwellung im Kontrollohr, das die azelluläre Vehikel-Injektion erhielt, wurde als Repräsentation der Immun-Recall-Reaktion angesehen, die vollständig der MOG-Impfung zuzuschreiben ist. Die Schwellung des Ohrs, in das DCs injiziert wurden, wurde direkt mit dem Kontrollohr derselben Maus verglichen und als Prozentsatz der Schwellung des Kontrollohrs ausgedrückt. In Wiederholungsexperimenten vermittelten DCs, die aus den CxLNs von Mäusen mit RMS-Fingolimod-Behandlung isoliert wurden, einen signifikanten Anstieg der Recall-Reaktionen auf das ZNS-Antigen MOG, was verstärkte Anti-ZNS-Immunantworten in den CxLNs bestätigte, während RMS-Fahrzeugkontrollen keine solche Veränderung zeigten ( Abbildung 8A). DCs, die aus den CxLNs von Mäusen isoliert wurden, die icv-Vehikel oder Fingolimod erhielten, zeigten keine Fähigkeit, die Teff-Reaktion auf MOG in den CxLNs zu regulieren, wie durch ähnliche Schwellungsgrade in azellulären Vehikel- und DC-injizierten Ohren angezeigt (Abbildung 8A). Diese Daten legten nahe, dass ein beeinträchtigter Austritt von DCs aus dem ZNS als Folge einer RMS-Fingolimod-Behandlung für erhöhte ZNS-Antigen-Recall-Reaktionen in den CxLNs verantwortlich war. Eine direkte Wirkung von Fingolimod auf CxLN-DCs kann jedoch nicht ausgeschlossen werden.

Vom ZNS abgeleitete DCs modulieren die Anti-ZNS-Immunität in den CxLNs. (EIN) CxLN-DCs wurden aus C57BL/6-Mäusen gereinigt, die 4 Wochen lang mit RMS-Fingolimod oder -Vehikel oder icv-Fingolimod oder Vehikel behandelt wurden. Diese oder ein azelluläres Vehikel wurden vor der MOG-DTH-Beurteilung in jede Ohrmuschel von separaten C57BL/6-Mäusen injiziert (siehe Methoden). Nur DCs von mit Fingolimod behandelten Mäusen erhöhten die MOG-DTH-Reaktionen (RMS-Fingolimod, n = 12/Gruppe icv-Fingolimod, n = 6/Gruppe P = 0,003 3 unabhängige Experimente). (B) Separate C57BL/6-Mäuse wurden mit Fingolimod oder Vehikel i.p. behandelt. für 14 Tage (n = 10 3 unabhängige Experimente) und ZNS-DCs wurden FACS-gereinigt und im DTH-Modell getestet, was zeigte, dass sie DTH ähnlich modifizierten und durch direkte Fingolimod-Exposition nicht verändert wurden. (C) 10 Mäuse (5 Vehikel 5 Fingolimod) wurden zufällig ausgewählt aus EIN, und CxLNs, die die Vehikelkontroll- oder DC-behandelten Ohren entleerten, wurden für die Treg-Funktionsbewertung separat isoliert. Nur die CxLN-drainierenden Ohren, denen RMS-Fingolimod-DCs verabreicht wurden, hatten eine signifikant reduzierte Treg-Aktivität (n = 5 P = 0.01). (D) ZNS CD45 hi CD3 – CD11c + CD11b + und CD45 hi CD3 – CD11c + CD11b – Zellen wurden aus 10 normalen Mäusen isoliert, wonach jede DC-Untergruppe (2 × 10 2 Zellen) im DTH-Modell in separaten Mäusen untersucht wurde. Nur CD11b – ZNS-DCs reduzierten DTH signifikant zu MOG (n = 10 P = 0,011 3 unabhängige Experimente). (E) Wir wiederholten das Experiment in D, außer dass MOG durch methyliertes BSA ersetzt wurde (n = 3/Gruppe). Es gab keine signifikante Modulation der Reaktion auf methyliertes BSA (P > 0.9), was – im Gegensatz zur MOG DTH DC-vermittelten Modulation – auf einen ZNS-Antigen-spezifischen Mechanismus hindeutet. Die Daten repräsentieren den Mittelwert ± SEM. *P < 0,05.

Fingolimod verändert die entzündliche Aktivität von ZNS-DCs nicht. Um zu testen, ob die direkten Wirkungen von Fingolimod auf die entzündliche und nicht die wandernde Kapazität von DC für unsere Ergebnisse verantwortlich waren, nutzten wir die pharmakokinetischen Eigenschaften von Fingolimod, die nach systemischer Therapie zu einer bevorzugten ZNS-Konzentration führen ( 32 ). Dies stellte sicher, dass alle DCs, die aus dem ZNS isoliert wurden, Fingolimod in vivo ausgesetzt waren. In diesem Fall konnten DCs aus den CxLNs nicht verwendet werden, da wir gezeigt hatten, dass eine systemische Fingolimod-Behandlung wahrscheinlich den Verkehr zu den CxLNs verändert und somit unsere Ergebnisse verzerrt. Wir behandelten Gruppen von 10 Mäusen mit Vehikel oder Fingolimod (6 &mgr;g/d i.p.) für 7 Tage. ZNS-DCs wurden wie oben aus dem Vorderhirn isoliert, wobei die Hirnhäute entfernt wurden (Ergänzende Abbildungen 2 und 10). Wir verglichen dann ihre Fähigkeit, ZNS-Antigen-Rückrufreaktionen unter Verwendung des DTH-Modells zu modulieren. Es gab keine signifikanten Unterschiede in den Rückrufreaktionen, wenn DCs aus Vehikel- oder Fingolimod-behandelten Mäusen isoliert und anschließend an die CxLNs abgegeben wurden (Abbildung 8B), was darauf hindeutet, dass die direkten Wirkungen von Fingolimod auf DCs ihre Fähigkeit, Entzündungen zu modulieren, nicht veränderten . Nachdem wir eine direkte Wirkung von Fingolimod auf DCs ausgeschlossen hatten und unsere Beobachtung einer veränderten Treg-Funktion in den CxLNs als Ergebnis der RMS-Fingolimod-Behandlung berücksichtigten, untersuchten wir als nächstes, ob adoptiv übertragene DCs die Treg-Funktion in den CxLNs direkt modulieren.

