Information

8.2: Das Zeug der Gene - Biologie

8.2: Das Zeug der Gene - Biologie


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Dass alle eukaryontischen Zellen einen Kern enthalten, wurde Ende des 19. Jahrhunderts verstanden. Ungefähr zur gleichen Zeit gewann die Vorstellung, dass der Zellkern genetische Informationen enthält, an Bedeutung. 1910 erhielt Albrecht Kossel den Nobelpreis für Physiologie oder Medizin 1910 für seine Entdeckung von Adenin, Thymin, Cytosin und Guanin (die vier DNA-Basen) sowie von Uracil in der RNA. Mendels Vererbungsgesetze, die 1865 vorgestellt wurden, wurden nicht allgemein verstanden, wahrscheinlich weil sie sich auf eine starke Dosis Arithmetik und Statistik stützten, als der Nutzen der quantitativen Biologie nicht sehr geschätzt wurde. Aber nach der Wiederentdeckung drei Jahrzehnte später nahm die Zahl der bekannten vererbten Merkmale in einem bestimmten Organismus rapide zu. Zu dieser Zeit war DNA als kleines, einfaches Molekül bekannt, das nur aus den vier Nukleotiden bestand (siehe DNA-Struktur unten für zusätzliche historische Perspektive). Die Frage war also, wie eine so kleine, einfache Erklärung für die Vererbung so vieler verschiedener physischer Merkmale sein konnte. Die Erkenntnis, dass Enzymaktivitäten genauso vererbt werden wie morphologische Merkmale, führte zu dem Ein-Gen-ein-Enzym Hypothese, die G. W. Beadle, E. L. Tatum und J. Lederberg 1958 den Nobelpreis für Physiologie und Medizin einbrachte. Als sich später herausstellte, dass Enzyme Proteine ​​sind, wurde die Hypothese Ein-Gen-Ein-Protein. Als gezeigt wurde, dass Proteine ​​aus einem oder mehreren Polypeptiden bestehen, lautete die endgültige Hypothese: Ein-Gen-Ein-Polypeptid. Diese Beziehung zwischen Genen und Proteinen konnte jedoch kein Licht darauf werfen, wie DNA das genetische Material sein könnte. Ganz im Gegenteil! Als Ketten von bis zu 20 verschiedenen Aminosäuren hatten Polypeptide und Proteine ​​das Potenzial für eine ausreichende strukturelle Vielfalt, um die wachsende Zahl vererbbarer Merkmale in einem bestimmten Organismus zu erklären. Daher schienen Proteine ​​wahrscheinlichere Kandidaten für die Vererbungsmoleküle zu sein.

Die Experimente, über die Sie hier lesen werden, begannen zu Beginn des Ersten Weltkriegs und dauerten bis kurz nach dem Zweiten Weltkrieg. Während dieser Zeit haben wir gelernt, dass DNA kein bloßes Tetramer, sondern ein langes Polymer ist. Dies führte zu einigen sehr cleveren Experimenten, die die wissenschaftliche Gemeinschaft schließlich zu dem Schluss zwangen, dass die DNA und nicht das Protein das genetische Molekül ist, obwohl sie aus nur vier monomeren Einheiten besteht. Zum Schluss schauen wir uns das klassische Werk von . an Watson, Crick, Franklin und Wilkins das enthüllte die Struktur des genetischen Moleküls.

A. Griffiths Experiment

Fred Neufeld, ein deutscher Bakteriologe, der Anfang des 20. Jahrhunderts Pneumokokken-Bakterien untersuchte, entdeckte drei immunologisch unterschiedliche Stämme von Streptokokken-Pneumonie (Typen I, II und III). Der virulente Stamm (Typ III) war für einen Großteil der Sterblichkeit während der Spanische Grippe (Grippe) Pandemie von 1918-1920. Diese Pandemie tötete zwischen 20 und 100 Millionen Menschen, viele davon, weil die Influenza-Virusinfektion das Immunsystem der infizierten Personen schwächte und sie anfällig für bakterielle Infektionen machte Streptokokken-Pneumonie.

In den 1920er Jahren, Frederick Griffith arbeitete mit virulent Wildtyp (Typ III) und gutartig (Typ II) Stämme von S. Lungenentzündung. Die beiden Stämme waren in Petrischalen leicht zu unterscheiden, da der virulente Stamm morphologisch einwuchs glatte Kolonien, während sich der gutartige Stamm bildete grobe Kolonien. Aus diesem Grund wurden die beiden Bakterienstämme genannt S und R, bzw. Das wissen wir jetzt S Zellen sind mit einer Polysaccharid-Kapsel (Schleim) überzogen, wodurch die Kolonien glatt erscheinen. Im Gegensatz, R Zellkolonien sehen rau aus (glänzen nicht), weil ihnen die Polysaccharidbeschichtung fehlt.

Griffith wusste, dass Mäuse mit S Zellen töteten sie innerhalb von etwa einem Tag! Injektion des nicht-tödlichen R Zellen hingegen verursachten keinen Schaden. Dann vermutete er, dass die Exposition von Mäusen gegenüber dem R-Stamm von S. Lungenentzündung Zuerst würden sie gegen eine tödliche Infektion durch S-Zellen immunisiert. Sein experimentelles Protokoll und seine Ergebnisse, die 1928 veröffentlicht wurden, sind unten zusammengefasst.

Um seine Hypothese zu testen, injizierte Griffith Mäusen R-Zellen. Einige Zeit später injizierte er ihnen S-Zellen. Der Versuch, die Mäuse gegen S. Lungenentzündung war nicht erfolgreich! Den Kontrollmäusen wurden S-Stammzellen injiziert und die experimentellen Mäuse, die zuerst die R-Stammzellen und dann die S-Zellen erhielten, starben alle in kurzer Zeit! Wie erwartet überlebten nur Mäuse, denen R-Zellen injiziert worden waren.

Griffith überprüfte auch das Blut seiner Mäuse auf das Vorhandensein von Bakterienzellen:

· Mäusen mit gutartiger Injektion R (grobe) Stammzellen überlebten und nach dem Ausplattieren von Blut aus den Mäusen auf Nährmedium wuchsen keine Bakterienzellen.

· Viele Kolonien von S-Zellen wuchsen aus dem Blut von toten Mäusen, denen S-Zellen injiziert wurden.

Griffith führte zwei weitere Experimente durch, die in der Abbildung gezeigt sind:

1. Er injizierte Mäusen durch Hitze abgetötete S-Zellen; wie erwartet überlebten diese Mäuse. Das Blut dieser Mäuse enthielt keine Bakterienzellen. Dies wurde „erwartet“, da das Erhitzen der S-Zellen die gleiche Wirkung haben sollte wie die Pasteurisierung auf Bakterien in der Milch!

