Information

12.10: Warum es wichtig ist - DNA-Transkription und -Übersetzung - Biologie

12.10: Warum es wichtig ist - DNA-Transkription und -Übersetzung - Biologie


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Warum die Umwandlung von DNA in RNA in Proteine ​​beschreiben?

Inzwischen kennen Sie Gene und DNA-Sequenzen und wissen, wie Veränderungen in der DNA große Auswirkungen haben können. wie? Wie bewirkt die DNA, dass etwas passiert?

Unser Körper enthält Billionen von Zellen, die auf sehr präzise Weise aufgebaut werden müssen. Ähnlich wie wenn eine Baufirma Blaupausen erstellt, bevor sie tatsächlich mit einem Projekt beginnen, braucht Ihr Körper einen Plan, um dies zu erreichen.

DNA fungiert als Blaupause. Mit diesem Plan in jeder Zelle ist Ihr Körper in der Lage, DNA in Aktionsmoleküle, die Proteine ​​​​sind, über einen Vermittler, RNA, umzuwandeln. Diese Idee ist so zentral für die Biologie, dass sie oft als das zentrale Dogma der Biologie bezeichnet wird: DNA wird in RNA transkribiert, die in Protein übersetzt wird. Dieser mehrstufige Prozess ist einer der Gründe für die Vielfalt, die wir in der Welt um uns herum sehen.

Lernerfolge

  • Skizzieren Sie den Prozess der eukaryotischen Transkription
  • Fassen Sie den Übersetzungsprozess zusammen
  • Skizzieren Sie den Prozess der prokaryotischen Transkription und Translation
  • Identifiziere das zentrale Dogma des Lebens

Darwins Gott

Jeder Biologiestudent erfährt von zwei massiven Maschinen, die mit dem DNA-Molekül arbeiten. Es gibt die Transkriptionsmaschine, die eine einzelsträngige Kopie eines Gens erstellt, und es gibt die Replikationsmaschine, die eine doppelsträngige Kopie der DNA-Doppelhelix erstellt. Ersteres ist der erste Schritt im Proteinsyntheseprozess, während letzteres Teil des Zellteilungsprozesses ist. Aber was passiert, wenn sich diese verschiedenen Maschinen treffen, während sie auf demselben DNA-Abschnitt arbeiten? Was sind die Regeln der DNA-Straße?

Neue Forschungen legen nahe, dass der hochkomplexe Replikationsvorgang nicht durch Frontalkollisionen mit der Transkriptionsmaschine destabilisiert wird, sondern lediglich pausiert, während er den Eindringling verdrängt. Dazu verwendet es ein Protein, das ansonsten bei der Transkriptionsreparatur hilft. Wie das Papier erklärt:

Es ist die Forschung, die sowohl wichtig als auch interessant ist. Und wie bei jedem neuen Befund kann er für die Frage der Evolution relevant sein. Vielleicht hat uns zum Beispiel die Evolutionstheorie dazu gebracht, diesen Befund vorherzusagen. Oder, fast genauso gut, vielleicht ist der Befund vernünftigerweise aus der Theorie abgeleitet.

In diesem Fall würde eine solche Retrodiktion ungefähr so ​​aussehen: Wenn die Evolution wahr ist, würden wir erwarten, dass die Replikationsmaschine die Transkriptionsmaschine verdrängt, weil zufällige Mutationen zu einem solchen Design führen könnten, aber nicht zu anderen denkbaren Designs.

Was aber, wenn andererseits die Evolution ein solches Design nicht begünstigte? Was wäre, wenn es keine solche Vorhersage oder Retrodiktion gäbe? Dann wäre es schwieriger, das Design als Unterstützung für die Evolution heranzuziehen. Was ist, wenn die Evolution keine plausible Erklärung für das Design hat?

In diesem Fall ist es wahrscheinlich nicht wahrscheinlich, dass die Replikations- und Transkriptionsmaschinen sich in der überfüllten Umgebung erfolgreich durchsetzen, Frontalkollisionen auflösen und etablierte “-Straßenregeln” haben, angesichts der zufälligen biologischen Variation der Evolution unter der windenden Hand der natürlichen Auslese. Hier hätten wir einen Befund, der nicht zur evolutionären Erklärung passt, und die Beweise verschieben sich von der Plus-Spalte in die Minus-Spalte.

Interessant ist, wie Evolutionisten routinemäßig auf solche Erkenntnisse reagieren. Wenn sie mit solchen Entwürfen konfrontiert werden, errichten Evolutionisten fast ausnahmslos eine Reihe von trügerischen Straßensperren. Sie können sehen, dass dieselben Hindernisse wiederholt verwendet werden, und sie sprechen Bände über evolutionäres Denken.

Ein solches trügerisches Hindernis besteht darin, dass das Platzieren solcher Beweise in der Minus-Spalte einem Argument aus Unglauben gleichkommt. “Sie können sich nicht vorstellen, wie die Evolution ein solches Design geschaffen haben könnte,”, sagen Evolutionisten, “und Sie denken, es ist ein Beweis gegen die Evolution.” Es ist ein seltsames Argument, das die Last auf den einen legt Bewertung einer Theorie auch, um die Theorie zu verteidigen.

Tatsächlich kann sich jeder „vorstellen“, wie die Evolution das Design konstruiert haben könnte, aber was es braucht, ist eine plausible Erklärung. Evolutionisten wollen, dass wir einfach eine leere Erzählung akzeptieren. Das Problem ist nicht die Ungläubigkeit des Bewerters, sondern Leichtgläubigkeit seitens des Evolutionisten. “Keine Sorge, es hat sich entwickelt” ist keine plausible Erklärung.

Diese trügerische Klage der Evolutionisten ist auch ein weiteres Zeichen des Protektionismus, der das evolutionäre Denken durchzieht. Wenn Erkenntnisse, die eine Theorie nicht erklärt, in der Minus-Spalte nicht erlaubt sind, was könnte dann der Theorie schaden? Es ist die ultimative Form der Unfalsifizierbarkeit. Beweise, die die Theorie erklärt, machen sie zu einer Tatsache und DNA-Regeln der Straße zählen nicht, weil dies ein Argument aus Ungläubigkeit wäre.

81 Kommentare:

Dieses Argument der Ungläubigkeitskarte ist an den Rändern stark ausgefranst. Aber das Schwierige daran ist, dass alle ihre Karten an den Rändern stark ausgefranst sind. Eine raffinierte Art, dich im Raten zu lassen, huh.

Was, gelinde gesagt, auch interessant ist, ist ihr Beharren darauf, dass ihre "Berge" der Beweise für die Evolution kein Argument aus Ungläubigkeit darstellen.

Richter: "Nun, Sir, welche harten Beweise haben Sie, um zu beweisen, dass die Evolution wahr ist?"

Coyne: "Nun, zuallererst Euer Ehren, die Wissenschaft versucht nicht alles zu "zu beweisen", sondern die beste Erklärung basierend auf den Beweisen zu finden. Die Wissenschaft ist immer offen für Korrekturen. Jedenfalls haben wir viele Informationen, die uns einen vernünftigen Rückschluss auf das Geschehene erlauben."

Richter: "Übersetzung, Sie haben keine harten Beweise, aber viele, viele Indizien".

Coyne: "Nun, so würde ich es nicht sagen, aber im Grunde schon."

Richter: "Sehr gut. [wendet sich an den Meyer]. Und Sie, Sir, welche direkten Beweise haben Sie, um Ihre Position zu beweisen, dass das Leben entworfen wurde und nicht mit natürlichen Begriffen nur durch den Inhalt von Mr. Coyne erklärt werden kann?"

Meyer: "Nun, zunächst einmal Euer Ehren, die Wissenschaft versucht nicht, alles zu "zu beweisen", sondern die beste Erklärung basierend auf den Beweisen zu finden. Die Wissenschaft ist immer offen für Korrekturen. Wie auch immer, ich habe auch viele Beweise, die es uns erlauben, eine vernünftige Schlussfolgerung (ich glaube die beste Schlussfolgerung) zu ziehen, dass das Leben entworfen wurde.

Richter: "Übersetzung, Sie haben auch keine harten Beweise, aber viele, viele Indizien, oder?".

Meyer: „Ja, ähm, Euer Ehren. Ich möchte meine Schlußfolgerung auf die beste Erklärung der Schlußfolgerung von Mr. Coyne auf die beste Erklärung gegenüberstellen, da keiner von uns direkte Beweise hat.

Richter: "Alight, hier sind die Grundregeln. Punkte für logische, gut begründete Argumente und Nachteile für alle nur-so-Geschichten. Am Ende des Tages zähle ich sie auf und derjenige mit den meisten Punkten gewinnt den Fall.

Steve: "Richter: "Alight, hier sind die Grundregeln. Punkte für logische, gut begründete Argumente und Nachteile für alle nur-so-Geschichten. Am Ende des Tages zähle ich sie auf und derjenige mit den meisten Punkten gewinnt den Fall."