DCs modulieren die Treg-Funktion direkt in den CxLNs. Um sicherzustellen, dass übertragene DCs die Anti-ZNS-Immunität modulieren, indem sie die CxLN-Treg-Aktivität regulieren, untersuchten wir Mäuse, bei denen CxLN-DCs auf das Ohr übertragen wurden. Nach der MOG-Herausforderung (Abbildung 8A) wurden die entwässernden CxLNs der DC- und Vehikel-injizierten Ohren separat isoliert, wonach die Treg-Aktivität bestimmt wurde, wie wir es zuvor getan hatten (Abbildung 7G). Die Treg-Aktivität war bei CxLNs, die DCs von RMS-Fingolimod erhielten, im Vergleich zu mit RMS-Vehikel behandelten Mäusen signifikant niedriger (Abbildung 8C). Diese Daten unterstützen somit die Behauptung, dass Fingolimod den Austritt von DCs aus dem Gehirn hemmt, die ansonsten die Treg-Aktivität erhöhen würden. Darüber hinaus weisen sie darauf hin, dass es eine Subpopulation von DCs im normalen ZNS geben muss, die Anti-ZNS-Immunantworten in den CxLNs hemmen.

Eine Untergruppe von Vorderhirn-DCs hemmt die Anti-ZNS-Immunität. Unsere vorstehenden Daten legten das Vorhandensein einer Untergruppe von ZNS-DCs nahe, die Anti-ZNS-Immunantworten in den CxLNs unterdrückt. Daher isolierten wir die DCs vom Vorderhirn, wo sich die DCs entlang des RMS konzentrieren (Abbildungen 1–3) und sorgfältig von Hirnhäuten befreit wurden, um alle assoziierten DCs zu entfernen. Die verbleibenden, überwiegend RMS-assoziierten DCs von 10 normalen Mäusen wurden durch FACS gereinigt (ergänzende Abbildung 10). Wir testeten dann die Fähigkeit von sortierten CD45 hi CD3 – CD11c + CD11b + und CD45 hi CD3 – CD11c + CD11b – ZNS-DCs, Anti-ZNS-Reaktionen in unserem DTH-Modell zu modulieren. Isolierte DCs wurden direkt in ein Ohr und azelluläre Vehikelkontrolle in das andere von MOG-geimpften Mäusen injiziert, und die Rückrufreaktionen auf MOG wurden gemessen. Nur CD45 hi CD3 – CD11c + CD11b – ZNS-DCs waren in der Lage, Antigenrückrufreaktionen auf MOG signifikant zu reduzieren (Abbildung 8D). Diese DC-Subpopulation umfasst pDCs, von denen bekannt ist, dass sie Treg-Antworten verstärken (40). Diese Daten bestätigten, dass das normale Maus-ZNS eine CD45 hi CD3 – CD11c + CD11b – Zellpopulation enthält, die in der Lage ist, Anti-ZNS-Reaktionen in den CxLNs zu unterdrücken. Um zu zeigen, dass dieser Effekt wahrscheinlich antigenspezifisch war, führten wir das gleiche Experiment durch, ersetzten jedoch MOG durch methyliertes BSA zur Impfung und Provokation und fanden keine signifikante Modulation von DTH ( 8E ). Diese Beobachtung legt nahe, dass DCs CxLN-Reaktionen auf ZNS-Antigen-spezifische Weise modulieren.

Viele Studien haben die tolerogenen Eigenschaften des ZNS-Parenchyms gezeigt. Diese Ergebnisse, kombiniert mit der Identifizierung von anatomischen Barrieren des ZNS, legten nahe, dass zelluläre Immunkomponenten einen begrenzten Zugang zum ZNS haben (2). Diese Beobachtungen stimmen jedoch nicht mit der inzwischen weithin akzeptierten Beobachtung überein, dass T-Zellen im normalen ZNS vorhanden sind. Während zuvor umstritten (5, 23, 24, 41), zeigen unsere vorliegenden Ergebnisse eindeutig, dass aus dem Blutkreislauf stammende CD11c + -DCs auch auf ausgewählte Regionen des gesunden ZNS-Parenchyms zugreifen können, wie dies in anderen festen Geweben der Fall ist. Hier haben wir einen neuen physiologischen Weg des DC-Verkehrs vom ZNS zu den CxLNs identifiziert, der die ZNS-Autoimmunität im peripheren Immunkompartiment aktiv herunterreguliert. Wir zeigten ferner, dass dieser Weg der DC-Migration anatomisch und funktionell mit dem RMS verbunden und für eine therapeutische Intervention zugänglich ist.

Die relevanteste Frage, die sich aus diesen Daten ergibt, ist, wie das Vorhandensein von DCs im Parenchym zuvor unbemerkt geblieben sein könnte. Dies ist wahrscheinlich auf die übliche Praxis zurückzuführen, für die meisten Zwecke koronale Schnitte zu erstellen. In dieser Ausrichtung nimmt das RMS einen sehr geringen Anteil des gesamten Abschnitts ein. Da die Dichte der DCs relativ gering ist, würden diese Zellen in dieser Schnittebene leicht übersehen. Sagittalschnitte hingegen zeigen den gesamten Verlauf des RMS, wodurch die darin enthaltenen DCs leichter identifiziert werden können. Mit diesem Ansatz zeigten wir, dass DCs, nachdem sie Zugang zum Seitenventrikel erhalten hatten, entlang des RMS-Pfads wanderten (Abbildung 5C). Der Ursprung von RMS-assoziierten DCs im unmanipulierten ZNS wurde in dieser Studie nicht endgültig identifiziert, obwohl unsere Daten darauf hindeuteten, dass sie aus dem Kreislauf stammen (Abbildung 3) und wahrscheinlich über den Plexus choroideus eindringen, weitgehend unabhängig von Mechanismen, über die kürzlich berichtet wurde regulieren die Rekrutierung von Makrophagen an dieser Stelle (26). Sie könnten jedoch auch aus einer kürzlich beschriebenen ZNS-residenten Vorläuferpopulation stammen (5). Unabhängig von ihren möglichen Eintrittspunkten zeigten unsere Ergebnisse eindeutig, dass sie nach ihrer Rekrutierung für das RMS zum distalen OB und dann zu den CxLNs wandern (Abbildungen 4 und 5), wahrscheinlich durch Zugang zu den Lymphgefäßen der Nasenschleimhaut (Abbildung 9 .). und Lit. 42 – 44). Dort interagieren sie mit T-Zellen und regulieren die Treg-Aktivität, die wiederum die ZNS-spezifische Teff-Aktivierung reguliert. Eine spezifische Unterbrechung dieses Signalwegs im Gehirn mit Fingolimod verhinderte, dass DCs die CxLNs erreichten. Dies hatte die Wirkung, die ZNS-Immuntoleranz zu brechen, was zu einer neuroinflammatorischen Erkrankung führte.