2. Griffith injizierte Mäusen auch a Mischung aus lebenden R-Zellen und durch Hitze abgetöteten S-Zellens, in der Hoffnung, dass die Kombination bei der Maus Immunität induzieren könnte, bei der die Injektion der R-Zellen allein fehlgeschlagen war. Sie können sich seine Überraschung vorstellen, als die injizierten Mäuse nicht immunisiert wurden, sondern starben und sich reichlich S-Zellen in ihrem Blut angesammelt hatten.

Griffith erkannte, dass bei seinen Experimenten etwas Wichtiges passiert war. In der Mischung aus lebenden R-Zellen und durch Hitze abgetöteten S-Zellen hatte etwas, das von den toten S-Zellen freigesetzt wurde, einige R-Zellen transformiert. Griffith nannte dieses „etwas“ das Transformationsprinzip, ein Molekül, das in den Trümmern toter S-Zellen vorhanden ist und manchmal von einigen lebenden R-Zellen erworben wird, wodurch sie in virulente S-Zellen umgewandelt werden. Wir wissen jetzt, dass R-Zellen eine Polysaccharidhülle fehlt und dass das Immunsystem der Wirtszelle R-Zellen angreifen und beseitigen kann, bevor eine ernsthafte Infektion auftreten kann.

B. Das Avery-MacLeod-McCarty-Experiment

Griffith kannte die chemische Identität des Umwandlungsprinzips nicht. Seine Experimente führten jedoch zu Studien, die bewiesen, dass DNA der „Stoff der Gene“ ist. Mit verbesserten molekularen Reinigungstechniken, die in den 1930er Jahren entwickelt wurden, transformierten O. Avery, C. MacLeod und M. McCarty R-Zellen in vitro (das heißt, ohne die Hilfe einer Maus!). Sie reinigten durch Hitze abgetötete S-Zell-Komponenten (DNA, Proteine, Kohlenhydrate, Lipide…) und testeten separat die Transformationsfähigkeit jeder molekularen Komponente an R-Zellen in einem Reagenzglas.

Die Experimente von Avery et al. sind im Folgenden zusammengefasst.

Da nur die DNA-Fraktion der toten S-Zellen könnte eine Transformation bewirken, Avery et al. schlussfolgerte, dass DNA die Transformierendes Prinzip. Trotz dieser Ergebnisse wurde die DNA nicht ohne weiteres als Genmaterial akzeptiert. Der Knackpunkt war, dass die DNA nur aus vier Nukleotiden bestand. Obwohl Wissenschaftler wussten, dass DNA ein großes Polymer ist, dachten sie sich DNA immer noch als ein einfaches Molekül, zum Beispiel ein Polymer, das aus sich wiederholenden Sequenzen der vier Nukleotide besteht:

…AGCTAGCTAGCTAGCTAGCT…

Nur die scheinbar endlosen Kombinationen von 20 Aminosäuren in Proteinen versprachen die biologische Spezifität, die notwendig ist, um die vielen genetischen Merkmale eines Organismus zu erklären. Mangels struktureller Vielfalt wurde die DNA als bloßes Gerüst für Proteingene erklärt. Um die berühmte Aussage von Marshal McLuhan zu adaptieren, dass das Medium ist die Nachricht (d.h. Äther haben nicht nur vermitteln, aber sind die Botschaft), glaubten viele immer noch, dass Proteine ​​das Medium der genetischen Information sind ebenso gut wie die funktionale Nachricht selbst.

Die Zurückhaltung einflussreicher Wissenschaftler der Zeit, eine DNA zu akzeptieren Transformationsprinzip seinen Entdeckern den verdienten Nobelpreis beraubt. Nachdem neue Beweise weiteren Widerstand gegen diese Annahme unhaltbar machten, gab sogar das Nobelkomitee zu, dass die Nichtvergabe eines Nobelpreises für die Entdeckungen von Avery et al. war ein Fehler. Die Schlüsselexperimente von Alfred Hershey und Martha Chase haben schließlich jede Vorstellung, Proteine ​​seien Gene, zunichte gemacht.

167 Transformation in und aus Mäusen; Griffith, McCarthyet al.

C. Das Hershey-Chase-Experiment

Biochemisch ist bekannt, dass Bakterienviren aus DNA bestehen, die in einer Proteinkapsel eingeschlossen ist. Der Lebenszyklus von Bakterienviren (Bakteriophagen oder kurz Phagen) beginnt mit der Infektion eines Bakteriums, wie unten dargestellt.

Phagen sind inerte Partikel, bis sie an Bakterienzellen binden und diese infizieren. Phagenpartikel, die zu einer Bakterienkultur hinzugefügt wurden, konnten in einem Elektronenmikroskop an Bakterienoberflächen angeheftet werden. Die Ermittler fanden heraus, dass sie durch Rühren in einem Mixer (ähnlich wie in Ihrer Küche) Phagenpartikel von Bakterien ablösen konnten. Die Zentrifugation trennte dann die Bakterienzellen in einem Pellet am Boden des Zentrifugenröhrchens, wobei die abgelösten Phagenpartikel im Überstand zurückblieben. Durch Zugabe von Phagen zu Bakterien und anschließendes Ablösen des Phagen von den Bakterien zu unterschiedlichen Zeitpunkten konnte bestimmt werden, wie lange der Phagen anhaften musste, bevor die Bakterien infiziert wurden. Es stellte sich heraus, dass pelletierte Zellen, die für kurze Zeit an Phagen angeheftet waren, überleben und sich vermehren, wenn sie in Wachstumsmedium resuspendiert werden. Aber pelletierte Zellen, die längere Zeit an Phagen haften geblieben waren, waren infiziert worden; zentrifugal von den abgelösten Phagen getrennt und in frischem Medium resuspendiert, würden diese Zellen weitermachen und lysieren, wodurch neue Phagen produziert werden. Daher dauerte die Übertragung der genetischen Information für die Virulenz vom Virus auf den Phagen einige Zeit. Das für Infektion und Virulenz verantwortliche virale Erbgut war offenbar nicht mehr mit der Phagenkapsel assoziiert, die aus dem Zentrifugalüberstand gewonnen werden konnte.

Alfred Hershey und Martha Chase entwarfen ein Experiment, um festzustellen, ob die DNA umschlossen vom viralen Proteinkapsel oder das Kapselprotein selbst bewirkte, dass der Phagen das Bakterium infizierte. Im Experiment sind sie separat gewachsen E coli Zellen infiziert mit T2-Bakteriophage in Gegenwart von entweder 32P oder 35S (radioaktiv Isotope von Phosphor bzw. Schwefel). Das Ergebnis war die Produktion von Phagen, die entweder radioaktive DNA oder radioaktive Proteine ​​enthielten, aber nicht beides (denken Sie daran, dass nur DNA Phosphor und nur Proteine ​​Schwefel enthalten). Sie werden dann separat frisch infiziert E coli Zellen mit entweder 32P- oder 35S-markierter, radioaktiver Phagen. Ihr Experiment wird unten beschrieben.