Ja, genau das ist passiert in Kitzmiller gegen Dover. Die IDCer hatten jede Chance, ihre Sache vor der Welt zu vertreten, und sie taten es komplette Gesichtspflanze. Dembski knurrte und machte eine lahme Entschuldigung dafür, dass er nicht aussagte. Behe sagte aus und machte sich wegen seines Mangels an Wissen über die aktuelle wissenschaftliche Forschung wie ein totaler Narr. Der Rest der IDCer gab ihr Bestes als Clowns, die sich aus ihrem winzigen Zirkusauto stapelten. Wäre es ein Fußballspiel gewesen, wäre das Endergebnis etwa 137-0 gewesen, IDC verloren. "Atemberaubende Dummheit" in der Tat.

Seitdem ist IDC so gut wie vom Radar verschwunden. Es gibt ein paar isolierte Websites wie Ungewöhnlich dicht und dieses hier, bevölkert von einer verbleibenden Handvoll von wissenschaftlich unwissenden wahren Gläubigen. Ein bisschen wie die wenigen armen japanischen Soldaten auf abgelegenen einsamen Inseln, die nach 1945 jahrelang weitergekämpft haben, ohne zu wissen, dass der 2. Weltkrieg zu Ende war.

Na ja, es ist immer noch eine gute Unterhaltung, ihnen dabei zuzusehen, wie sie neue und andere Wege finden, sich selbst in Verlegenheit zu bringen.

„Tatsächlich kann sich jeder ‚vorstellen‘, wie die Evolution das Design konstruiert haben könnte, aber was es braucht, ist eine plausible Erklärung.“

Nun, hier ist eine Arbeitshypothese:

Kopf-an-Kopf-Kollisionen sind katastrophal, wenn keine Maschinen sie lösen. Aus anderen Studien geht jedoch klar hervor, dass Kopf-an-Schwanz-Kollisionen kein Abwürgen der Replikationsgabel verursachen.

Ich gehe also davon aus, dass primitive Genome mit Ursprüngen und Promotoren in der gleichen Orientierung organisiert waren. Interessanterweise weisen moderne Bakteriengenome 80-98% ihrer rRNA-Gene auf und deutlich mehr als 50% ihrer Gene sind mit dem Replikationsursprung koorientiert. Einige Viren (und ich denke Mitochondrien) haben die gleiche Ausrichtung.

Später entwickelt sich MFD1 – es hat Ähnlichkeit mit Helikasen und hilft der RNA-Polymerase, sich in einer Reihe von gebrochenen DNA-Kontexten abzulösen. Es funktioniert auch bei Kopf-an-Kopf-Kollisionen.

Dies ermöglicht ein dynamischeres Genom, Rekombination ohne Rücksicht auf die Orientierung. vorteilhaft. Bakterien beginnen, Gene auf einen der beiden Stränge zu legen, wobei die Regulation komplexer ist.

Jetzt könnte ich testweise Testgenome mit und ohne Co-Orientierung synthetisieren und in jedem das Wesentliche eines solchen Proteins abfragen.

Ich könnte auch eine detaillierte Phylogenie über Mfd machen - wie alt ist es, womit es am meisten verwandt ist. Fehlt es Organismen und wie gehen sie mit Kollisionen um?

Ich könnte sogar einige rRNA-Gene in E. coli invertieren, auf schädliche Auswirkungen testen und sehen, ob die Mfd-Überexpression zum Ausgleich funktioniert.

Ich bin sicher, es gibt noch viel mehr, um eine solche Geschichte aufzuräumen, aber es ist nicht mein Feld und es ist spät. Trotzdem hoffe ich, dass dies zeigt, wie eine plausible Hypothese aufgestellt und getestet werden kann. Du hättest an etwas (wahrscheinlich besseres) denken können, hast es aber nicht getan. Das ist es, was Design vorschlägt: Hören Sie auf, darüber nachzudenken, wie – hören Sie auf, nachzufragen. Warum fragen wie, wenn das schon beantwortet ist?

"Evolutionisten wollen, dass wir einfach eine leere Erzählung akzeptieren"

Nein, wir wollen detaillierte empirische Forschung betreiben, und Sie müssen die Evolutionsbiologie nicht als ein Feld ohne Prozess und Fortschritt darstellen, das seine Hände in die Luft wirft, wenn es "Komplexität" sieht

„Seitdem ist IDC so gut wie vom Radar verschwunden. "

Sie sollten ein Komiker sein.
Ihre Logik und Ihre Pseudowissenschaft sind in der Tat sehr humorvoll.

Erstaunlich, wie Darwinisten nicht sehen können, dass sie diejenigen sind, die nicht herausfinden können, was Wahrscheinlichkeiten bedeuten und warum sie in der Biologie wichtig sind.

Ihr hirntoten darwinistischen Fundamentalisten solltet eure schwachen und ignoranten Argumente "The Worrell Family Science Emporium" nennen.

Rob sagte: ". Ich bin sicher, es gibt noch viel mehr, um eine solche Geschichte aufzuräumen"

Hier gehen wir wieder, eine weitere Geschichte, die als plausibler Mechanismus gilt.

Man lernt nie, dass Wissenschaft kein Geschichtenerzählen ist und dass Vermutungen und Spekulationen keine Tatsachen sind.

Sie lieben es, diese vermeintlichen "Wahrscheinlichkeiten" nachzuplappern. Möchten Sie uns ein Beispiel geben und etwas Mathematik auf dieses System anwenden?

Thorton, wie lautet Ihre Antwort auf den Artikel? Ich denke, Sie wissen, dass der Fall Dover im Grunde genommen bedeutungslos war, da der Richter in seinem Urteil große Teile des ACLU-Skripts wörtlich kopiert hat. ID hat sicherlich die beste Erklärung für die Beweise. Evolutionisten sind gezwungen, sich auf unzählige Wunder zu verlassen, um ihre Theorie zu retten. Wir alle wissen, dass aussagekräftige oder spezifizierte Informationen nicht einfach aus einem Zauberhut entstehen. Komplexe Baupläne entstehen nicht im Handumdrehen. (Cambrian Explosion) Sich auf das Multiversum zu verlassen, nur damit die Geschichte keine stellaren evolutionären Ideen retten kann. Exquisit gestaltete Maschinen entstehen nicht zufällig. Protektionismus wäre nicht nötig, wenn es wirklich gute Beweise gäbe, um die Opposition zum Schweigen zu bringen. Wenn Ihre Weltanschauung Sie nicht für die Wahrheit blind gemacht hätte, könnten Sie große Einsichten haben. Gewöhnen Sie sich besser an ID-Ideen. Ab jetzt wird es nur noch schlimmer. Wenn es eine gute Unterhaltung für Sie ist, dann haben Sie Glück, aber eines Tages habe ich das Gefühl, dass es aufhören wird, so lustig zu sein, und eine ernste Angelegenheit wird. Viele Leute fragen sich bereits, ob es nicht die Evolutionisten sind, die sich wegen ihres unerschütterlichen, scheinbar unerschütterlichen Glaubens an Pater Charlie blamieren.

"Spezifizierte Informationen entstehen nicht einfach aus einem Zauberhut"

Wie viele spezifizierte Informationen enthält Mfd? Wie viele Einheiten spezifizierter Information sind es von seinem nächsten Verwandten?

LOL! Ich habe gerade Liebe die IDC-Mundatmer, die aus dem Gebälk kommen, um die gleichen alten leeren Prahlereien zu spucken. "ID übernimmt die Wissenschaft!! Die Evolution liegt auf dem Sterbebett!! Oh Gott, es ist so komplex, es MUSS nur entworfen werden! "

Wenn ihr aufhört, euch aufs Zahnfleisch zu schlagen und durch eure Forschung tatsächlich positive Beweise hervorbringt, wird die Mainstream-Wissenschaft vielleicht aufhören zu lachen.

Hier ist die Gesamtsumme der ID 'Theory' bis heute:

"Ein unbekannter Designer an einem unbekannten Ort und zu einer unbekannten Zeit, der unbekannte Materialien mit einem unbekannten Verfahren verwendet und aus unbekannten Gründen etwas hergestellt hat".

Fühlen Sie sich frei, jederzeit weitere Details anzugeben.

Hier ist die große Sache, die Sie IDCers noch nicht herausgefunden haben:

Nur weil die Wissenschaft nicht alle Details von allem entdeckt hat, was in den letzten 3,3 Milliarden Jahren in evolutionären Prozessen passiert ist bedeutet nicht, dass die ID standardmäßig gewinnt.

Die Wissenschaft ist völlig in Ordnung mit der Aussage "Ich weiß es nicht, also werde ich es mehr erforschen" für Bereiche wie die Abiogenese oder den Ursprung der DNA-Replikation. IDCer denken, dass "Ich weiß es noch nicht" gleichbedeutend mit "MEIN Intelligent Designer muss es gewesen sein!" Es ist dieselbe dumme falsche Dichotomie, von der ID seit Jahren lebt. IDer tun gerne so, als gäbe es nur zwei Kategorien

1) Natürliche Prozesse haben es geschafft
2) ID hat es getan.

In Wirklichkeit gibt es drei Kategorien

1) Natürliche Prozesse, die wir derzeit verstehen, haben es getan.
2) Natürliche Prozesse, die wir derzeit nicht Verstehe, habe es getan
3) ID hat es geschafft.

Nur weil einige Daten nicht in Kategorie 1 sind nicht bedeutet, dass es automatisch in 3) fällt. Deshalb erfordert die Wissenschaft positive Beweise für eine Position kann nicht nur "ToE dies nicht erklären, damit ID gewinnt. Und ein positiver Ausweis ist etwas, das Sie haben NULL von.