Migrationsweg der Immunzellen durch das RMS. Zirkulierende DCs werden in die subventrikuläre Zone und RMS rekrutiert, höchstwahrscheinlich über den Plexus choroideus und/oder das zugehörige Gefäßsystem. Diese APCs wandern entlang des RMS zum OB und treffen auf ZNS-Antigene, vielleicht von sterbenden Vorläufern oder Neuronen, die zum Ersatz bestimmt sind. DCs verlassen dann das Gehirn am zentralen Terminus von RMS im OB und greifen auf die CxLNs zu, wo sie die Immunität regulieren. Wir schlagen vor, dass sie die Differenzierung und/oder Funktion von Tregs fördern, die wiederum anti-ZNS autoreaktive naive Zellen oder Gedächtnis-Teff-Antworten in den CxLNs unterdrücken. Nur zuvor aktivierte Th-Zellen werden an das ZNS rekrutiert. NC, neuraler Kortex CB, Kleinhirn.

In Experimenten, bei denen eine Kanüle in das ZNS eingeführt wurde, verhinderte eine systemische Fingolimod-Behandlung, dass sowohl Makrophagen als auch DCs das ZNS verließen (Abbildung 4). Es ist wahrscheinlich, dass diese Makrophagenansammlung als Folge des Einführens der Kanüle aufgetreten ist, was unweigerlich zu einer gewissen Hirnverletzung führt. Im nicht verletzten ZNS führte die systemische Behandlung mit Fingolimod und AMD3100 zu einer alleinigen Akkumulation von DCs, anscheinend weil sie daran gehindert wurden, das ZNS zu verlassen (Abbildung 4C). Interessanterweise behinderte die Ablation des RMS mit ARA-c auch den Zellaustritt aus dem ZNS, was möglicherweise eine Rolle des Immunzelltransports entlang des RMS bei der Auflösung von ZNS-Entzündungen identifiziert. Die Ansammlung von Entzündungszellen und die Verhinderung ihres Austritts bei anhaltender Entzündung im Zusammenhang mit aktiven MS-Plaques können eine Erklärung für die zunehmende Zahl von Nebenwirkungen im Zusammenhang mit einer Fingolimod-Behandlung bei MS liefern (45). Die Identität der Entzündungszelle(n), die in diesem Zusammenhang schädlich sein könnte(n), ist jedoch nicht klar. Es kann spekuliert werden, dass dies Makrophagen sind, die mit einer anhaltenden Verletzung in MS-Plaques verbunden sind.

Die Assoziation von APCs, wie DCs, mit einem neurogenen Signalweg wie dem RMS mag überraschend erscheinen, obwohl beachtet werden sollte, dass das RMS um die Wand des olfaktorischen Ventrikels (oder Reste davon) herum organisiert ist. Von diesen DCs wird erwartet, dass sie an immunregulatorischen Aktivitäten des ZNS teilnehmen, wie sie in anderen festen Organen vorkommen, indem sie zu drainierenden LNs wandern und Immunzellen wie Tregs regulieren (11). Wir sollten jedoch beachten, dass wir die Virchow-Robin-Räume, die auch DC-T-Zell-Wechselwirkungen beherbergen, nicht untersucht haben ( 46 ). In jedem Fall legen unsere Daten, ähnlich wie bei anderen soliden Organen, nahe, dass die Unterdrückung von Anti-ZNS-Reaktionen in den CxLNs durch DCs vermittelt wird, die aus dem ZNS gereist sind. Eine weitere Unterstützung für diese Behauptung war unser Befund, dass DCs – allein, die zu den CxLNs wanderten – Veränderungen in der Immunantwort auf ZNS-Antigene vermittelten. Wir demonstrierten dies, indem wir reduzierte ZNS-Immunantworten im CxLN einer Empfängermaus zeigten, nachdem wir CD11c + CD11b – DCs erhalten hatten, die aus dem ZNS einer normalen Maus isoliert wurden (Abbildung 8D).