Phagen und Zellen wurden entweder mit 32P oder 35S gerade lang genug inkubiert, um eine Infektion zu ermöglichen. Ein Teil jeder Kultur wurde weiterlaufen gelassen und lysiert, um zu beweisen, dass die Zellen infiziert waren. Der Rest jeder Mischung wurde zum Mischer geschickt. Nach Zentrifugation jeder Mischung wurden die Pellets und Überstände untersucht, um zu sehen, wo die radioaktiven Proteine ​​oder DNA verschwunden waren. Nach den Ergebnissen landete das 32P immer im Pellet von Bakterienzellen, während das 35S im Phagenrest im Überstand gefunden wurde. Hershey und Chase kamen zu dem Schluss, dass das genetische Material bakterieller Viren DNA und kein Protein ist, genau wie Avery et al. hatte vorgeschlagen, dass DNA das bakterielle Transformationsprinzip ist.

Angesichts des früheren Widerstands gegen „einfache“ DNA als genetisches Material verwendeten Hershey und Chase bei der Formulierung ihrer Schlussfolgerungen eine vorsichtige Sprache. Sie müssen nicht haben; alle nachfolgenden Experimente bestätigten, dass DNA das genetische Material war. Gleichzeitig mit diesen Bestätigungen wurden Experimente durchgeführt, die zeigten, dass DNA möglicherweise kein so einfaches, unkompliziertes Molekül ist (in der Tat war es nicht!). Für ihre letzten Beiträge zur Bestimmung der DNA als „Stoff der Gene“ teilte Alfred D. Hershey 1969 den Nobelpreis für Physiologie oder Medizin mit Max Delbruck und Salvador E. Luria.

168 Hershey und Chase: Virale Gene sind in der viralen DNA


8.2: Das Zeug der Gene - Biologie

Zielsetzung: Durch die Analyse von Bildern und Beobachtungen, YWBAT: Identifizieren und erklären Sie die Kategorien, die Ökologen verwenden, um Ökosysteme zu organisieren.

  • Fünfte Klasse
    Sechste Klasse, Siebte Klasse, Achte Klasse 3 weitere . , Sechste Klasse, Siebte Klasse, Achte Klasse
  • 53,451 Ansichten
  • 6 Favoriten

Einführung biotischer und abiotischer Faktoren

Zielsetzung: YWBAT: 1) Identifizieren und erklären Sie den Unterschied zwischen lebenden und nicht lebenden Dingen 2) Definieren Sie biotisch, abiotisch und ökologisch

8.26 Klasse Großes Ziel und Überprüfung der Laborausstattung

Rachel Ryland von der Boston Collegiate Charter School

Zielsetzung: - Erklären Sie unser großes Ziel. - Laborgeräte identifizieren. - Erklären Sie, wofür jedes Gerät verwendet wird und in welchen Einheiten es misst.

3.23 Vererbung und genetische Bewertung

Rachel Ryland von der Boston Collegiate Charter School

Zielsetzung: Die Studierenden werden ihre Beherrschung der Ziele in der Einheit Vererbung und Genetik demonstrieren.

9.21 Zelltypen

Rachel Ryland von der Boston Collegiate Charter School

Zielsetzung: Unterscheiden Sie zwischen prokaryontischen und eukaryontischen Zellen. Beschreiben Sie den Aufbau und die Funktion der Zellmembran.

  • Sechste Klasse
    Siebte Klasse, 8. Klasse 2 mehr . , Siebte Klasse, Achte Klasse
  • 6,711 Ansichten
  • 5 Favoriten

Methoden der Bevölkerungsstichprobe

Zielsetzung: YWBAT: Erklären Sie die verschiedenen Methoden, die verwendet werden, um die Populationsgröße einer bestimmten Art zu schätzen.

Beispiel für eine Taschenmaus - Natürliche Selektion

3.14 Monohybridkreuze

Rachel Ryland von der Boston Collegiate Charter School

Zielsetzung: Wenden Sie die dominante/rezessive Beziehung auf das Problem der monohybriden Genetik an.

8.27 Große Ideen für Laborsicherheit und BCCS-Wissenschaft

Rachel Ryland von der Boston Collegiate Charter School

Zielsetzung: - Erklären Sie die Laborsicherheitsverfahren für die Klasse und ihre Bedeutung. - Identifizieren Sie die 6 großen Ideen der BCCS-Wissenschaft.

  • Fünfte Klasse
    Sechste Klasse, Siebte Klasse, Achte Klasse 3 weitere . , Sechste Klasse, Siebte Klasse, Achte Klasse
  • 32,627 Ansichten
  • 6 Favoriten

Nahrungskette

Zielsetzung: YWBAT:
1) Schaffen Sie eine Nahrungskette
2) Erkläre den Unterschied zwischen Erzeuger, Verbraucher und Zersetzer

  • Sechste Klasse
    Siebte Klasse, 8. Klasse 2 mehr . , Siebte Klasse, Achte Klasse
  • 11,778 Ansichten
  • 2 Favoriten

Berechnung der Gesamtbevölkerungsgröße und Bevölkerungsdichte

Zielsetzung: YWBAT: Bevölkerungsdichte berechnen

3.21 Invasive Arten

Rachel Ryland von der Boston Collegiate Charter School

Zielsetzung: Identifizieren Sie, was eine invasive (nicht einheimische) Art ist. Erklären Sie, wie sich invasive Arten negativ auf Gebiete auswirken können, und betreten Sie dann.

  • Achte Klasse
    Neunte Klasse, Zehnte Klasse, Elfte Klasse, Zwölfte Klasse, College Prep. 5 weitere. , Neunte Klasse, Zehnte Klasse, Elfte Klasse, Zwölfte Klasse, College Prep.
  • 8,065 Ansichten

Das „Ich“ in der Evolution: Biologische Individualität

Anke al-Bataineh vom Leadership Preparatory High

Zielsetzung: Die Studierenden verstehen, wie genetische Variationen zu Individualität innerhalb von Populationen führen.

  • Achte Klasse
    Neunte Klasse, Zehnte Klasse, Elfte Klasse, Zwölfte Klasse, College Prep. 5 weitere. , Neunte Klasse, Zehnte Klasse, Elfte Klasse, Zwölfte Klasse, College Prep.

2.7 Meiose

Rachel Ryland von der Boston Collegiate Charter School

Zielsetzung: Diagramm Mitose. Erklären Sie den Prozess der Meiose.

  • Achte Klasse
    Neunte Klasse, Zehnte Klasse, Elfte Klasse, Zwölfte Klasse, College Prep. 5 weitere. , Neunte Klasse, Zehnte Klasse, Elfte Klasse, Zwölfte Klasse, College Prep.
  • 2,667 Ansichten

Wie man ein Weltbild "verkauft"

Anke al-Bataineh vom Leadership Preparatory High

Zielsetzung: Die Studierenden verwenden Modelle aus der Unternehmens-, politischen und zwischenmenschlichen Welt, um einen überzeugenden "Pitch" für Individualismus oder Kollektivismus zu entwickeln.