“Du hättest dir etwas einfallen lassen (wahrscheinlich Besseres)”

Anstatt “primitive Genome mit Ursprüngen und Promotoren in der gleichen Orientierung organisiert zu haben, würde ich sie von Anfang an zufällig orientiert haben, um jegliche Andeutung von Teleologie oder Design zu vermeiden und dem evolutionären Thema der Zufälligkeit beizubehalten. Als nächstes hätte ich bei direkten Begegnungen die Konsequenz, dass die Transkription fehlschlägt. Dies war, so könnte man argumentieren, nur ein leichter Zufall, wenn wir die (wahrscheinlich wahrscheinlichere) Konsequenz vermeiden, dass beide scheitern, und es als 50/50-Fall präsentieren. Bei anhaltender Replikation vermeiden Sie (i) das fatale Problem, dass die Reproduktion nicht funktioniert und (ii) haben Sie einen schönen Übergang zum bestehenden Design.

Und wenn die Transkription fehlschlägt, haben Sie einfach mehr nutzlose DNA. Wie sind funktionierende Gensequenzen überhaupt entstanden? Wer weiß, aber sicherlich gab es viele nutzlose Segmente. Was also, wenn Sie als Folge von direkten Begegnungen noch mehr nutzlose Segmente haben. Man könnte auch argumentieren, dass diese direkten Begegnungen in solch primitiven Formen nicht so häufig waren, weil … die Transkription nicht so häufig vorkam oder die Replikation nicht so häufig oder beides oder … was auch immer.

Später entwickelte sich MFD1, weil es der RNA-Polymerase half, ihre Aufgabe zu erfüllen. Aber seine Funktion war etwas flexibel oder schlampig, so dass es manchmal tatsächlich mehrere Aufgaben ausführen konnte. Diese wurden verfeinert, und so gab es eine Divergenz der Funktionalität, da mehrere, gut entwickelte Funktionen entstanden. Im Fall der Frontal-Begegnungsfunktionalität half MFD1 dabei, die RNA-Polymerase geordneter zu verdrängen, wodurch die Wahrscheinlichkeit eines erfolgreichen Neustarts erhöht wurde. Dies öffnete etwa die Hälfte des Genoms für eine erfolgreiche Transkription, die übrigens immer wichtiger wurde, da Transkriptions- und Replikationsfrequenzen wahrscheinlich deutlich anstiegen.

Natürlich war ein Großteil des neu transkribierten Genoms Schrott, aber es könnte einige nützliche Sequenzen gegeben haben. Und das hätte auf jeden Fall den Selektionsdruck auf diese Hälfte erhöht.

Da haben Sie es, Evolution passiert.

Leider ist dieses Szenario oder Ihres, wenn Sie so wollen, keine plausible Erklärung. Es fehlen wesentliche Details, die kein Zeichen von Einfachheit sind (weshalb es fehlt). Noch bedauerlicher ist, dass Evolutionisten dieses Problem anscheinend nicht kennen. Abgesehen von gelegentlichen Anschuldigungen von „So-Geschichten“ gegen Sub-Hypothesen, die sie nicht befürworten, konstruieren Evolutionisten routinemäßig ihre eigenen Einfach-So-Geschichten. Aber es ist leicht, solche Probleme zu vergessen, wenn die übergreifende Idee eine Tatsache ist. Das Problem der Erklärung von Designs, wie den DNA-Regeln der Straße, besteht nicht darin, die Plausibilität der Evolution zu rechtfertigen, sondern eher einen Prozess aufzuklären, der auf die eine oder andere Weise stattgefunden haben muss. Es ist die Frage, *wie* es funktioniert hat, nicht *ob* es funktioniert hat, und die Messlatte wird noch so tief gesenkt. Für Evolutionisten ist das, was als “plausibel” gilt, erstaunlich.

"Ein solches trügerisches Hindernis besteht darin, dass das Platzieren solcher Beweise in der Minus-Spalte einem Argument aus Unglauben gleichkommt. “Sie können sich nicht vorstellen, wie die Evolution ein solches Design geschaffen haben könnte,”, sagen Evolutionisten, “, “Sie denken, dass es ein Beweis gegen die Evolution ist.” Es ist ein seltsames Argument, das die Last auf den einen legt Bewertung einer Theorie auch, um die Theorie zu verteidigen."

Es ist ein vorübergehend seltsames (ähem!) Argument, nicht wahr? Und gleichzeitig entlarvt es die neugierige leichtgläubigkeit Darwinisten, nicht wahr?

„Aber was passiert, wenn sich diese verschiedenen Maschinen treffen, während sie auf demselben DNA-Abschnitt arbeiten? Was sind die Regeln der DNA-Straße?

Neue Forschungen legen nahe, dass der hochkomplexe Replikationsvorgang nicht durch Frontalkollisionen mit der Transkriptionsmaschine destabilisiert wird, sondern lediglich pausiert, während er den Eindringling verdrängt."

Ich weiß nicht, ob mein Verständnis hier richtig ist, da ich kein Biologe bin.

Ich bin jedoch Computerentwickler, und was hier beschrieben wird, klingt ziemlich nach Thread-Management.

Angenommen, Sie haben zwei Benutzer, die auf dieselbe Variable zugreifen. Die beiden Benutzer führen Code in unterschiedlichen Threads aus, aber die beiden Threads verwenden dieselbe Variable. Wie verhindern Sie alle Arten von seltsamen Anomalien, wenn verschiedene Threads dieselbe Variable ändern möchten? Sie fügen dem Codeabschnitt eine Sperre hinzu: Dies bedeutet, dass der erste Thread, wenn er in die Sperre eintritt, die exklusiven Rechte hat, ihn auszuführen. Der zweite Thread muss warten, bis der erste Thread die Sperre verlässt, bevor der zweite Thread fortfahren kann.

Es ist absolut bemerkenswert, wie ähnlich die DNA der Computerprogrammierung ist. Nicht nur in den vereinfachten Bereichen wie Syntax, sondern auch in den fortgeschritteneren Bereichen.

Es würde mich nicht wundern, wenn wir die objektorientierte Programmierung in der DNA entdecken würden, bei der die Logik in Funktionen gekapselt ist, die von anderen Bereichen der DNA aufgerufen werden, anstatt dieselbe Logik dupliziert zu haben, wo immer sie benötigt wird.

Oh, und ich würde jeden Darwinisten wagen, mir einen natürlichen Prozess zu zeigen, der Computercode erzeugen kann. Ich denke, der Darwinismus ist intellektuell bankrott, und seine gesamte Grundlage sind unbegründete Behauptungen.

Hanno,
Sie erhalten möglicherweise eine "Hurrikan"-Antwort, wie ich es vor ein paar Tagen getan habe, wenn eine ähnliche Frage gestellt wurde.

Hanno: "Oh, und ich würde jeden Darwinisten wagen, mir einen natürlichen Prozess zu zeigen, der Computercode erzeugen kann. Ich denke, der Darwinismus ist intellektuell bankrott, und seine gesamte Grundlage sind unbegründete Behauptungen. "

LOL! Ein weiterer Informatiker, der den Unterschied zwischen Analogien und Realität nicht versteht. Zu lustig.

Wenn Wissenschaftler von DNA- "Code" sprechen, verwenden sie eine breite Definition von Code als "jeder Vorgang, der eine bestimmte Eingabe einer bestimmten Ausgabe zuordnet". Computercode fällt unter a unterschiedlich Definition von 'Code': 'ein System, bei dem abstrakte Symbole verwendet werden, um eine Nachricht über ein Medium zu übertragen.' IDCer lieben es, über die beiden Definitionen zu streiten.

Computercode wird als Analogie für die DNA-Funktion, aber wie alle Analogien bricht es bei genauer Betrachtung zusammen. In der grundlegenden Mechanik funktionieren die beiden völlig unterschiedlich. Computercode verwendet abstrakte Symbole um Informationen an die Maschine weiterzugeben, die die Arbeit verrichtet. Die Symbole sind unabhängig des Mediums und muss zu einem anderen Zeitpunkt interpretiert werden, um Operationen auszuführen. DNA hingegen ist nicht abstrakt überhaupt. Es ist ein physikalisches Molekül, das Teil einer sich selbst erhaltenden chemischen Reaktion ist (zugegeben eine erstaunlich komplizierte). Eine Reaktion, die lediglich den Gesetzen der Chemie und Physik folgt. Es ist komplett abhängig auf seinen physikalischen Aufbau. Ein DNA-Modell aus Stöcken und Ton und wird nicht Code für ein Protein, egal wie sehr Sie beten.

Ich würde jeden IDCer wagen zu zeigen, dass DNA auf abstrakten Symbolen beruht, die interpretiert werden müssen, unabhängig vom Übertragungsmedium, wie es Computercode tut.

Versuchen Sie es anders herum:
Computerprozessor bewegt nur Elektronen herum, weil einige andere Elektronen der Elektronenspeichermatrix des Prozessors präsentiert wurden, so dass sie gegeneinander gezwungen werden
Elektronenpakete bewegen sich einfach nach den Naturgesetzen

Diese Antwort des Evolutionisten spricht Bände.

====
LOL! ein anderer Informatiker, der den Unterschied zwischen Analogien und Realität nicht versteht. Zu lustig.