Jüngste Arbeiten haben die CxLNs als einen Hauptort der Aktivierung von Anti-ZNS-Immunantworten bei MS identifiziert (13, 47). Antigene, die an das ZNS abgegeben werden, leiten zu den CxLNs ab, wo sie von DCs verarbeitet werden (7). In das Hirnparenchym injizierte DCs wandern ebenfalls zu CxLNs (14). ZNS-spezifische T-Lymphozyten werden dann in den CxLNs vor ihrer Migration zum ZNS aktiviert (14). Die Verhinderung der DC-Migration zu den CxLNs durch eine gezielte RMS-Fingolimod-Behandlung führte zu einer beeinträchtigten Treg-Funktion, was die Inzidenz spontaner EAE bei ansonsten resistenten 2D2-Mäusen erheblich erhöhte. Die EAE-Inzidenz bei 2D2-Mäusen ( 7A ) war ähnlich der, die bei einer Behandlung mit Pertussistoxin beobachtet wurde, von der auch bekannt ist, dass sie die Migration von Immunzellen hemmt ( 34 ). Das Fehlen der EAE-Induktion, wenn Fingolimod direkt über s.c. an die CxLNs abgegeben wurde. lymphatics weist darauf hin, dass eine direkte Wirkung von Fingolimod auf die CxLNs unwahrscheinlich ist. Darüber hinaus verstärkte ein breites Targeting von meningealen Entzündungszellen, anderen ähnlichen parenchymalen ZNS-Zellen oder dem gesamten ZNS ( 32 ) durch icv-, hippocampale oder systemische Fingolimod-Verabreichung die Neuroinflammation nicht, konnte keine EAE induzieren und/oder vermittelte keine DTH-Änderungen. Dies bestätigte, dass es für Fingolimod notwendig ist, die Neuroinflammation zu steigern, spezifisch auf das RMS abzuzielen (Abbildungen 5–7). Es ist zwar möglich, dass durch eine ZNS-Trauma als Folge einer gezielten Fingolimod-Behandlung freigesetztes Antigen EAE induziert, dies erscheint jedoch unwahrscheinlich. Kontrollmäuse wurden ähnlich behandelt und erhielten trotz der Freisetzung potentieller Antigene keine EAE. Eine direkte Impfung von 2D2-Mäusen mit MOG-Peptid ohne Pertussistoxin induziert ebenfalls keine EAE (34). Darüber hinaus weist die verfügbare Literatur zu Fingolimod darauf hin, dass seine direkte Wirkung auf das ZNS und Entzündungszellen, einschließlich Tregs, den Schweregrad und die Inzidenz von EAE reduzieren würde (48). Schließlich zeigten wir, dass die Wirkungen von Fingolimod auf ZNS-DCs ihre Entzündungsregulation in den von uns verwendeten Modellen nicht veränderten, sondern direkt ihre Migration beeinflussten. Daher deuten unsere vorliegenden Daten darauf hin, dass mit dem RMS assoziierte pDCs von Fingolimod angegriffen werden und sie daran hindern, auf die CxLNs zuzugreifen. Das resultierende Defizit führte zu Veränderungen der Treg-Funktion und induzierte eine Teff-Aktivierung, die eine Exazerbation oder Induktion von EAE verursachte.

DCs dürften auch eine Rolle beim kürzlich gefundenen Nutzen von Alemtuzumab spielen, einem monoklonalen therapeutischen Antikörper, der sich derzeit in Studien zur Behandlung von MS befindet. Alemtuzumab fördert die pDC-Differenzierung und die Treg-Expansion (15). pDCs sind dafür bekannt, die Treg-Expansion in Tiermodellen von MS zu fördern (40). Eine weitere Immunmodifikation durch eine Behandlung mit Alemtuzumab scheint die protektive Anti-ZNS-Autoimmunität bei MS zu verstärken, indem sie aus dem Gehirn stammende neurotrophe Faktoren produzierende T-Zellen in der Peripherie produziert, eine Wirkung, die wahrscheinlich durch DCs vermittelt wird. Wir fanden auch heraus, dass die Untergruppe der DCs, die die ZNS-Immunantworten in den CxLNs herunterregulierten, wahrscheinlich auch pDCs enthielt, die CD11c + CD11b – sind. Obwohl unsere gegenwärtigen Studien an Mäusen durchgeführt wurden, regulieren die CxLNs die Immunität bei neuroinflammatorischen Erkrankungen des Menschen ( 13 ) und das RMS wurde auch beim Menschen anatomisch definiert ( 49 ). Obwohl es Kontroversen über die neurogene Funktion des RMS beim erwachsenen Menschen gab (49 – 53), muss seine Rolle als Kanal für andere Zelltypen noch erforscht werden, und die Verteilung von ZNS-parenchymalen DCs beim Menschen ist Berichten zufolge ähnlich. bei Mäusen gesehen (5, 32).

Schließlich kann der RMS-Immunzell-Migrationsweg manipuliert werden, wie unsere Lieferung von syngenen DCs an die CxLNs zeigt. Dies demonstrierte die Möglichkeit, lokale Therapeutika bereitzustellen, die letztendlich die Immunfunktion auf der Ebene der CxLNs beeinflussen, um neuroinflammatorische Erkrankungen zu behandeln. Der Hauptvorteil solcher lokalisierten Therapieansätze besteht darin, dass signifikant niedrigere Arzneimitteldosen verabreicht werden können, um hohe Konzentrationen an den Hauptwirkungsstellen zu erreichen, während unerwünschte, dosisabhängige systemische Nebenwirkungen minimiert werden.Diese Daten stellen einen potenziellen Mechanismus dar, durch den Fingolimod einen negativen Ausgang bei MS verursachen könnte, aber vor allem revidieren sie unser Verständnis der Wege des Immunzellverkehrs durch das ZNS und der Folgen der Interkommunikation zwischen den Immun- und ZNS-Kompartimenten in der Aufrechterhaltung der ZNS-Gewebehomöostase bei Gesundheit und Krankheit.

Alle Mäuse waren auf dem C57BL/6-Hintergrund. Weibliche C57BL/6-Mäuse im Alter von 6–12 Wochen wurden von Australian BioResources gekauft. 2D2-transgene Mäuse waren ein Geschenk von V. Kuchroo (Brigham and Women's Hospital, Boston, Massachusetts, USA, Ref. 33, 34). In Cx3cr1 +/gfp Mäusen wurde die kodierende Sequenz für EGFP in die Cx3cr1 kodierende Region durch gezielte Deletion, wodurch das Cx3CR1/Fraktalkin-Rezeptor nicht funktionsfähig und EGFP unter Cx3cr1 Promotorkontrolle im mutierten Allel (25). Mäuse wurden in der Garvan Institute Biological Testing Facility (BTF) oder Salk Institute Tiereinrichtungen untergebracht und in einem 12-Stunden-Licht-/12-Stunden-Dunkelzyklus gehalten, wobei Standardfutter und Wasser frei verfügbar waren. EAE wurde induziert und klinisch überwacht, wie zuvor mit MOG . beschrieben35–55 ( 46 ). EAE wurde klinisch mit einer Standardskala von 1 bis 5 bewertet.