Welch RA, Burland V, Plunkett G, Redford P, Roesch P, Rasko D, Buckles EL, Liou SR, Boutin A, Hackett J, et al.: Umfangreiche Mosaikstruktur durch die vollständige Genomsequenz von uropathogenen Escherichia coli. Proc Natl Acad Sci USA. 2002, 99: 17020-17024. 10.1073/pnas.252529799.

Rasko DA, Ravel J, Okstad OA, Helgason E, Cer RZ, Jiang L, Shores KA, Fouts DE, Tourasse NJ, Angiuoli SV, et al: Die Genomsequenz von Bacillus cereus ATCC 10987 zeigt metabolische Anpassungen und ein großes Plasmid, das mit Bacillus anthracis pXO1. Nukleinsäuren Res. 2004, 32: 977-988. 10.1093/nar/gkh258.

Paulsen IT, Press CM, Ravel J, Kobayashi DY, Myers GSA, Mavrodi DV, DeBoy RT, Seshadri R, Ren Q, Madupu R, et al: Vollständige Genomsequenz des Pflanzenkommensal Pseudomonas fluorescens Pf-5. Nat. Biotechnologie. 2005, 23: 873-10.1038/nbt1110.

Mongodin EF, Hance IR, Deboy RT, Gill SR, Daugherty S, Huber R, Fraser CM, Stetter K, Nelson KE: Gentransfer und Genomplastizität in Thermotoga Maritima, eine hyperthermophile Modellspezies. J Bakteriol. 2005, 187: 4935-4944. 10.1128/JB.187.14.4935-4944.2005.

Nesbø CL, Nelson KE, Doolittle WF: Suppressive subtraktive Hybridisierung erkennt umfangreiche genomische Diversität in Thermotoga Maritima. J Bakteriol. 2002, 184: 4475-4488. 10.1128/JB.184.16.4475-4488.2002.

Tettelin H, Masignani V, Cieslewicz MJ, Donati C, Medini D, Ward NL, Angiuoli SV, Crabtree J, Jones AL, Durkin AS, et al.: Genomanalyse multipler pathogener Isolate von Streptococcus agalactiae: Implikationen für das mikrobielle "Pan-Genom". Proc Natl Acad Sci USA. 2005, 102: 13950-13955. 10.1073/pnas.0506758102.

Hao W, Golding GB: Muster der bakteriellen Genbewegung. Mol Biol Evol. 2004, 21: 1294-1307. 10.1093/molbev/msh129.

Ortutay C, Gaspari Z, Toth G, Jager E, Vida G, Orosz L, Vellai T: Speziation in Chlamydien: Genomweite phylogenetische Analysen identifizierten einen zuverlässigen Satz erworbener Gene. J. Mol. Evol. 2003, 57: 672-680. 10.1007/s00239-003-2517-3.

Daubin V, Lerat E, Perriere G: Die Quelle von lateral transferierten Genen in bakteriellen Genomen. Genom Biol. 2003, 4: R57-10.1186/gb-2003-4-9-r57.

Hao W, Golding GB: Das Schicksal seitlich übertragener Gene: Leben auf der Überholspur bis hin zur Anpassung oder zum Tod. Genom-Res. 2006, 16: 636-643. 10.1011/gr.4746406.

Marri PR, Bannantine JP, Paustian ML, Golding GB: Lateraler Gentransfer in Mycobacterium avium Unterart Paratuberkulose. Kann J Microbiol. 2006, 52: 560-569. 10.1139/W06-001.

Kunin V, Ouzounis CA: Das Gleichgewicht der treibenden Kräfte während der Genom-Evolution in Prokaryoten. Genom-Res. 2003, 13: 1589-1594. 10.1011/gr.1092603.

Mirkin BG, Fenner TI, Galperin MY, Koonin EV: Algorithmen zur Berechnung sparsamer Evolutionsszenarien für die Genomevolution, der letzte universelle gemeinsame Vorfahre und die Dominanz des horizontalen Gentransfers in der Evolution von Prokaryoten. BMC Evolution Biol. 2003, 3: 2-10.1186/1471-2148-3-2.

McLysaght A, Baldi PF, Gaut BS: Umfangreicher Gengewinn im Zusammenhang mit der adaptiven Evolution von Pockenviren. Proc Natl Acad Sci USA. 2003, 100: 15655-15660. 10.1073/pnas.2136653100.

Mira A, Ochman H, Moran NA: Deletional Bias und die Evolution bakterieller Genome. Trends Genet. 2001, 17: 589-596. 10.1016/S0168-9525(01)02447-7.

Ochman H, Davalos LM: Die Natur und Dynamik bakterieller Genome. Wissenschaft. 2006, 311: 1730-1733. 10.1126/science.1119966.

Lerat E, Ochman H: Erkennen der Pseudogene in bakteriellen Genomen. Nukleinsäuren Res. 2005, 33: 3125-3132. 10.1093/nar/gki631.

Liu Y, Harrison PM, Kunin V, Gerstein M: Umfassende Analyse von Pseudogenen in Prokaryoten: weit verbreiteter Genzerfall und Versagen mutmaßlicher horizontal übertragener Gene. Genom Biol. 2004, 5: R64-10.1186/gb-2004-5-9-r64.

Andersson JO, Andersson SG: Pseudogene, Junk-DNA und die Dynamik von Rickettsien Genome. Mol Biol Evol. 2001, 18: 829-839.

Feil EJ: Kleine Veränderung: Schritt halten mit der Mikroevolution. Nat. Rev. Mikrobiol. 2004, 2: 483-495. 10.1038/nrmicro904.

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped BLAST und PSI-BLAST: eine neue Generation von Proteindatenbank-Suchprogrammen. Nukleinsäuren Res. 1997, 25: 3389-3402. 10.1093/nar/25.17.3389.

Hanage W, Fraser C, Spratt B: Fuzzy-Spezies unter rekombinogenen Bakterien. BMC Biol. 2005, 3: 6-10.1186/1741-7007-3-6.

Thompson JD, Higgins DG, Gibson TJ: CLUSTAL W: Verbesserung der Sensitivität des progressiven multiplen Sequenz-Alignments durch Sequenzgewichtung, positionsspezifische Gap-Penalties und Auswahl der Gewichtsmatrix. Nukleinsäuren Res. 1994, 22: 4673-4680. 10.1093/nar/22.22.4673.