Wenn Wissenschaftler von DNA- "Code" sprechen, verwenden sie eine breite Definition von Code als "jeder Prozess, der eine bestimmte Eingabe einer bestimmten Ausgabe zuordnet". Computercode fällt unter eine andere Definition von "Code": "ein System, bei dem abstrakte Symbole verwendet werden, um eine Nachricht über ein Medium zu übertragen".

Computercode wird als Analogie für die DNA-Funktion verwendet, aber wie alle Analogien bricht er bei genauer Betrachtung zusammen. In der grundlegenden Mechanik funktionieren die beiden völlig unterschiedlich. Computercode verwendet abstrakte Symbole, um Informationen an die Maschine weiterzugeben, die die Arbeit verrichtet. Die Symbole sind unabhängig vom Medium und müssen zu einem anderen Zeitpunkt interpretiert werden, um Operationen auszuführen. DNA hingegen ist überhaupt nicht abstrakt. Es ist ein physikalisches Molekül, das Teil einer sich selbst erhaltenden chemischen Reaktion ist (zugegeben eine erstaunlich komplizierte). Eine Reaktion, die lediglich den Gesetzen der Chemie und Physik folgt. Es ist vollständig abhängig von seiner physischen Struktur. Ein DNA-Modell, das aus Stöcken und Ton hergestellt wurde und kein Protein kodiert, egal wie sehr Sie beten.
====

Darum geht es bei der Evolution. Gerade genug Wissen zu haben, um gefährlich zu sein, muss ihre Theorie vorschreiben, weil ihre Religion es verlangt, ihre Religion in ihre Wissenschaft einfließen lassen, andere beschuldigen, genau das zu tun, wenn sie so etwas nie getan haben, massive Probleme ignorieren, die Frage lächerlich machen, und wenn sie eine Antwort geben, wird das Problem nicht gelöst. In diesem Fall wirft es einfach noch tiefere Probleme auf.

Tatsächlich besteht ein grundlegender Unterschied zwischen Biologie und Technik darin, dass in der Biologie die Rückkopplungsschleifen, Signale, Informationen usw. ein wesentlicher Bestandteil der Pflanze sind. Dies macht es zutiefst komplexer, etwas, was Evolutionisten als selbstverständlich zu betrachten scheinen, ohne eine Ahnung davon zu haben.

Religiöse Gewissheit aus Unwissenheit, gepaart mit Heuchelei und Dämonisierung. Es klingt wie eine unglaubliche Übertreibung, aber man muss nur die Literatur (oder die Kommentare) lesen.

"Anstatt “primitive Genome mit Ursprüngen und Promotoren in der gleichen Ausrichtung organisiert zu haben, würde ich sie von Anfang an zufällig orientiert haben, um jegliche Andeutung von Teleologie oder Design zu vermeiden und dem evolutionären Thema der Zufälligkeit beizubehalten."

Fasst zusammen, warum ID (als Wissenschaft) zum Scheitern verurteilt ist – es begann mit einer vorgefälschten Prämisse:

Alles, was nicht zufällig ist, ist teleologisch!

Die genetische Variation, die in die Evolution eingeht, ist das Produkt zufälliger Prozesse, aber die Selektion produziert alles andere als zufällige Ergebnisse. Nehmen Sie mein hypothetisches Beispiel: Wenn alte Replikatoren Gene in die falsche Richtung ligiert haben, sind sie dem Untergang geweiht. So kann ein einfacher selektiver Prozess zu einem Ergebnis führen, bei dem alle Genpromotoren in die gleiche Richtung geordnet sind. Wir sehen heute die Überreste dieses Systems. Diese Organisation SCHAUT nach Cornelius, und er schreit sofort nach Designer, ist aber nur das Produkt der Notwendigkeit.

Um zu weniger hypothetischen Beispielen zu kommen, wissen wir in der gerichteten Evolution, genetischen Algorithmen und direkten Beobachtungen, dass Informationen in der Evolution zunehmen können.

Bis Sie diesen Punkt stichhaltig widerlegen, haben Sie interessante, aber irrelevante Beobachtungen.

Und zu argumentieren, dass die Evolutionsbiologie nicht jedes Detail jedes letzten Systems gelöst hat, spricht nicht für ID als Ersatz. Es ist ein Beweis für seinen Erfolg, dass Sie immer wieder zu immer kleineren Systemen und neueren Entdeckungen wechseln müssen, um herauszufinden, was die Wissenschaft noch nicht weiß.

Ich biete einen Weg, um die Entwicklung dieses Systems oben zu studieren. Welchen ID-basierten Weg würden Sie zum Verständnis einschlagen? Ach, richtig, gibt es nicht, denn die Antwort setzt man gleich zu Beginn voraus. Selbst Ihr albernes Gegenbeispiel setzt Evolution voraus.

„Religiöse Gewissheit basierend auf Unwissenheit, gepaart mit Heuchelei und Dämonisierung. Es klingt wie eine unglaubliche Übertreibung, aber man muss nur die Literatur (oder die Kommentare) lesen."

Oh, und nur zum Spaß, ein gewisser Funktionsgewinn durch Auswahl, die auf zufällige Eingaben wirkt. Ja, die empirische Fälschung der ID:

Übrigens, das sind natürliche Gain-of-Function-Mutationen:

Ok, das sind also alle natürlich, aber hier ist ein cooles Experiment vom Typ der gerichteten Evolution - zufälliges Domänenmischen ergibt neue interessante Phänotypen nach der Auswahl:

Schnelle Diversifizierung von Zellsignal-Phänotypen durch modulare Domänenrekombination.
Peisajovich SG, Garbarino-Wissenschaft. 2010 Apr. 16328(5976):368-72.JE, Wei P, Lim WA.

Wenn Sie interessiert sind, googeln Sie 'Directed Evolution' für eine Tonne mehr in diese Richtung - wo Menschen zufällige Variation + Auswahl gemacht haben -> neue Funktion.

"Informationen" aus dem Zufall, wenn Sie so wollen.

". es bedarf einer plausiblen Erklärung.“ Nein, es bedarf der wissenschaftlichen Methode, die auf die Evolutionstheorie angewendet wird. Eine wissenschaftliche Methode besteht aus dem Sammeln von Daten durch Beobachtung und Experimentieren sowie der Formulierung und Überprüfung von Hypothesen. "Plausible Erklärung" ist keine Wissenschaft, es sei denn, sie wird durch eine wissenschaftliche Methode gestützt. Indem Sie eine "plausible Erklärung" akzeptieren, legen Sie die Messlatte so niedrig, dass die Evolution glaubwürdig wird.

Cornelius: „Darum geht es bei der Evolution. Gerade genug Wissen zu haben, um gefährlich zu sein, muss ihre Theorie vorschreiben, weil ihre Religion es verlangt, ihre Religion in ihre Wissenschaft einfließen lassen, andere beschuldigen, genau das zu tun, wenn sie so etwas nie getan haben, massive Probleme ignorieren, die Frage lächerlich machen, und wenn sie eine Antwort geben, wird das Problem nicht gelöst. In diesem Fall wirft es einfach noch tiefere Probleme auf.

Tatsächlich besteht ein grundlegender Unterschied zwischen Biologie und Technik darin, dass in der Biologie die Rückkopplungsschleifen, Signale, Informationen usw. ein wesentlicher Bestandteil der Pflanze sind. Dies macht es zutiefst komplexer, etwas, was Evolutionisten als selbstverständlich zu betrachten scheinen, ohne eine Ahnung davon zu haben.

Religiöse Gewissheit aus Unwissenheit, gepaart mit Heuchelei und Dämonisierung. Es klingt wie eine unglaubliche Übertreibung, aber man muss nur die Literatur (oder die Kommentare) lesen."

LOL! CH, mir ist aufgefallen, dass du die gleichen müden alten Kreationisten-Enten trabt, die wir alle seit Jahren gehört haben, aber habe keinen einzigen Punkt angesprochen Ich habe in keinem meiner Beiträge angesprochen.

Nur ein weiteres episches FAIL für die wissenschaftsfreien IDCers.

Ein solches trügerisches Hindernis besteht darin, dass das Platzieren solcher Beweise in der Minus-Spalte einem Argument aus Unglauben gleichkommt. “Sie können sich nicht vorstellen, wie die Evolution ein solches Design geschaffen haben könnte,”, sagen Evolutionisten, “ und Sie denken, es ist ein Beweis gegen die Evolution.”

Und doch fährt derselbe Evolutionist, der dieses Argument verwendet, fort, uns zu sagen, dass die Evolution wahr sein muss, weil Gott die Dinge nicht so geschaffen hätte, wie sie sind. Sie können also das Argument der Ungläubigkeit gegen die Existenz eines Schöpfers verwenden, aber wir können nicht dasselbe Argument gegen die Lebensfähigkeit der Evolution verwenden?

Ich glaube, ich rieche hier nach Doppelmoral.

Ich habe einige Antworten auf meine Kommentare gelesen. Es scheint, dass Evolution für Darwinisten die wissenschaftliche Methode ist. Wenn in anderen Wissenschaften Beobachtungen gemacht werden, die einem Aspekt der darwinistischen Theorie widersprechen, tun die Darwinisten dies schnell als „Oh, aber weil es keine Biologie ist, zählt es nicht.“ Die Evolution sitzt auf ihrer eigenen kleinen Insel, die von anderen Wissenschaften nicht berührt werden kann.