Eine 30-Gauge-Infusionskanüle (Alzet) wurde in den rechten Seitenventrikel (icv +0,2 mm anteroposterior, +1,0 mm lateral, 2,2 mm Tiefe oder 0, +1,0 mm lateral, 2,2 mm Tiefe), das rostrale Vorderhirn (RFB) implantiert. Parenchym (+0,7 mm anteroposterior, +1,1 mm lateral, 2,2 mm Tiefe) oder des Hippocampus (–2,5 mm anteroposterior, +1,0 mm lateral, 2,7 Tiefe). Ein Katheterschlauch wurde von der Infusionskanüle mit einer s.c. implantierten osmotischen Pumpe verbunden. Kanülenplatzierungen wurden postmortal in Schnitten bestätigt, die für Nissl-Material gefärbt waren (Abbildung 6A). Um die CxLNs anzuvisieren, wurde an der Schädelbasis ein Einschnitt vorgenommen und der Katheterschlauch unter die Kopfhaut getunnelt, so dass sich die Spitze an der Position des Bregmas in der Mittellinie befand. Der Katheterschlauch wurde in Position genäht, vorbereitet, um die Durchgängigkeit zu gewährleisten, und mit dem s.c. Infusionspumpe.

Erzeugung von BM-Chimären. BM-Chimären wurden wie zuvor beschrieben erzeugt (54). Kurz gesagt wurden Empfänger-WT-Mäuse im Alter von 6 Wochen mit 2 Dosen von 5,5 Gy im Abstand von 14 Stunden bestrahlt. Spender Cx3cr1 +/gfp Mäuse wurden getötet und BM wurde von den Oberschenkelknochen und Schienbeinen geerntet. 3 Stunden nach der zweiten Bestrahlungsdosis erhielten Empfängermäuse eine Injektion von 3–5 × 10 6 BM-Zellen (in 150 μl RPMI) i.v. über die seitliche Schwanzvene.

Isolierung von mononuklearen LN- und ZNS-Zellen. CNS und LNs wurden aus mit Kochsalzlösung perfundierten Mäusen entfernt und vor dem Verdau mit Kollagenase D (2,5 mg/ml) und DNase I (1 mg/ml) in R10-Medium (RPMI 1640-Medium), ergänzt mit 10 %, in 2-mm-Stücke geschnitten. (v/v) FCS, 2 mM 1 -Glutamin, 100 U/ml Penicillin, 100 μg/ml Streptomycin und 50 μM 2-Mecaptoethanol für 45 Minuten bei 37 °C. Die Gewebe wurden dann durch ein Zellsieb geleitet, gefolgt von einem Percoll-Gradienten (70%/37%) und 350 g Zentrifugation. Mononukleare Zellen wurden aus der Zwischenphase entfernt, zweimal gewaschen und in R10-Medium, ergänzt mit 10 % (v/v) FCS, resuspendiert.

Immunhistochemie (IHC). ZNS-Gewebe wurde wie zuvor beschrieben durch IHC und Immunfluoreszenz (IF) untersucht (46). Kurz gesagt wurden Mäuse tief betäubt (1 ml/2 kg Euthal, 17 % Pentobarbiton-Natrium, 2,5 % Phenytoin-Natrium) und durch den linken Ventrikel mit 10 ml 0,9 % Kochsalzlösung, gefolgt von 150 ml eiskaltem 4 % Paraformaldehyd in Natriumborat, perfundiert Puffer bei pH 9,5 unter Verwendung einer peristaltischen Pumpe (Gilson). Die Gehirne wurden geerntet, 5 Stunden in 4% Paraformaldehyd nachfixiert und 16 Stunden in 20% Saccharose/50 mM Kalium-PBS (KPBS) bei 4°C kryogeschützt. Als nächstes wurden 30 µm dicke gefrorene Hirnschnitte mit einem Gleitmikrotom (SM2010R Leica Biosystem) gewonnen. Die Schnitte wurden in Kryoschutzmittellösung (30% Ethylenglycol, 20% Glycol in 50 mM Natriumphosphatpuffer, pH 7,4) bei –20°C gelagert.

Die duale Immunmarkierung wurde wie zuvor beschrieben durchgeführt (46). Kurz gesagt wurden 30 &mgr;m dicke schwimmende Gewebeschnitte mit 0,3% Wasserstoffperoxid für 10 Minuten behandelt, um die endogene Peroxidase zu hemmen, gefolgt von 7 Minuten mit 1% Natriumborhydrid. Gewebeschnitte wurden dann mit monoklonalem Antikörper gegen CD11c (Armenischer Hamster anti-mCD11c 1:1.000 Klon N418, eBioscience) oder CD3 (anti-CD3 KT3 1:1.000 Chemicon) in 2 % Ziegen- oder Eselserum und 0,3 % Triton X-100 . immungefärbt . Gewebeschnitte wurden in primärem Antikörper 48 Stunden lang bei 4 °C auf einer Orbitalwippe (50 Upm Ratek Instrument) inkubiert, gefolgt von einer biotinylierten Sekundärfärbung (Ziege oder Esel 1:200 Jackson Immunoresearch) in demselben Puffer wie oben für 1 Stunde bei Zimmertemperatur. Nach der sekundären Immunfärbung wurden die Schnitte mit Avidin unter Verwendung des Vecta Elite-Kits (Vector Laboratorie) gemäß dem Protokoll des Herstellers markiert. Nach der Avidin-Markierung wurden die Schnitte zweimal (10 Minuten pro Waschgang) in 0,1 M Natriumacetat, pH 6, gewaschen, gefolgt von einer Entwicklung in nickelverstärktem DAB (2,5% Nickelammoniumsulfat, 100 mM Natriumacetat, 0,5 mg/ml DAB, 2 .). mg/ml D β-Glucose, 0,4 mg/ml Ammoniumchlorid, 1 E/ml Glucoseoxidase Sigma-Aldrich) für 5–7 Minuten bei 4 °C für eine schwarze Markierung. Die Schnitte wurden dreimal (10 Minuten pro Waschgang) in KPBS gewaschen und mit dem zweiten primären Antikörper gegen CD11c oder DCX (sc-8066 Santacruz Biotech) über Nacht unter den gleichen Bedingungen wie für den anfänglichen primären Antikörper inkubiert, gefolgt von den entsprechenden biotinylierten Sekundärfärbung (Esel 1:200 Jackson Immunoresearch) und Avidin-Markierungsverfahren. Die Schnitte wurden dann zweimal (10 Minuten pro Waschgang) mit KPBS gewaschen, und die Färbung wurde in DAB ohne Nickelverstärkung entwickelt (0,5 mg/ml DAB, 2 mg/ml D-β-Glucose, 0,4 mg/ml Ammoniumchlorid, 1 U/ml&supmin; Glucoseoxidase Sigma-Aldrich) in KPBS, um eine braune Markierung zu ergeben. Die Schnitte wurden auf gelatinebeschichtete Objektträger aufgezogen, dann dehydriert und mit DPX (Electron Microscopy Sciences) mit Deckgläsern bedeckt. Für die kombinierte Immunperoxidase- und IF-Färbung wurden Schnitte mit Anti-CD11c markiert und mit nickelverstärktem DAB entwickelt, gefolgt von Inkubation mit Anti-DCX und einem speziesspezifischen FITC-markierten Sekundärantikörper. Die Schnitte wurden auf gelatinebeschichteten Objektträgern in einem wässrigen Einbettungspuffer aufgezogen und mit einem Deckglas versehen.