Swofford D: PAUP* 4.0 Beta-Version, Phylogenetische Analyse mit Parsimony (und anderen Methoden). 1998, Sunderland, MA Sinauer Associates

van Dongen S: Ein Clusteralgorithmus für Graphen. Technischer Bericht INS-R0010. 2000, Amsterdam: Nationales Forschungsinstitut für Mathematik und Informatik in den Niederlanden

Konstantinidis KT, Tiedje JM: Genomische Erkenntnisse, die die Artendefinition für Prokaryonten voranbringen. Proc Natl Acad Sci USA. 2005, 102: 2567-2572. 10.1073/pnas.0409727102.

Pearson WR: Effektiver Proteinsequenzvergleich. Methoden Enzymol. 1996, 266: 227-258.

Fraser-Liggett CM: Einblicke in Biologie und Evolution aus der mikrobiellen Genomsequenzierung. Genom-Res. 2005, 15: 1603-1610. 10.1011/gr.3724205.

Nierman WC, DeShazer D, Kim HS, Tettelin H, Nelson KE, Feldblyum T, Ulrich RL, Ronning CM, Brinkac LM, Daugherty SC, et al.: Strukturelle Flexibilität im Burkholderia mallei Genom. Proc Natl Acad Sci USA. 2004, 101: 14246-14251. 10.1073/pnas.0403306101.


Rekombination: Definition, Mechanismus und Typen | Mikrobiologie

In diesem Artikel werden wir diskutieren über: 1. Definition der Rekombination 2. Mechanismus der Rekombination 3. Typen.

Definition der Rekombination:

Die wichtigsten Eigenschaften von Organismen sind die Anpassung an die Umwelt und die Aufrechterhaltung ihrer DNA-Sequenz in der Zellgeneration bis hin zu Generationen mit sehr geringen Veränderungen. Das langfristige Überleben von Organismen hängt von genetischen Variationen ab, einem Schlüsselmerkmal, durch das sich der Organismus an eine sich mit der Zeit ändernde Umgebung anpassen kann.

Diese Variabilität zwischen den Organismen entsteht durch die Fähigkeit der DNA, genetische Neuanordnungen zu durchlaufen, was zu einer geringfügigen Änderung der Genkombination führt. Die Umlagerung der DNA erfolgt durch genetische Rekombination.

Somit ist Rekombination der Prozess der Bildung eines neuen rekombinanten Chromosoms durch die Kombination des genetischen Materials von zwei Organismen. Die neuen Rekombinanten zeigen Veränderungen der phänotypischen Eigenschaften.

Die meisten Eukaryoten zeigen einen vollständigen sexuellen Lebenszyklus einschließlich Meiose, ein wichtiges Ereignis, das durch Rekombination neue Allelkombinationen erzeugt. Möglich wird dies durch den Chromosomenaustausch, der durch das Crossing-Over zwischen den beiden homologen Chromosomen mit identischen Gensequenzen entsteht.

Bis 1945 wurde viel an der eukaryotischen Genetik gearbeitet, die den Grundstein für die klassische Genetik legte. Die Arbeiten zur bakteriellen Genetik wurden zwischen 1945 und 1965 durchgeführt, um das Verständnis der mikrobiellen Genetik auf molekularer Ebene voranzutreiben.

Mechanismus der Rekombination:

Grundsätzlich gibt es drei Theorien, nämlich Bruch und Wiedervereinigung, Bruch und Kopie und vollständige Kopienwahl, die den Mechanismus der Rekombination erklären (Abb. 8.23).

(i) Bruch und Wiedervereinigung:

Zwei homologe Chromosomenduplexe, die paarweise liegen, brechen zwischen den Genorten a und b sowie a + und b + (Abb. 8.23A). Die gebrochenen Segmente verbinden sich kreuzweise und ergeben Rekombinanten, die ein a- und b+-Segment sowie ein a+- und b-Segment enthalten. Diese Art der Rekombination erfordert keine Synthese neuer DNA. Dieses Konzept wurde verwendet, um die genetische Rekombination zu erklären.

(ii) Bruch und Kopieren:

Eine Helix des paarigen homologen Chromosoms (ab und a + b + ) bricht zwischen a und b (Abb. 8.23B). Segment b wird durch ein neu synthetisiertes Segment ersetzt, das von b + kopiert und an einen Abschnitt angehängt wird. Somit enthalten die Rekombinanten und ab + und a + b + .

(iii) Vollständige Kopierauswahl:

1931 schlug Belling diese Theorie für die Rekombination von Chromosomen bei höheren Tieren vor. Dies wurde jedoch von mehreren Arbeitern in Frage gestellt. Daher hat es nur historische Bedeutung.

Nach dieser Theorie dient ein Teil eines Elternstrangs des homologen Chromosoms als Matrize für die Synthese einer Kopie seines DNA-Moleküls. Der Kopiervorgang verlagert sich auf den anderen Elternstrang. Somit enthalten die Rekombinanten einige genetische Informationen eines Elternstrangs und eines anderen Strangs (Abb. 8.23 ​​C).

Arten der Rekombination:

Viele Arten der Rekombination treten in Mikroorganismen auf.

Diese werden grundsätzlich in die folgenden drei Gruppen eingeteilt:

(ii) nicht-reziproke Rekombination und

(iii) Ortsspezifische Rekombination.

(i) Allgemeine Rekombination:

Eine allgemeine Rekombination findet nur zwischen den komplementären Strängen von zwei homologen DNA-Molekülen statt. Smith (1989) untersuchte die homologe Rekombination in Prokaryonten. Die allgemeine Rekombination in E. coli wird durch Basenpaarungswechselwirkungen zwischen den komplementären Strängen zweier homologe DNA-Moleküle gesteuert.

Die Doppelhelix zweier DNA-Moleküle bricht und die beiden gebrochenen Enden verbinden sich mit ihren gegenüberliegenden Partnern, um sich wieder zu vereinen, um eine Doppelhelix zu bilden. Die Austauschstelle kann überall in der homologen Nukleotidsequenz auftreten, wo ein Strang eines DNA-Moleküls Basenpaare mit dem zweiten Strang bildet, um einen Heteroduplex gerade zwischen zwei Doppelhelices zu ergeben (Abb. 8.24).

Im Heteroduplex werden aufgrund von Spaltungs- und Wiedervereinigungsereignissen keine Nukleotidsequenzen an der Austauschstelle verändert. Heteroduplex-Verbindungen können jedoch eine kleine Anzahl von fehlgepaarten Basenpaaren aufweisen.

Die allgemeine Rekombination wird auch als homologe Rekombination bezeichnet, da sie homologe Chromosomen erfordert. In Bakterien und Viren wird die allgemeine Rekombination durch die Produkte von rec-Genen wie dem RecA-Protein durchgeführt. Das RecA-Protein ist sehr wichtig für die DNA-Reparatur, daher handelt es sich um eine recA-abhängige Rekombination.