Außerdem scheinen Darwinisten Schwierigkeiten zu haben, einfache Argumente zu verstehen. Ich muss also verstehen, dass DNA nicht wie Computercode ist, weil sie physikalisch ganz anders sind? Na und? Das weiß ich schon! Niemand argumentiert, dass sie physisch identisch sind. Wenn wir sagen, dass DNA wie Computercode ist, beziehen wir uns auf ihre INFORMATIONALEN Eigenschaften. Und die INFORMATIONSEIGENSCHAFTEN sind identisch, was die Struktur angeht, sowie ein NICHT-PHYSIKALISCHES, ABSTRAKTES ATTRIBUT. Chemie KANN die Information, die man braucht, um einen sich selbst replizierenden Zyklus zu erzeugen, NICHT ERKLÄREN, denn physikalisch gibt es keine geordnete Information, sie ist völlig unregelmäßig. Informationen sind von Bedeutung, weil sie unregelmäßig sind und spezifiziert sind, eine höchst unwahrscheinliche Kombination. Das Problem mit Darwinisten ist, dass sie unwissend sind: Sie studieren nur den Darwinismus und wissen nichts darüber, was andere wissenschaftliche Gebiete dazu zu sagen haben.

Und dann gibt es das Argument, dass ich als Laie nicht genug wissen könnte, um die Komplexität der Darwinschen Theorie zu verstehen. Nun raten Sie mal, Darwins Theorie ist so einfach wie dumm. Und ich WERDE "Wissenschaftler" befragen, die nur so mit Geschichten als gültige wissenschaftliche Theorien herausplatzen, die nicht in der Lage sind, die Identität genau darzustellen, bevor sie "widerlegt" werden, und die sich als "DER HEROISCHE VERTEIDIGER DER WISSENSCHAFT" aufstellen, während sie die betrügerischen Beweise ignorieren, die wird Schulkindern als Beweis für den Darwinismus präsentiert. wie die Embryo-Zeichnungen von Heacle. (Das ist seit über 100 Jahren bekannt.) Lustig auch, wie Darwinisten darauf bestehen, dass "Theorien Vorhersagen machen sollten" und wie sich jede Vorhersage, die der Darwinismus gemacht hat, BEVOR DIE TATSACHE sich als falsch herausgestellt hat: Von der "einfachen Protoplasma-Idee der Zelle" zu Darwins Zeit , zu Eugenik, zu Junk-DNA, zu evolutionärer Phykologie, die sagt, dass Selbstbewusstsein eine Illusion ist. You must have self awareness to have an illusion of anything, so how can selfawareness be an illusion itself? So, being alive is just an illusion, where really just as dead as my laptop. I know of no other scientific fields where scienitists are so often "surprised" by new discoveries as in Darwinism. Maybe that says something about your paradigm!

ID has made a strong case, using empirical evidence, and combining various scientific dissiplines, while Darwinists only reinforce their case by destroying their own reputations with pathetic "refutations". You have a better chance to see a blind man hit a bulls eye, than to see a Darwinist making a case against what ID ACTUALLY states, rather than against their own imagination.

"And yet the same evolutionist who uses this argument then proceeds to tell us that evolution must be true because God wouldn't have created things the way they are. So they can use the argument of incredulity against the existence of a creator but we can't use the same argument against the viability of evolution?

Me thinks I smell a double standard here."

When we say there is no natural process in the known universe that can produce specified irregularity, apart from ID, they say it's an argument from ignorance. But they themselves have no problem with using vestigial structures as evidence for evolution. Yet, just because we don't know why something is constructed a certain way, does not necessarily mean that it is evolutionary junk. Remember junk DNA? Arguments from ignorance are used all the time to defend evolution.

Then there is the claim that Irreducible Complexity is unfalsifiable. I will grant the Darwinists this one, it is a bit fuzzy, and it is easy to circumvent with the creative imagination of Darwinists. But Darwin wrote Evolution can be falsified by showing that structures exists which could not possibly be formed in a slow and gradual process, in other words, that IC exists. If IC is unfalsifiable, then so is Darwinism, because IC is the criteria with which to falsify Darwinism.

"Computer code is used as an analogy for DNA function, but like all analogies it breaks down when examined closely. In the fundamental mechanics the two operate completely differently. Computer code uses abstract symbols to pass information to the machine doing the work. The symbols are independent of the medium and needs to be interpreted at a different time in order to perform operations. DNA on the other hand is not abstract at all. It is a physical molecule that is part of a self- sustaining chemical reaction (granted an amazingly complicated one). A reaction that merely follows the laws of chemistry and physics to proceed. It is completely dependent on its physical structure. A model of DNA created out of sticks and clay and won't code for a protein no matter how hard you pray.

I would dare any IDCer to show that DNA relies on abstract symbols that must be interpreted, independent of the medium of transmission like computer code does."

The Genetic Code IS abstract, and is described by tRNA. tRNA is a molecule that associate a particular amino acid with a particular triplet of RNA codons. This code is completely arbitrary, as there are nothing in the chemical properties of the codon that determine that they should associate with any particular amino acid. In fact, the code does differ in some species.

Also, the DNA specifications get translated into an amino acid string that just happen to fold into a workable protein. There is no physical reason why the sequence of DNA bases should specify anything beyond its own chemical makeup. It is this specification, which have no chemical explanation, that begs the informational question. Yes, chemistry dictate what DNA looks like, and chemistry control the translation of DNA, but it DOES NOT explain why DNA the translated molecule from DNA should have any meaningful function at all. In fact, without this information, you can not even build the molecules that does the translation, as they themselves are incoded into the DNA.

Pointing out the physical properties of DNA does not take away its informational attributes, which is completely abstract.

"I would dare any IDCer to show that DNA relies on abstract symbols that must be interpreted, independent of the medium of transmission like computer code does."

The fact that the genetic code is *not* universal, the fact that there is no chemical necessity that *this* codon triplet translate to *that* amino acid shows that the DNA medium is not the message.

But, of course, one knows better than to ever expect the DarwinDefenders to admit to such a truth.

There is no physical reason why the sequence of DNA bases should specify anything beyond its own chemical makeup. It is this specification, which have no chemical explanation, that begs the informational question.

RNA–Amino Acid Binding: A Stereochemical Era for the Genetic
Code

I am particularly struck by the difficulty of getting [the genetic code] started unless there is some basis in the specificity of interaction between nucleic acids and amino acids or polypeptide to build upon. (Woese 1967)

Nonetheless, it is clear that at some early stage in the evolution of life the direct association of amino acids with polynucleotides, which was later to evolve into the genetic code, must have begun. (Orgel 1968)

Part I: The Observed Mechanism of RNA–Amino Acid
Interaction

Just above, Carl Woese and Leslie Orgel, writing at the dawn of molecular biology and coding, suppose that chemical interactions between nucleotide sequences and amino acids are an indispensable basis for the genetic code. It is the conclusion of the present narrative that such interactions are easily demonstrated, utilize plausible, simple chemistry, and can indeed be shown to echo part of the genetic code.

Pointing out the physical properties of DNA does not take away its informational attributes, which is completely abstract.

Abstraction is a mental activity. Don’t confuse pattern recognition by the human mind for the operation of stereochemical processes :: Don’t confuse the map with the territory.

Hanno: "The Genetic Code IS abstract, and is described by tRNA. tRNA is a molecule that associate a particular amino acid with a particular triplet of RNA codons. This code is completely arbitrary, as there are nothing in the chemical properties of the codon that determine that they should associate with any particular amino acid."

LOL! Of course it's not an abstract code, any more that the chemical reaction for forming sulfuric acid from sulfur trioxide and water

The human description of the reaction uses abstract symbols, but not the reaction itself. HUGE difference.

Here's an experiment you can do Hanno. Trot on down to your local ID lab. Build a replica tRNA molecule from Tinkertoys. See how long it takes that molecule to create a Tinkertoy amino acid. Get back to us with the results.

"LOL! Of course it's not an abstract code, any more that the chemical reaction for forming sulfuric acid from sulfur trioxide and water
.
SO3 + H2O --> H2SO4
.
is abstract.
"

These people are fools it's not that they're ignorant, it's not that they're stupid, it's that they are intellectually dishonest. It's that they intentionally assert falsehoods and intentionally engage in faulty reasoning . all in a hopeless effort to protect Darwinism (and atheism) from rational scrutiny.

"LOL! Of course it's not an abstract code, any more that the chemical reaction for forming sulfuric acid from sulfur trioxide and water

You are either ignorant of how DNA translate into amino acid strings, or you are dishonest.

There is no chemical reason why one DNA base pair should be followed by another particular base pair. In fact, if there were, DNA would've been a crystal, unable to carry any information. Its message would be reduced to something like ATGCATGCATGCATGC.

The sequence of the DNA base pairs are NOT determined by their chemical properties, but by the ABSTRACT genetic code. Seen from a purely physical perspective, the base pairs are irregular and chaotic. It is the abstract meaning of the code that makes it significant. Information is recognized when there's specification, without any physical attachment with the object being specified. Nature does not create specifications, it simply follows laws of physics wherever they lead. Specification is always a product of mind.