IF konfokale Mikroskopie. Die Schnitte wurden einer IF-Dreifachfärbung von Meerschweinchen-Anti-DCX (1:2.000 Millipore), Armenischer Hamster Anti-CD11c (1:800 eBioscience) und Ratten-Anti-CD11b (1:500 BD Biosciences) oder Ratten-Anti-CD31 (1 :100 BD Biosciences) wurden in Inkubationspuffer (0,1 M PBS enthaltend 0,3% Triton-X100 mit sowohl 2% normalem Esels- als auch 2% normalem Ziegenserum) zugegeben und die Färbung wurde 24 Stunden bei 4°C durchgeführt. Nach dreimaligem Waschen mit PBS wurden die Schnitte dann mit Fluorophor-markierten Sekundärantikörpern (Jackson ImmunoResearch) bei Raumtemperatur (RT) 1 Stunde lang sondiert. Die Reaktion wurde durch dreimaliges Waschen in PBS beendet, und die Schnitte wurden dann montiert und in 50 % Glycerin/PBS mit Deckgläschen bedeckt. Proben von Cx3cr1 gfp/+ -zu-WT-BM-chimäre Mäuse wurden ähnlich behandelt, außer dass stattdessen eine Doppelfärbung durchgeführt wurde. Hirnschnitte dieser Mäuse wurden mit DCX und CD11b oder mit CD11c und CD11b gefärbt. Konfokale Bilder wurden auf einem Leica TSC SP-Konfokalmikroskop erhalten und unter Verwendung der Software Adobe Photoshop CS2 v.9 verarbeitet.

Zellquantifizierung und -kartierung. Um DCs zu quantifizieren und/oder zu kartieren, verwendeten wir doppelt markiertes IHC/IF-Material, wie oben für CD11c mit DCX beschrieben (Abbildung 1). CD11c + -Zellen, die mit dem RMS (DCX + ) assoziiert sind, wurden in 6 separaten SPF C57BL/6-Mäusen von ihrem Austrittspunkt auf der Ebene der subventrikulären Zone (in mindestens 5 Abschnitten pro Tier) bis zu ihrem Eintritt in den OB quantifiziert. Das Corpus callosum und der frontale Cortex in den gleichen Schnitten wurden als Kontrollen der weißen bzw. grauen Substanz untersucht. Die Zellzahlen wurden mit der Abercrombie-Methode korrigiert ( 55 ) und die Zelldichte wurde unter Verwendung des untersuchten Bereichs (aus Neurolucida-Rekonstruktionen), definiert als DCX + -Bereich für das RMS oder als die anatomischen Grenzen des Corpus callosum und des frontalen Kortex desselben, abgeleitet Abschnitte.

Behandlungen. Um die Migration von Leukozyten durch das RMS/ZNS hinunter zu den CxLNs zu demonstrieren, wurden Mäuse mit Vehikel (50% DMSO) oder Fingolimod (6 &mgr;g/Tag in 50% DMSO) i.p. für 8 Tage, Beginn der Behandlung 1 Tag vor der Platzierung der icv-Kanüle und CFSE (1,2 mM in 50 % DMSO)-Infusion für 7 Tage durch s.c. Osmotische Minipumpe. Mononukleare Zellen aus dem Gehirn, CxLNs und ILNs wurden geerntet, während Infusionen aktiv waren. Mononukleäre LN-Zellen wurden mit Anti-CD45 (BD Biosciences – Pharmingen) allein markiert und durch FACS untersucht, um den Austritt von CD45 + -Zellen aus dem ZNS zu zeigen. ZNS-Leukozyten wurden mit einem Cocktail von Antikörpern (alle von BD Biosciences – Pharmingen) markiert, darunter Anti-CD45 (PERCP Ratte Anti-Maus CD45 30-F11), Anti-CD3 (Pazifischer Blauer Hamster Anti-Maus CD3e 500A2), Anti- CD4 (Alexa Fluor 700 Ratte Anti-Maus CD4 RM4-5), Anti-CD11c (APC Hamster Anti-Maus CD11c HL3), Anti-CD11b (APC-Cy7 Ratte Anti-Maus CD11b M1/70), Anti-B220 (PE Ratten-Anti-Maus-CD45r/B220 RA3-6B2) und Anti-mPDCA-1 (FITC-Ratten-Anti-Maus-PDCA-1 JF05-1C2.4.1) (Ergänzende Abbildungen 2 und 4).