Urlaubsmodell für allgemeine Rekombination:

Holliday (1974) präsentierte ein Modell zur Darstellung der allgemeinen Rekombination (Abb. 8.25). Nach diesem Modell erfolgt die Rekombination in fünf Schritten wie Strangbruch, Strangpaarung, Stranginvasion/-assimilation, Chiasma-(Crossing-Over)-Bildung, Bruch und Wiedervereinigung und Fehlpaarungsreparatur.

Abb.8.25: Das Holliday-Modell für die reziproke allgemeine Rekombination.

Die allgemeine Rekombination erfolgt durch Crossing-Over durch Paarung zwischen den komplementären Einzelsträngen des DNA-Duplex (a). Zwei homologe Regionen der DNA-Doppelhelix durchlaufen eine Austauschreaktion.

Die homologe Region enthält eine lange Sequenz komplementärer Basenpaarungen zwischen einem Strang aus einer oder zwei ursprünglichen Doppelhelices und einem komplementären Strang aus dem anderen. Es ist jedoch nicht bekannt, wie sich die homologe Region der DNA gegenseitig erkennt.

Eine Liste der Rekombinationsgene und ihrer Funktion ist in Tabelle 8.2 aufgeführt. Die RecBCD-Proteine ​​der recBCD- oder recJ-Gene werden für die Rekombination in E. coli benötigt. Dieses Protein dringt von einem Ende der Doppelhelix in die DNA ein und wandert entlang der DNA an der Doppelhelix mit einer Geschwindigkeit von etwa 300 Nukleotiden pro Sekunde.

Es erzeugt eine Schleife von ssDNA entlang der wandernden DNA (b). Es verwendet Energie aus der Hydrolyse von ATP-Molekülen. Eine spezielle Erkennungsstelle (a) Sequenz von acht Nukleotiden, die über das E. coli-Chromosom (b) verstreut ist, wird in die wandernde DNA-Schleife eingeschnitten, die vom RecBCD-Protein gebildet wird.

Tabelle 8.2: Rekombinations-(rec)-Gene und ihre Funktion.

(B) Strangpaarung:

Die RecBCD-Proteine ​​wirken als DNA-Helikase, da diese ATP hydrolysieren und entlang der DNA-Helix wandern. Somit führen die RecBCD-Proteine ​​zur Bildung von einzelsträngigen Whiskern an der Erkennungsstelle, die von der Helix (c) verdrängt wird. Dies initiiert eine Basenpaarungswechselwirkung zwischen den beiden komplementären Sequenzen der DNA-Doppelhelix.

(C) Stranginvasion/Assimilation:

Ein aus einer DNA-Doppelhelix erzeugter Einzelstrang (Whisker) dringt in die andere Doppelhelix ein (d). In E. coli produziert das recA-Gen RecA-Protein, das für die Rekombination zwischen den Chromosomen wie einzelsträngige (SSB)-Proteine ​​wichtig ist. Das RecA-Protein bindet fest an einzelsträngige DNA, um ein Nukleoprotein-Filament zu bilden.

Roca und Cox (1990) haben die Struktur und Funktion des RecA-Proteins überprüft. Das RecA-Protein fördert dabei die schnelle Renaturierung von komplementärer ssDNA, die ATP hydrolysiert. RecA-Protein hat mehrere Bindungsstellen, daher kann es eine ssDNA und anschließend eine dsDNA binden. RecA-Protein bindet zuerst an ssDNA und sucht dann nach Homologie zwischen dem Donorstrang und dem Empfängermolekül.

Aufgrund der Anwesenheit dieser Stellen katalysiert das RecA-Protein eine mehrstufige Reaktion (sog. Synapse) zwischen der homologen Region der ssDNA und einer DNA-Doppelhelix. E. coli SSB-Protein hilft dem Rec-Protein, diese Reaktionen durchzuführen. Wenn eine Homologieregion durch eine anfängliche Basenpaarung zwischen den komplementären Sequenzen identifiziert wird, tritt der entscheidende Schritt in der Synapse ein.

In-vivo-Experimente haben gezeigt, dass zwischen einer mit RecA-Protein bedeckten ssDNA und einer dsDNA-Helix mehrere Arten von Komplexen gebildet werden. Zunächst wird ein nicht-basengepaarter Komplex gebildet, der beim Auffinden einer homologen Region in eine dreisträngige Struktur (ssDNA, dsDNA und RecA-Protein) umgewandelt wird.

Dieser Komplex ist instabil und spinnt einen DNA-Heteroduplex plus eine verdrängte ssDNA aus der ursprünglichen Helix. Sobald die homologen Regionen angetroffen und die ssDNA und dsDNA komplexiert sind, wird eine stabile D-Schleife gebildet (d).

Der nächste Schritt ist die Assimilation von Strang- und Nick-Ligation (e). Der Donorstrang verdrängt allmählich den Empfängerstrang, was als Zweigmigration bezeichnet wird. Nach der Synapsenbildung wird die Heteroduplex-Region durch Protein-gerichtete Verzweigungsmigration, katalysiert durch das RecA-Protein, vergrößert.

Die auf das RecA-Protein gerichtete Verzweigungsmigration schreitet aufgrund der Zugabe von mehr RecA-Protein zu einem Ende des RecA-Proteinfilaments auf der ssDNA mit einer einheitlichen Geschwindigkeit in eine Richtung fort. Die Verzweigungsmigration kann an jedem Punkt stattfinden, an dem zwei Einzelstränge mit der Sequenz versuchen, sich mit demselben komplementären Strang zu paaren.

Eine ungepaarte Region des anderen Einzelstrangs, die zu einer Verschiebung des Verzweigungspunkts führt, ohne die Gesamtzahl der DNA-Basenpaare zu ändern. An der Rekombination sind spezielle DNA-Helikasen beteiligt, die die proteingerichtete Verzweigungsmigration katalysieren. Im Gegensatz dazu verläuft die spontane Zweigwanderung in beide Richtungen fast gleich schnell. Daher macht es über eine lange Distanz kleine Fortschritte.

(e) Chiasma oder Crossing-Over-Formation:

Der Austausch eines Einzelstrangs zwischen zwei Doppelhelices ist ein anderer Schritt in einem allgemeinen Rekombinationsereignis. Nach dem anfänglichen Querstrangaustausch wird angenommen, dass weitere Strangaustausche zwischen den beiden eng gegenüberliegenden Helices schnell ablaufen. Eine Nuklease spaltet und baut die D-Schleife an einigen Stellen teilweise ab.

In diesem Stadium folgen möglicherweise verschiedene Organismen verschiedenen Wegen. In den meisten Fällen wird jedoch eine wichtige Struktur namens Cross-Strang-Exchange (auch Holliday Juncture oder Chi-Form oder Chiasmas genannt) von den beiden beteiligten DNA-Helices (g) gebildet. Eine Chi-Form einzelsträngiger Verbindungen in der Cross-Over-Region wurde auch von Dressier und Potter (1982) unter dem Elektronenmikroskop beobachtet.