No one is arguing the physical mechanism to read and interpret the data. Computers read their data via physical processes as well. Without it, the data would be meaningless. No one is disputing the physical processes involved in reading the data. That is not the issue, the issue is the data itself.

"You are either ignorant of how DNA translate into amino acid strings, or you are dishonest."

A DarwinDefender will do or say just about anything, including emulating a stultifying and irreversible ignorance, in order to keep from seeing that not only is his evolutionism false, but that it can't even be true.

Hanno: "The sequence of the DNA base pairs are NOT determined by their chemical properties, but by the ABSTRACT genetic code."

That's just plain stupid. Maybe you should go look up the definition of 'abstract' and 'abstract symbol' before you stick that other foot in your mouth.

BTW, how's that experiment with the Tinkertoys coming? Have the 'abstract' toy molecules produced any amino acids yet?

Specification is always a product of mind.

There is no chemical reason why one DNA base pair should be followed by another particular base pair.

Did you read the reference I gave you?

RNA–Amino Acid Binding: A Stereochemical Era for the Genetic Code

There's plenty of reason, apparently.

Hanno: "Specification is always a product of mind."

Translation: "Make me admit the self-evident truth that I *will not* admit."

That's OK, he can still prove it. Or you might try.

abstract or an abstraction?

If the former, did a "mind" design it?

"In the 1880s, Rydberg worked on a formula describing the relation between the wavelengths in spectral lines of alkali metals"

Ofcause a mind designed it. The Rydberg formula is not the actual relation between the wavelengths in spectral lines of alkali metals, it describes the relation between the wavelengths in spectral lines of alkali metals.

The formula itself has no physical relationship with the thing it describes, and yet it specifies it.

Also, isn't always Darwinists who complain that you "can't proof a negative?". Specification IS ALWAYS the product of mind, and we know this from everyday experience. If you feel that undirected natural processes are capable of producing specification, then the burden of proof is on you.

Lastly, I admin I have not read your article. I have very limited time, and I'm growing quite weary of Darwinists who constantly waste my time by referring me to articles that simply assumes evolution occurred, and then back it up with just so stories. I don't know what exactly that is suppose to prove. I do not refer you to Signature of the Cell. Though it would be great if you could read it yourself, I know you are probably to biased to bother, so I describe the argument as best I can in a post short enough for you to read.

Rather than bombarding me with links (Which I noticed is a favorite tactic of Darwinists) Why don't you just give me a summarized version of the argument, and if it isn't just another case of "We know evolution has occurred, so maybe this is how it could've happened", I'll read it. At least show me that you've read and understood the argument yourself, by explaining it in your own words, before referring me there. Otherwise, we might just as well stop talking to each other, and just start posting links.

So you expect me to read a 24 page, highly technical article on RNA evolution, and then simply comment on it here?

As impressive as this all seems, I have only one question, one which David Berlinski has asked as well: "Can the results of Powner et al be reproduced without Powner et al?" - or in this case "Can the results of Yarus et al be reproduced without Yarus et al?"

All these abiogenesis experiments achieve is to underline how critical intelligent interference is in order to produce these molecules. Without an intelligent agent that filter out impurities, protect the molecule from degradation, and guide the molecule's development by playing the role of selection (selection for future advantage, I might add, which is basically what design is), all the abiogenesis scenario's fall apart.

Oh no? So what PHYSICAL property DOES dictate the sequence of DNA nucleotides? Enlighten me.

BTW, I don't exactly know what your point is with the tinker toys. No one ever argued that chemistry played no role in biochemistry. That would just be stupid.

Of cause a mind designed it. The Rydberg formula is not the actual relation between the wavelengths in spectral lines of alkali metals, it describes the relation between the wavelengths in spectral lines of alkali metals.

Hanno, thanks for your comment, but you seem to be contradicting yourself. What mind designed the Rydberg formula? God's or Rydberg's? When ID persons use the word "design" referring to biology, it means "create." And then you say the formula does not describe the "actual" relation between the wavelengths, but it yet describes the relation between them. What is the function of the word "actual" in your sentence?

Who did the specifying in this specification? God or Rydberg?

By the same token, who specified the "actual" genetic code, chemical evolution, God, or human beings? Can you see that the code is a description conceived by humans of chemical processes that developed naturally, just as Rydberg's formula is a description of physical properties that matter displays?

So you expect me to read a 24 page, highly technical article on RNA evolution, and then simply comment on it here?

Granted, the paper is technical, but since it refutes your reiterated claim that the genetic code has no chemical basis, you might at least have said something about it.

Surely the excerpt from the introduction that I posted earlier would have explained the issue well enough.

At some point, doesn't a science skeptic need to understand the science?

Regarding your first post, you seem to be making a category mistake.

The formula describing some feature in nature is distinct from nature itself. All formula's are derived from mind. E=mc2 is the formula and is a product of Einstein's mind. The atom bomb is physical effect. The formula IS NOT the natural effect, it DESCRIBES the natural effect. The particles themselves only react to chemical and nuclear forces, while the formula describes how they react. Formula's are forms of information, and like all information, it is the product of mind.

Likewise, there is no chemical necessity that DNA code should specify functioning proteins. You can mix the DNA code in any order you want, and, thanks to the machinery of the cell, is will produce a amino acid string, but that string will not necessarily fold into a stable protein. The SEQUENCE of DNA nucleotides constitute information, as it has no physical relation to the final product.

Secondly, regarding your paper, I will have to admit that you have me at a disadvantage. I did admit to being a layman in science, which means that I have SOME scientific knowledge, but not enough to comment on a highly technical paper. However, I do not think this disqualifies my position out of hand.

Firstly, there ARE ID scientists that DO understand these technical papers, and who are NOT convinced. (Scientists with all kinds of different religious backgrounds) According to them, all these papers assume evolution occurred, rather than concluding it. All abiogenesis experiments involve some form of human intervention, and always simulates conditions in a idealistic way rather than a realistic one. If abiogenesis is possible, one would expect a scientist to be able to set up the initial (realistic) conditions, and then sit back to see chemistry do its thing.

Secondly, ID Scientists make very strong arguments based on empirical evidence. One hardly ever see a calm reasoned response from Darwinists, rather it their replies involve name calling, and misrepresentations of the argument itself. If Darwinism is true, why can't they just answer the question, rather than avoiding it?

Thirdly, while Darwinists appear VERY concerned about the effect ID would have on science, one hardly ever hear any concern from them about inaccuracies on the Darwinian side. To the contrary, if you point them out, you're a "creationist".

Fourthly, there is a very clear double standard applied between ID and Darwinism. For Darwinism, just so stories are acceptable theories, while no amount of empirical evidence and reasoning seems to be enough for ID.

If ID made anything clear, it is that the Darwinian scientists are *NOT* honest in their motivations, and *DOES* exclude certain possibilities for purely philosophical reasons. Under these conditions, I feel perfectly comfortable attacking Darwinian theory.

Also, in Signature of the Cell, Stephen C Meyer outline his own study of the various theories on origin of live since Darwin to the RNA world. All these theories treat the origin of live as a purely chemical problem and either ignores or displaces the problem of informational origin. Though I can not do so myself, ID scientists like Meyer can understand your paper, and will criticize it. Moreover, I have a general idea of what his criticism would be: most probably displacing the origin of information out of view, rather than explaining it.

Now, I'm completely open to an explanation on how undirected natural processes can form information. I'm also not afraid of technical terms, as long as I can find an explanation for them. But to shoot above my head and then to call it quits is not fair play. Lacking knowledge is not the same as being stupid.


Einführung

The cell, with its variety of cellular compartments, varying polarities, competing interactions, and differing sites of molecular synthesis poses challenges to the formation of biomolecular interactions essential to all biological processes. This necessitates ways to bring biomolecules together in a tightly regulated manner. One mechanism for this localization is the use of molecular scaffolds to enable particular interactions while inhibiting off-pathway interactions, thus increasing the efficiencies of the biological processes in which they are involved in Zappulla and Cech (2006). Whereas proteins have long been appreciated to sometimes function as scaffolds, it is becoming increasingly clear that RNA molecules can also facilitate a wide range of interactions among and between proteins and nucleic acids, in many cellular contexts.

In this review, we define an “RNA scaffold” as an RNA molecule capable of bringing together 2 or more macromolecules to form a complex with functional activity. These macromolecules may be proteins, other RNAs or DNA molecules that in the absence of the RNA scaffold do not interact or do so very poorly. By this definition, perhaps the most well-known RNA scaffold molecules are ribosomal RNAs (rRNAs), which provide the structural and catalytic core of ribosomes around which approximately 57� ribosomal proteins (depending on species) (Lecompte et al., 2002) assemble to generate functioning ribosomes. Beyond this, long non-coding RNAs (lncRNAs) and even messenger RNAs (mRNAs) are now increasingly being shown to perform a diverse array of scaffolding roles. While rRNAs, bound by ribosomal proteins, are generally regarded as mostly static ribonucleoprotein complexes (RNPs) (Mathis et al., 2017)- although study of “specialized ribosomes” may shift this view (Genuth and Barna, 2018) – lncRNA and mRNAs are generally thought to facilitate more transient, regulatable interactions. Thus, RNAs can scaffold both stable cellular complexes and facilitate transient macromolecular interactions.