Um die Wirkung der zentralen Fingolimod-Verabreichung auf den EAE-Schweregrad zu untersuchen, wurden C57BL/6-Mäuse entweder für icv- oder RFB-Infusionen (dh RMS-zielgerichtet) kanüliert und erhielten über 4 Wochen 30 oder 300 ng/d Fingolimod oder Vehikel (50% DMSO) . 1 Woche nach Beginn der Fingolimod-Infusion wurde EAE wie oben beschrieben induziert. 2D2-Mäuse erhielten RMS-Fingolimod oder RMS-Vehikel (d. h. Infusionen von 300 ng/d Fingolimod oder Vehikel durch auf das RMS gerichtete Kanülen). Als Kontrolle wurde Fingolimod (300 ng/Tag) durch Infusion unter die Kopfhaut gezielt auf die CxLNs (das ZNS umgangen) gerichtet. Die Tiere wurden auf die Entwicklung einer klinischen EAE untersucht. Am Ende des Experiments wurden die Mäuse perfundiert und ihre Gehirne und Rückenmark wurden entfernt. Nach der Fixierung wurden die Gehirne geschnitten und auf Nissl-Material gefärbt, um die Kanülenplatzierungen zu bewerten.

Um die Rolle von CXCR4 und CD73 zu untersuchen, wurden AMD3100 (CXCR4-Antagonist MerckMillipore) und ein CD73-Antagonist (Adenosin-5'-[α,β-methylen]diphosphat-ADP-Analogon Sigma-Aldrich) verwendet. ADP-Analogon (0,5 mg in Kochsalzlösung) wurde täglich i.p. injiziert. für 12 Tage. Mäuse wurden getötet, während die Behandlungen pharmakologisch aktiv waren, und mononukleare Zellen aus dem RFB, die von Meningen befreit waren, wurden isoliert und durch FACS untersucht (ergänzende Abbildungen 2 und 4).

Zur Ablation des RMS wurde ARA-c (Sigma-Aldrich), 2% in Kochsalzlösung, 7 Tage lang icv durch s.c. infundiert. Osmotische Minipumpe. Mäuse wurden getötet, während das Arzneimittel für die Analyse mononukleärer ZNS-Zellen oder die IHC-Quantifizierung von CD11c-Zellen im RMS aktiv war.

Verfolgen von transplantierten DCs im RMS in vivo. BM von C57BL/6-Mäusen, kultiviert in Gegenwart von 300 ng/ml rekombinantem murinem Fms-ähnlichem Tyrosinkinase-3-Liganden (FLT3) für 9 Tage. Die erfolgreiche DC-Reifung wurde durch FACS-Analyse bestätigt, die zeigte, dass >95% der Zellen CD45 + CD11c + waren. Zellen wurden ex vivo in 2,6 &mgr;M CFSE für 5 Minuten markiert, gewaschen und dann icv (1 × 10 6 Zellen) injiziert. Für die ex vivo-Fingolimod-Behandlung wurden die Zellen in Kultur mit 100 nM Fingolimod für 24 Stunden vor der Abgabe inkubiert. Die Tiere wurden 16 und 24 Stunden nach der Injektion getötet und die Gehirne wurden wie oben beschrieben für die IF-Färbung für die DCX- oder LN-Analyse nach 48 Stunden verarbeitet.

Ex vivo Treg-Suppressionszell-Assay. LNs von experimentellen Mäusen, die wie oben beschrieben vorbehandelt wurden, wurden geerntet, und Einzelzellsuspensionen wurden erhalten, indem die LN durch ein 70-μm-Nylonnetz in 1 × PBS, das 5% FCS enthielt, geleitet wurde. Rote Blutkörperchen wurden auf Eis lysiert. Um Tregs aus der Zellsuspension zu entfernen, wurden die Zellen mit Biotin-Anti-CD25-Kügelchen (Miltenyi Biotec) oder den gleichen Kügelchen ohne Antikörper als Prozesskontrolle (gemäß den Anweisungen des Herstellers) markiert und dann durch Magnetsäulen geleitet (Ergänzende Abbildung 8 .). ). Zellsuspensionen mit oder ohne Tregs wurden in Gegenwart oder Abwesenheit von MOG . inkubiert35–55 Peptid (3 μg/ml) für 44 Stunden Stimulation. Die Zellen wurden dann dreimal mit 1 × PBS gewaschen und mit Fluorophor-konjugierten Antikörpern markiert, um aktivierte Teffs und Tregs unter Verwendung von Anti-CD3, -CD4, -Vβ11, -CD25 und CD69 zu bestimmen, gefolgt von einer Analyse (ergänzende Abbildung 9).

FACS-Analyse. Mononukleare Zellen wurden markiert und unter Verwendung eines LSR II-Durchflusszytometers (BD Biosciences) analysiert. Zur Bestimmung von Zellphänotypen, die aus dem ZNS isoliert wurden, wurden Ereignisse wie in den ergänzenden Abbildungen 2 und 4 gezeigt gegatet. Um den Anteil der im Rückenmark vorhandenen antigenspezifischen T-Zellen zu bestimmen, wurden Vβ11 + CD3 + CD4 + T-Zellen mit Gating-Strategie, gezeigt in ergänzender Abbildung 5. Eine Phänotypisierung von mononuklearen Gehirnzellen wurde durchgeführt, um den Anteil von Mikroglia (CD45 int ), T-Zellen (CD45 hi CD3 + CD4 +/– ), DCs (CD45 hi CD3 – CD11c + ), Makrophagen/ PMNs (CD45 hi CD3 – CD11c – CD11b + ) und B-Zellen (CD45 hi CD3 – CD11c – CD11b – B220 + ergänzende Abbildung 4) und pDCs (CD45 hi CD3 – CD11c – CD11b – B220 + mPDCA-1 + ergänzende Abbildungen 2 und 4). In LNs von 2D2-Mäusen wurden antigenspezifische Helfer-Teffs als CD45 + CD44 hi CD62L – CD3 + CD4 + Vβ11 + definiert und antigenspezifische Tregs wurden als CD45 + Vβ11 + CD3 + CD4 + CD25 hi CD127 lo definiert (Ergänzende Abbildungen 6 und 7 und Ref. 56).