Die Chi-Form von zwei homologen Helices, die sich anfänglich paarten und durch gegenseitigen Austausch von zwei der vier Stränge zusammengehalten wurden, wobei ein Strang von jeder der Helices stammt (g).

Die chi-Form hat zwei wichtige Eigenschaften, (i) der Austauschpunkt kann durch eine Doppelzweigwanderung schnell entlang der Helices hin und her wandern, und (ii) sie enthält zwei Strangpaare, ein Paar sich kreuzender Stränge und das andere Paar von sich nicht kreuzenden Strängen.

(f) Bruch und Wiedervereinigung:

Die chi-Struktur kann mehrere Umdrehungen (h) isomerisieren. Dies führt zu einer Veränderung von zwei ursprünglichen sich nicht kreuzenden Strängen in die sich kreuzenden Stränge und die sich kreuzenden Stränge in die sich nicht kreuzenden Stränge. Um zwei separate DNA-Helices zu regenerieren, sind Bruch und Wiedervereinigung in zwei sich kreuzenden Strängen erforderlich.

Wenn Bruch und Wiedervereinigung vor der Isomerisierung auftreten, würden die beiden sich kreuzenden Stränge nicht auftreten. Daher ist eine Isomerisierung für das Brechen und die Wiedervereinigung von zwei homologen DNA-Doppelhelices erforderlich, die aus einer allgemeinen genetischen Rekombination resultieren.

Bruch und Wiedervereinigung treten entweder in der vertikalen oder horizontalen Ebene auf. Wenn der Bruch horizontal auftritt, würden die Rekombinanten den Genotyp ABlab mit einer kleinen Änderung der Basensequenzen in der inneren Region enthalten (i).

Wenn jedoch ein Bruch vertikal auftritt, würden die Rekombinanten Ab/aB (J) enthalten. Es wird angenommen, dass das RurC-Protein und das RecG-Protein, die von ruvC- bzw. recG-Genen exprimiert werden, alternative Endonukleasen sind, die für die Holliday-Struktur spezifisch sind.

(g) Nichtübereinstimmung reparieren (Mismatch Proof Read&Shying System):

Es ist ein solches Reparatursystem, das fehlgepaarte Basenpaare ungepaarter Regionen nach der Rekombination korrigiert. Dieses System erkennt fehlgepaarte Funktionen der DNA-Polymerase. Der Mechanismus beinhaltet die Exzision einer der anderen fehlgepaarten Basen zusammen mit etwa 3.000 Nukleotiden. This RecFJO is involved in the repair of short mismatch either in the initial stage or at the end of recombination.

The two proteins MutS and MutL are present in bacteria and eukaryotes. The MutS protein binds to mismatched base pair, whereas MutL scan the DNA for a nick (Fig. 8.26).

When a nick is formed MutL triggers the degradation of the nicked strand all the way back through the mismatch, because the nicks are largely confined to the newly replicated strands in eukaryotes, replication errors are selectively removed. In bacteria the mechanism is the same except that an additional protein MutH nicks the un-methylated GATC sequences and begins the process.

It has been demonstrated in yeast and bacteria that the same mismatch repair system which removes replication errors as in Fig. 8.26 also interrupts the genetic recombination events between imperfectly matched DNA sequences. It is known that homologous genes in two closely related bacteria (E. coli and S.typhimurium) generally will not recombine, even after having 80% identical nucleotide sequences.

However, when mismatch repair system is inactivated by mutation, the frequency of such interspecies recombination increases by 100-fold. This mechanism protects the bacterial genome from sequence changes that would be caused by recombination with foreign DNA molecules entering in the cell.

(ii) Non-reciprocal Recombination (Gene Conversion):

The fundamental law of genetics is that the two partners contribute the equal amount of genes to the offsprings. It means that the offsprings inherit the half complete set of genes from the male and half from the female. One diploid cell undergoes meiosis producing four haploid cells therefore, the number of genes contributed by male gets halved and so the genes of female.

In higher animals like man it is not possible to analyse these genes taking a single cell. However, in certain organisms such as fungi it is possible to recover and analyse all the four daughter cells produced from a single cell through meiosis.

Occasionally, three copies of maternal allele and only one copy of paternal allele is formed by meiosis. This indicates that one of two copies of parental alleles has been altered to the maternal allele. This gene alteration is of non-reciprocal type and is called gene conversion. Gene conversion is thought to be an important event in the evolution of certain genes and occurs as a result of the mechanism of general recombination and DNA repair.

Non-reciprocal general recombination is given in Fig. 8.27. Kobayashi (1992) has discussed the mechanism for gene conversion and homologous recombination.

This process starts when a nick is made in one of the strands (a). From this point DNA polymerase synthesizes an extra copy of a strand and displaces the original copy as a single strand (b). This single strand starts pairing with the homologous region as in lower duplex of DNA molecule (b). The short unpaired strand produced in step (b) is degraded when the transfer of nucleotide sequence is completed. The results are observed (in the next cycle) when DNA replication has separated the two non-matching strands (c).

(iii) Site-Specific Recombination:

Site specific recombination alters the relative position of nucleotide sequences in chromosome. The base pairing reaction depends on protein mediated recognition of the two DNA sequences that will combine. Very long homologous sequence is not required.

Unlike general recombination, site specific recombination is guided by a recombination enzyme that recognises specific nucleotide sequences present on one of both recombining DNA molecules. Base pairing is not involved, however, if occurs the heteroduplex joint is only a few base pair long.

It was first discovered in phage λ by which its genome moves into and out of the E. coli chromosome. After penetration phage encoded an enzyme, lambda integrase which catalyses the recombination process (Fig. 8.28). Lambda integrase binds to a specific attachment site of DNA sequence on each chromosome.

It makes cuts and breaks a short homologous DNA sequences. The integrase switches the partner strands and rejoins them to form a heteroduplex joint of 7 bp long. The integrase resembles a DNA topoisomerase in rejoining the strands which have previously been broken.

Site specific recombination is of the following two types:

(a) Conservative site-specific recombina­tion:

Production of a very short heteroduplex by requiring some DNA sequence that is the same on the two DNA molecules is known as conservative site-specific recombination. The detail procedure is described in Fig. 8.28.

(b) Trans-positional site-specific recombi­nation:

There is another type of recombination system known as trans-positional site-specific (TSS) recombination. The TSS recombination does not produce heteroduplex and requires no specific sequences on the largest DNA.

There are several mobile DNA sequences including many viruses and transposable elements that encode integrates. The enzyme integrates by involving a mechanism different from phage λ insert its DNA into a chromosome. Each enzyme of integrates recog­nises a specific DNA sequence like phage λ.

K. Mizuuchi (1992a) reviewed the mecha­nism of trans-positional recombination based on the studies of bacteriophage Mu and the other elements. The enzyme integrase was first purified from Mu. Similar to integrase of phage λ, the Mu integrase also carries out of its cutting and rejoining reactions without requirement of ATP. Also they do not require a specific DNA sequence in the target chromosome and do not form a joint of heteroduplex.

Different steps of TSS recombinational events are shown in Fig. 8.29. The integrase makes a cut in one strand at each end of the viral DNA sequences, and exposes the 3′-OH group that protrudes out. Therefore, each of these 3′-OH ends directly invades a phosphodiester bond on opposite strands of a randomly selected site on a target chromosome.

This facilitates to insert the viral DNA sequence into the target chromosome, leaving two short single stranded gaps on each side of recombinational DNA molecule.

These gaps are filled in later on by DNA repair process (i.e. DNA polymerase) to complete the recombination process. This mechanism results in formation of short duplication (short repeats of about 3 to 12 nucleotide long) of the adjacent target DNA sequence. Formation of short repeats is the hall-marks of a TSS recombination.

Fig. 8.29 : Mechanism of trans-positional site-specific recombination SDR, short direct repeats of target DNA sequence.


A Family Consents to a Medical Gift, 62 Years Later

Henrietta Lacks was only 31 when she died of cervical cancer in 1951 in a Baltimore hospital. Not long before her death, doctors removed some of her tumor cells. They later discovered that the cells could thrive in a lab, a feat no human cells had achieved before.

Soon the cells, called HeLa cells, were being shipped from Baltimore around the world. In the 62 years since — twice as long as Ms. Lacks’s own life — her cells have been the subject of more than 74,000 studies, many of which have yielded profound insights into cell biology, vaccines, in vitro fertilization and cancer.

But Henrietta Lacks, who was poor, black and uneducated, never consented to her cells’ being studied. For 62 years, her family has been left out of the decision-making about that research. Now, over the past four months, the National Institutes of Health has come to an agreement with the Lacks family to grant them some control over how Henrietta Lacks’s genome is used.

“In 20 years at N.I.H., I can’t remember something like this,” Dr. Francis S. Collins, the institute’s director, said in an interview.

The agreement, which does not provide the family with the right to potential earnings from future research on Ms. Lacks’s genome, was prompted by two projects to sequence the genome of HeLa cells, the second of which was published Wednesday in the journal Nature.

Though the agreement, which was announced Wednesday, is a milestone in the saga of Ms. Lacks, it also draws attention to a lack of policies to balance the benefits of studying genomes with the risks to the privacy of people whose genomes are studied — as well as their relatives.

As the journalist Rebecca Skloot recounted in her 2010 best-seller, “The Immortal Life of Henrietta Lacks,” it was not until 1973, when a scientist called to ask for blood samples to study the genes her children had inherited from her, that Ms. Lacks’s family learned that their mother’s cells were, in effect, scattered across the planet.

Some members of the family tried to find more information. Some wanted a portion of the profits that companies were earning from research on HeLa cells. They were largely ignored for years.

Bild

Ms. Lacks is survived by children, grandchildren and great-grandchildren, many still living in or around Baltimore.

And this March they experienced an intense feeling of déjà vu.

Scientists at the European Molecular Biology Laboratory published the genome of a line of HeLa cells, making it publicly available for downloading. Another study, sponsored by the National Institutes of Health at the University of Washington, was about to be published in Nature. The Lacks family was made aware of neither project.

“I said, ‘No, this is not right,’ ” Jeri Lacks Whye, one of Henrietta Lacks’s grandchildren, said in an interview. “They should not have this up unless they have consent from the family.”

Officials at the National Institutes of Health now acknowledge that they should have contacted the Lacks family when researchers first applied for a grant to sequence the HeLa genome. They belatedly addressed the problem after the family raised its objections.

The European researchers took down their public data, and the publication of the University of Washington paper was stopped. Dr. Collins and Kathy L. Hudson, the National Institutes of Health deputy director for science, outreach and policy, made three trips to Baltimore to meet with the Lacks family to discuss the research and what to do about it.

“The biggest concern was privacy — what information was actually going to be out there about our grandmother, and what information they can obtain from her sequencing that will tell them about her children and grandchildren and going down the line,” Ms. Lacks Whye said.

The Lacks family and the N.I.H. settled on an agreement: the data from both studies should be stored in the institutes’ database of genotypes and phenotypes. Researchers who want to use the data can apply for access and will have to submit annual reports about their research. A so-called HeLa Genome Data Access working group at the N.I.H. will review the applications. Two members of the Lacks family will be members. The agreement does not provide the Lacks family with proceeds from any commercial products that may be developed from research on the HeLa genome.

With this agreement in place, the University of Washington researchers were then able to publish their results. Their analysis goes beyond the European study in several ways. Most important, they show precisely where each gene is situated in HeLa DNA.

A human genome is actually two genomes, each passed down from a parent. The two versions of a gene may be identical, or they may carry genetic variations setting them apart.

“If you think of the variations as beads on a string, you really have two strings,” said Dr. Jay Shendure, who led the Washington genome study. “The way we sequence genomes today, for the most part we just get a list of where the genes are located, but no information about which ones are on which string.”

Dr. Shendure and his colleagues have developed new methods that allow them to gather that information. By reconstructing both strings of the HeLa genome, they could better understand how Ms. Lacks’s healthy cells had been transformed over the past 60 years.

For example, they could see how Ms. Lacks got cancer. Cervical cancer is caused by human papillomavirus infections. The virus accelerates the growth of infected cells, which may go on to become tumors.

Dr. Shendure and his colleagues discovered the DNA of a human papillomavirus embedded in Ms. Lacks’s genome. By landing at a particular spot, Ms. Lacks’s virus may have given her cancer cells their remarkable endurance.

“That’s one of the frequent questions that I and the Lacks family get whenever we talk about this stuff,” Ms. Skloot said. “The answer was always, ‘We don’t know.’ Now, there’s at least somewhat of an answer: because it happened to land right there.”

Richard Sharp, the director of biomedical ethics at the Mayo Clinic, said he thought the agreement “was pretty well handled.” But he warned that it was only a “one-off solution,” rather than a broad policy to address the tension between genome research and the privacy of relatives, now that recent research has demonstrated that it is possible to reveal a person’s identity through sequencing.

Dr. Sharp considered it impractical to set up a working group of scientists and relatives for every genome with these issues. “There’s absolutely a need for a new policy,” he said.

Eric S. Lander, the founding director of the Broad Institute, a science research center at Harvard and M.I.T., said resolving these issues was crucial to taking advantage of the knowledge hidden in our genomes.

“If we are going to solve cancer, it’s going to take a movement of tens of thousands, or hundreds of thousands, of patients willing to contribute information from their cancer genomes towards a common good,” Dr. Lander said. “We are going to need to have ways to have patients feel comfortable doing that. We can’t do it without a foundation of respect and trust.”


Schau das Video: Nobelpreisträger warnt vor dem mRNA-basierten Impfstoff gegen Covid (Kann 2022).