RNA can also function as a �oy” molecule, which we define similarly to a scaffold, except that in this case, two or more macromolecules are brought together by the RNA decoy in a complex that prevents the sequestered macromolecules from forming other interactions and functional complexes at other cellular locations. As with scaffolds, RNA decoy interactions can be transient and regulatable.

RNAs as molecular scaffolds or decoys possess several advantages over other types of biomolecules like proteins and DNA, including: (1) RNAs fold more readily than DNA into complex 3D structures by virtue of diverse secondary and tertiary structural interactions. (2) RNA abundance can be easily and rapidly increased (new transcription) or decreased (RNA decay) while using 1𠄲 orders of magnitude less energy than occurs for similar regulation of protein (Lynch and Marinov, 2015) indeed translation is the most energy-intensive process in a cell (Topisirovic and Sonenberg, 2011), whereas transcription (barring initiation) is largely an ATP-independent process (Imashimizu et al., 2014). (3) Unlike DNA, RNA is unencumbered with serving as a cell’s nuclear-localized permanent genetic material, thus increasing RNA’s regulatory potential. (4) Compared to proteins, RNA binds other molecules much more efficiently. For instance, 4� nts of RNA are capable of binding specific proteins, whereas protein-protein interaction domains typically range from tens to hundreds of amino acids (Prikryl et al., 2011 Chujo et al., 2016 Lunde et al., 2017). Additionally, RNA molecules are generally longer than most proteins (typical size of a globular protein = 5 nm radius of gyration of mRNA = 16.8�.8 nm) allowing greater spatial interaction potential with other biomolecules. (5) Evolution of RNA scaffolding functions likely occurs faster and is under less constraint than with protein scaffolds. This is evidenced by lower conservation of lncRNA genes versus protein coding genes (Johnsson et al., 2014), and the more complex protein folding rules and solubility issues that proteins face given their complement of 20 + distinct amino acids.

In this review, we discuss examples of many nuclear and cytoplasmic RNA scaffolds and decoys, some of which regulate relatively stable complexes, while others facilitate transient macromolecular interactions. Concepts of RNA-driven assemblies that have emerged, their physiological importance, and key remaining questions for future study will be highlighted. We will also focus on recent findings of mRNAs acting as cytoplasmic RNA scaffolds, and other means by which nascently translated proteins find their interaction partners. Finally, we discuss steps that can be taken to identify new RNA scaffolds and decoys.


Transcription/Translation Questions

1) Please closely examine Figure 1, and properly identify each of the components by writing the name of the component adjacent to the appropriate letter below.

Figure 1

A (the little circle): Amino Säure

B (the whole molecule): tRNA

C (this specific component of the molecule): Anticodon

D (three at a time): complimentary codon to anticodon

E (the while long, snake-like molecule): mRNA

F (the whole molecule): Ribosome

G (the chain of circles): Proteins

Is the 5′ cap on the right or left hand side of the mRNA molecule above? left side

This is a diagram of what cellular process?
It is a diagram of translation.

2) The purpose of the promoter and terminator sequences are to:

  1. Indicate to the DNA polymerase where to start and stop replicating the DNA
  2. Indicate to the RNA polymerase where to start and stop transcribing the DNA into mRNA
  3. Indicate to the ribosome where to start reading the codons to build a protein
  4. Indicate to the histones where to wind up the DNA and where to keep it uncoiled

3) mRNA is only ever transcribed from the template strand of DNA in order to preserve the correct sequence of nucleotides. The following mRNA strand, 5’ AUGCCG 3’ , was built from the correct template strand of DNA, 3’ TACGGC 5’ . What would the mRNA sequence be if the mRNA had been transcribed from the other complementary strand of DNA, 5’ ATGCCG 3’ , instead? Remember mRNA is read 5’-3’!! (1 point)

4) Carefully examine Figure 2 above. What happens to the tRNA and the amino acids in the A site? In the P site?

In the A site, tRNA accepts amino acids passed from the P site. P site passes the amino acids to A sites.

5) Looking at Figure 2 above, what would be the anticodon of the next tRNA molecule to enter the ribosome? Which amino acid would it be carrying?

It would be TTA and it would be carrying N.

6) If you were to label the LEFT-HAND side of the mRNA in the diagram above with the proper “direction” as it is represented in this figure (be sure you take note of the direction that the ribosome is moving along and reading the mRNA), you would label it 5’_______3′.

7) If the template strand of DNA had the sequence 3′ ATGGGC 5′ , the sequence of the mRNA transcript would be _________ and the two tRNA anticodons would be __________. (1 point)

  1. 5′ AUGGGC 3′ , UAC CCG
  2. 5′ AUGGGC 3′ , AUG GGC
  3. 5′ UACCCG 3′ , UAC CCG
  4. 5′ UACCCG 3′ , AUG GGC

8) Which amino acid would be attached to a tRNA molecule with an anticodon GAC? (the mRNA codon table is attached on the next page)

  1. Leucin
  2. Glutamine
  3. Aspartate
  4. Proline
  5. Valine

9) Look closely at Figure 3 above. It illustrates a single strand of mRNA with several ribosomes traveling along it at the same time. Why is it process absolutely vital in order to make proteins (labeled as poly peptides in the diagram) in a timely manner?

Multiple ribosomes traveling at one strand of mRNA is needed because the tRNA filters the ribosome randomly which makes the process untimely. The process is vital in order to make proteins in a timely manner because of the copy of mRNA.

10) Why do you think that mutations in an mRNA transcript would be likely to be less of an issue than mutations in a DNA molecule?

I think because mRNA is a copy.

11) If 30% of the DNA in a double helix is cytosine (C), which of the following is true? (circle all that apply)

  1. 20% of the DNA is adenine (A)
  2. 30% of the DNA is guanine (G)
  3. 20% of the DNA is guanine (G)
  4. 30% of the DNA is tyrosine (T)

12) How chromosomes are in each cell of the human body?

Figure 4

13) Looking at Figure 4 above, assign each component of the mRNA listed below with the appropriate letter that corresponds to the legend above:

  1. 5′ cap C
  2. Introns D
  3. Exons EIN
  4. poly-A tail B

14) Explain briefly the difference between introns and exons. How can one gene code for multiple proteins?

Introns are the ones required and exons are the ones that are not needed during translation. One gene can code for multiple proteins by making different combinations every time.

15) Written below is the nucleotide sequence of a strand of DNA. The underlined region of the DNA indicates the promoter sequence and terminator sequence of the gene.

  1. Please transcribe the template strand of DNA (marked with a *) into mRNA
  2. Underline the start codon and stop codon on the mRNA strand, and label the 5’ and 3’ ends.
  3. Write out the anticodon triplets for the tRNA molecules that would bind to the mRNA
  4. Using the table provided, determine the corresponding amino acid sequence. Please write the single letter abbreviations for each amino acid. (8 points)

5’ TGCAATATT CGATGTCACCGCTCGAGAAC GACATCGATTAAC CATATTCG 3′ * 3’ ACGTTATAAGC|TAC|AGT|GGC|GAG|CTC|TTG|CTG|TAG|CTA|ATT|GGT|ATA|AGC 5’

mRNA: 5′ AUG UCA CUC GAG AAC GAC AUC GAU UAA 3′


Classwork and Homework 2/9

1) Please closely examine Figure 1, and properly identify each of the components by writing the name of the component adjacent to the appropriate letter below.

Figure 1

A (the little circle): Amino Acid

B (the whole molecule): tRNA

C (this specific component of the molecule): Anti codons

D (three at a time): Codons complimentary to anti codons

E (the while long, snake-like molecule): mRNA

F (the whole molecule): Ribosome

G (the chain of circles): Protein Chain

Is the 5′ cap on the right or left hand side of the mRNA molecule above? Left side

This is a diagram of what cellular process? This diagram is portraying the process of translation.

2) The purpose of the promoter and terminator sequences are to:

  1. Indicate to the DNA polymerase where to start and stop replicating the DNA
  2. Indicate to the RNA polymerase where to start and stop transcribing the DNA into mRNA
  3. Indicate to the ribosome where to start reading the codons to build a protein
  4. Indicate to the histones where to wind up the DNA and where to keep it uncoiled

3) mRNA is only ever transcribed from the template strand of DNA in order to preserve the correct sequence of nucleotides. The following mRNA strand, 5’ AUG CCG 3’, was built from the correct template strand of DNA, 3’TAC GGC 5’. What would the mRNA sequence be if the mRNA had been transcribed from the other complementary strand of DNA, 5’ATG CCG 3’, instead? Remember mRNA is read 5’-3’!! (1 point)

4) Carefully examine Figure 2 above. What happens to the tRNA and the amino acids in the A site? In the P site? At the A site the tRNA molecule accepts the amino acid passed from the P site. At the P site of the ribosome the amino accept from the tRNA is passed to the A site.

5) Looking at Figure 2 above, what would be the anticodon of the next tRNA molecule to enter the ribosome? Which amino acid would it be carrying?

The anticodon of the next tRNA molecule would be TTA, it would be carrying the amino acid N.

6) If you were to label the LEFT-HAND side of the mRNA in the diagram above with the proper “direction” as it is represented in this figure (be sure you take note of the direction that the ribosome is moving along and reading the mRNA), you would label it 5′-3’______.