Isolierung von CxLN-DCs und DTH. Die Fähigkeit von DCs, die vom ZNS zu den CxLNs wanderten, eine anti-MOG-spezifische Immunantwort aufzubauen, wurde mit einem modifizierten DTH-Modell untersucht (39). Kurz gesagt, C57BL/6-Mäusen wurde icv oder über RFB eine Kanüle verabreicht, um eine kontinuierliche Infusion von Fingolimod (300 ng/d) oder Vehikel über 4 Wochen zu erhalten. Die Tiere wurden dann getötet und CxLNs entfernte mononukleare Zellen wurden wie oben isoliert, während die Infusionen aktiv waren. Die Zellen wurden mit Anti-CD3- und Anti-CD11c-Antikörpern markiert. Die CD3-CD11c + -Zellpopulation wurde mit dem Influx-Zellsorter (BD Biosciences) und den in der ergänzenden Abbildung 9 gezeigten Parametern auf eine Reinheit von >99% sortiert. Die sortierten Zellen (4–8 × 10 4 Zellen/20 μl Medium) wurden dann injiziert in eine Ohrmuschel einer separaten Kohorte von MOG-vorgeimpften C57BL/6-Mäusen (7 Tage vor der Zellinjektion) wurde der anderen Ohrmuschel ein Volumen an azellulärem Medium als Kontrolle injiziert. 10 Tage nach der Injektion wurden beide Ohrmuscheln mit MOG-Peptid (50 &mgr;g/20 &mgr;l/Ohr) gereizt. Die Ohrdicke wurde vor und 24 Stunden nach der MOG-Belastung unter Verwendung eines digitalen Mikrometers gemessen. Die DTH-Reaktion wurde durch Subtrahieren der Ohrdicke vor der Manipulation von der Messung 24 Stunden nach der Herausforderung gemessen.

Statistiken. Da die Daten nichtparametrisch waren, wurden alle Vergleiche unter Verwendung des entsprechenden nichtparametrischen Tests durchgeführt. Wenn im Laufe der Zeit Reihenmessungen vorgenommen wurden, wurden die Gruppen mit Hilfe von ANOVA mit wiederholten Messungen verglichen. Die Regressionsanalyse wurde unter Verwendung der Methode von Poisson durchgeführt. EIN P ein Wert von weniger als 0,05 wurde als signifikant erachtet, und die angegebenen Werte sind gegebenenfalls zweiseitig.

Zulassung zum Studium. Die Tierethikkommissionen des Garvan Institute oder der University of Queensland oder die IACUC des Salk Institute genehmigten alle Arbeiten.

D. A. Brown wird von Multiple Sclerosis Research Australia, The MS Angels Canberra, SpinalCure/NRMA, der National Multiple Sclerosis Society USA, Trish Multiple Sclerosis Research Foundation Australia, New South Wales Health Research and Development Infrastructure Grants und dem NHMRC unterstützt. SPORT. Sawchenko wird vom NIH Grant NS-21182, der Clayton Medical Research Foundation und dem Leona M. and Harry B. Helmsley Charitable Trust (Nr. 2012PG-MED002) unterstützt. D. A. Brown ist NHMRC Australia Biomedical Research Fellow und The Inaugural SpinalCure Australia Senior Research Fellow. M.J. Ruitenberg wird durch ein SpinalCure Australia Career Development Fellowship unterstützt. SPORT. Sawchenko ist Senior Investigator der Clayton Medical Research Foundation. Die Autoren danken William Sewell für aufschlussreiche Durchsicht und hilfreiche Kritik am Manuskript während der Erstellung.

Interessenkonflikt: Die Autoren haben erklärt, dass kein Interessenkonflikt besteht.

Referenzinformationen: J Clin Invest. 2014124(3):1228–1241. doi:10.1172/JCI71544.


Abstrakt

Studien haben getrennt gezeigt, dass Hypertonie mit einer Thrombozytenaktivierung in der Peripherie (was zu einer Akkumulation und einer lokalisierten Entzündungsreaktion führt) und einer Gliaaktivierung im Gehirn verbunden ist. Wir untersuchten den Beitrag von Blutplättchen bei Hirnentzündungen, insbesondere bei der Gliaaktivierung in vitro und in einem Rattenmodell für Bluthochdruck. Wir fanden heraus, dass HTN die Expression von Adhäsionsmolekülen wie JAM-1, ICAM-1 und VCAM-1 auf dem Endothel des Gehirns erhöhte und zur Ablagerung von Blutplättchen im Gehirn führte. Die Ablagerung von Blutplättchen bei hypertensiven Ratten war mit vermehrtem CD40 und CD40L und der Aktivierung von Astrozyten (GFAP-Expression) und Mikroglia (Iba-1-Expression) im Gehirn verbunden. Blutplättchen, die aus hypertensiven Ratten isoliert wurden, hatten signifikant höhere sCD40L-Spiegel und induzierten eine stärkere Gliaaktivierung als Blutplättchen aus normotensiven Ratten. Aktivierung von Thrombozyten mit ADP-induzierter sCD40L-Freisetzung und Aktivierung von Astrozyten und Mikroglia. Darüber hinaus induzierte CD40L die Aktivierung von Gliazellen (Astrozyten und Mikroglia), NFкB- und MAPK-Entzündungssignale, die in Neuroinflammation und neuronaler Schädigung (erhöhte apoptotische Zellen) gipfelten. Wichtig ist, dass die Injektion von ADP-aktivierten Blutplättchen in normotensiven Ratten eine starke Aktivierung von Astrozyten und Mikroglia induzierte und die Plasma-sCD40L-Spiegel im Vergleich zu Kontroll-Blutplättchen erhöhte. Im Gegensatz dazu verhinderte die Hemmung der Thrombozytenaktivierung durch Clopidogrel oder die Unterbrechung des CD40-Signalwegs die Aktivierung von Astrozyten und Mikroglia und sorgte bei beiden für eine Neuroprotektion in vivo und in vitro Bedingungen. Somit haben wir das Thrombozyten-CD40L als ein wichtiges entzündliches Molekül für die Induktion der Astrozyten- und Mikroglia-Aktivierung identifiziert, die hauptsächlich zu einer entzündungsvermittelten Schädigung im Gehirn beitragen.