7) If the template strand of DNA had the sequence 3′ATG GGC 5′, the sequence of the mRNA transcript would be _________ and the two tRNA anticodons would be __________. (1 point)

  1. 5′AUGGGC3′, UAC CCG
  2. 5′AUGGGC3′, AUG GGC
  3. 5′UAC CCG3′, UAC CCG
  4. 5′ UAC CCG3′, AUG GGC

8) Which amino acid would be attached to a tRNA molecule with an anticodon GAC? (the mRNA codon table is attached on the next page)

  1. Leucin
  2. Glutamine
  3. Aspartate
  4. Proline
  5. Valine

9) Look closely at Figure 3 above. It illustrates a single strand of mRNA with several ribosomes traveling along it at the same time. Why is it process absolutely vital in order to make proteins (labeled as poly peptides in the diagram) in a timely manner?

The process of multiple ribosomes traveling over one strand of mRNA is necessary because the fact that tRNA filters through the ribosome at random making the process untimely. Multiple ribosomes also allow the multiple proteins to made a the same time greater using the single mRNA copy strand.

10) Why do you think that mutations in an mRNA transcript would be likely to be less of an issue than mutations in a DNA molecule?

The mutations of a mRNA strand are less dire than a DNA molecule because a DNA molecule makes numerous and all copies for proteins spreading the mutation, rather than the mRNA which is only used a few times then terminated.

11) If 30% of the DNA in a double helix is cytosine (C), which of the following is true? (circle all that apply)

  1. 20% of the DNA is adenine (A)
  2. 30% of the DNA is guanine (G)
  3. 20% of the DNA is guanine (G)
  4. 30% of the DNA is tyrosine (T)

12) How chromosomes are in each cell of the human body?

Figure 4

13) Looking at Figure 4 above, assign each component of the mRNA listed below with the appropriate letter that corresponds to the legend above:

  1. 5′ cap _C____
  2. Introns_ D____
  3. Exons_ EIN____
  4. poly-A tail__ B___

14) Explain briefly the difference between introns and exons. How can one gene code for multiple proteins? Introns are the unnecessary gene material in mRNA, there are removed from mRNA before translation. Exons are the usable and necessary genes which are used to code for proteins. One gene code can code for multiple proteins as different combinations of genes result in different proteins and protein chains.

15) Written below is the nucleotide sequence of a strand of DNA. The underlined region of the DNA indicates the promoter sequence and terminator sequence of the gene.

  1. Please transcribe the template strand of DNA (marked with a *) into mRNA
  2. Underline the start codon and stop codon on the mRNA strand, and label the 5’ and 3’ ends.
  3. Write out the anticodon triplets for the tRNA molecules that would bind to the mRNA
  4. Using the table provided, determine the corresponding amino acid sequence. Please write the single letter abbreviations for each amino acid. (8 points)

5’TGCAATATT CGATGTCACCGCTCGAGAACGACATCGATTAAC CATATTCG3′ *3’ACGTTATAAGC TAC AGT GGC GAG CTC TTG CTG TAG CTA ATT GGTATAAGC5’


Darwin's God

If you had a four-letter alphabet and all words were three letters, then how many words would there be? The answer is 4 times 4 times 4, or 4-cubed, or 4^3, or 64. That’s how the DNA code works. Our DNA has four molecular “letters” and to create a protein the letters are taken three at a time in words called “codons.” Each codon specifies an amino acid and these 64 different codons are mapped to 20 different amino acids (and a “stop” signal). Since the 64 different codons far exceeds the 20 different amino acids and the stop signal, the code is degenerate. In other words, there are multiple codons that map the same amino acid (just as “absurd” and “ludicrous” have similar meanings).

But why the mismatch? If only 20 different amino acids are coded for, why are there 64 different codons? There is quite a bit of unused messaging power, or what engineers call “bandwidth.” According to evolutionists, it was just another biological kludge revealing nature’s dysteleology.

But ever since its discovery the DNA code has continued to yield hidden treasures of intricacy. For example, the code is cleverly designed at several levels, including minimizing the effects of errors and maximizing information content (such as in supporting overlapping messages).

This makes it even more difficult for evolutionists to explain how the code evolved.

Furthermore the code’s unused bandwidth has been found to be used in a variety of creative ways where additional information is layered on the basic message indicating the amino acid sequence. You can see some examples here, here, here and here.

The new UCSF paper is another such an example of yet another layer of information in the “unused” bandwidth that evolutionists thought was just an inefficient fluke. It has been known for years that a DNA gene, that is used to construct a protein, has some special signals near the beginning that will help the translating process get started correctly.

Now, the new research indicates that similar signals are used throughout the gene. Their purpose is not to help the protein production process get started correctly, but rather to fine-tune the speed of the production process.

It is yet another example of the many different types of information that are layered in a DNA gene which have evolutionists rewriting their script and explaining that “It’s over. None of that happened.”

99 comments:

God must have loved bacteria. He gave them Shine-Dalgarno sequences.

Notes of related interest: It is found that the first DNA code had to be at least as complex as the current DNA code found in life:

Shannon Information - Channel Capacity - Perry Marshall - video
http://www.metacafe.com/watch/5457552/

“Because of Shannon channel capacity that previous (first) codon alphabet had to be at least as complex as the current codon alphabet (DNA code), otherwise transferring the information from the simpler alphabet into the current alphabet would have been mathematically impossible”
Donald E. Johnson – Bioinformatics: The Information in Life

Yet despite this severe constraint on evolability, it is found that DNA is a 'optimal code'

Biophysicist Hubert Yockey determined that natural selection would have to explore 1.40 x 10^70 different genetic codes to discover the optimal universal genetic code that is found in nature. The maximum amount of time available for it to originate is 6.3 x 10^15 seconds. Natural selection would have to evaluate roughly 10^55 codes per second to find the one that is optimal. Put simply, natural selection lacks the time necessary to find the optimal universal genetic code we find in nature. (Fazale Rana, -The Cell's Design - 2008 - page 177)

“The genetic code’s error-minimization properties are far more dramatic than these (one in a million) results indicate. When the researchers calculated the error-minimization capacity of the one million randomly generated genetic codes, they discovered that the error-minimization values formed a distribution. Researchers estimate the existence of 10^18 possible genetic codes possessing the same type and degree of redundancy as the universal genetic code. All of these codes fall within the error-minimization distribution. This means of 10^18 codes few, if any have an error-minimization capacity that approaches the code found universally throughout nature.”
Fazale Rana - From page 175 'The Cell’s Design'
http://www.reasons.org/biology/biochemical-design/fyi-id-dna-deciphering-design-genetic-code

As well there was a ‘optimality’ found for the 20 amino acid set used in the 'standard' Genetic code when the set was compared to 1 million randomly generated alternative amino acid sets

Does Life Use a Non-Random Set of Amino Acids? - Jonathan M. - April 2011
Excerpt: The authors compared the coverage of the standard alphabet of 20 amino acids for size, charge, and hydrophobicity with equivalent values calculated for a sample of 1 million alternative sets (each also comprising 20 members) drawn randomly from the pool of 50 plausible prebiotic candidates. The results? The authors noted that: "…the standard alphabet exhibits better coverage (i.e., greater breadth and greater evenness) than any random set for each of size, charge, and hydrophobicity, and for all combinations thereof."
http://www.evolutionnews.org/2011/04/does_life_use_a_non-random_set045661.html

Extreme genetic code optimality from a molecular dynamics calculation of amino acid polar requirement – 2009
Excerpt: A molecular dynamics calculation of the amino acid polar requirement is used to score the canonical genetic code. Monte Carlo simulation shows that this computational polar requirement has been optimized by the canonical genetic code, an order of magnitude more than any previously known measure, effectively ruling out a vertical evolution dynamics.
http://pre.aps.org/abstract/PRE/v79/i6/e060901

Collective evolution and the genetic code - 2006:
Excerpt: The genetic code could well be optimized to a greater extent than anything else in biology and yet is generally regarded as the biological element least capable of evolving.
http://www.pnas.org/content/103/28/10696.full

Here, we show that the universal genetic code can efficiently carry arbitrary parallel codes much better than the vast majority of other possible genetic codes. the present findings support the view that protein-coding regions can carry abundant parallel codes.
http://genome.cshlp.org/content/17/4/405.full

The data compression of some stretches of human DNA is estimated to be up to 12 codes thick (12 different ways of DNA transcription) (Trifonov, 1989). (This is well beyond the complexity of any computer code ever written by man). John Sanford - Genetic Entropy

The multiple codes of nucleotide sequences. Trifonov EN. - 1989
Excerpt: Nucleotide sequences carry genetic information of many different kinds, not just instructions for protein synthesis (triplet code).
http://www.ncbi.nlm.nih.gov/pubmed/2673451

"In the last ten years, at least 20 different natural information codes were discovered in life, each operating to arbitrary conventions (not determined by law or physicality). Examples include protein address codes [Ber08B], acetylation codes [Kni06], RNA codes [Fai07], metabolic codes [Bru07], cytoskeleton codes [Gim08], histone codes [Jen01], and alternative splicing codes [Bar10].
Donald E. Johnson – Programming of Life – pg.51 - 2010

As well, DNA coding is optimized for energy efficiency

DNA coding is apparently successfully designed along the very stringent guidelines laid out by Landauer's principle of 'reversible computation' in order to achieve such amazing energy efficiency, something man has yet to accomplish in any meaningful way for computers: