Information

Auf welchem ​​Strang sitzt der Promotor?

Auf welchem ​​Strang sitzt der Promotor?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Mein Buch gibt immer wieder verschiedene Hinweise darauf, ob sich die Promotoren auf dem Kodierungs- oder Template-Strang befinden.

  • Es besagt, dass die -35-Region in Prokaryoten auf dem kodierenden Strang liegen muss. Es wird auch erwähnt, dass die Regionen -10 und -35 Bindungsstellen für die RNA-Polymerase sind.

  • Es sagt auch, dass CAAT und GC im Gegensatz zu -35 in Prokaryoten auch auf dem Matrizenstrang sein können. Was bedeutet, dass sie immer noch am häufigsten auf dem kodierenden Strang vorkommen. Und dann zeigt es mir eine Figur, in der im Matrizenstrang eine Promotorsequenz mit angehängtem Transkriptionskomplex gezeigt wird.

Alle Sequenzen werden 5'-TATAAA-3' geschrieben (zum Beispiel). Dies impliziert auch, dass sie sich auf dem kodierenden Strang befinden, da der Matrizenstrang dann 3' -> 5' ist, was die Richtung ist, in der die Transkription stattfindet.

Natürlich bin ich verwirrt und hoffe, dass jemand das klären kann. In welchem ​​Strang finde ich die Promotoren? Wirkt das Zeug auf die Promotorsequenz selbst oder auf ihre komplementäre Sequenz? Wenn sich der Promotor auch auf dem anderen Strang befinden kann, sollte er dann umgekehrt werden?


Die Antwort auf diese Frage hängt von der Definition des Wortes „Promoter“ ab.

Im einfachsten Modell der prokaryotischen Transkription ist der Promotor die Stelle, an der die RNA-Polymerase an die DNA bindet, bevor die RNA-Synthese initiiert wird. In diesem Prozess erkennt der σ-Faktor die Kernpromotorelemente, die die Polymerase anweisen, an die DNA zu binden, um den geschlossenen Komplex zu bilden. Der nächste Schritt ist der Wechsel zum offenen Komplex mit Trennung der DNA-Stränge.

Artikel zur Untersuchung der Wechselwirkung des σ-Faktors mit der DNA (z. B. hier) beziehen sich auf die Kontaktaufnahme des Proteins mit Basenpaaren. Daraus schließe ich, dass die ursprüngliche Frage keinen Sinn ergibt – ein Promotor ist eine dsDNA-Einheit, auch wenn wir sie anhand der Sequenz auf dem einen oder anderen dieser Stränge beschreiben könnten. So würde beispielsweise in einem Promotor die Konsensus-35-Sequenz - 5'-TTGACA - auf dem kodierenden Strang (stromaufwärts der kodierenden Sequenz) vorhanden sein, aber die Promotoreigenschaft der Sequenz beruht auf dem Vorhandensein dieser Sequenz und sein Komplement auf dem anderen Strang.


Promoter nicht sitzen überall… es ist nur gegenwärtig… das Transkriptionsfaktor sitzt drauf :P

Witze beiseite … Fügen Sie Alan Boyds Antwort ein wenig mehr Informationen hinzu:

Alan Boyd weist darauf hin, dass die Bedingungen Codierung oder Vorlage bezieht sich auf die Region, die transkribiert wird. Normalerweise haben die Transkriptionsfaktoren (TF), die an DNA binden, eine dsDNA-Bindungsdomäne und binden daher an beide die Stränge. Die Sequenzerkennungsdomänen sind jedoch spezifisch und scannen normalerweise die DNA5'-> 3', anschließend Rekrutierung RNA-Polymerase in der gleichen Orientierung. Aber es gibt noch weitere Aspekte dazu:

  • Promotor/regulatorische Elemente sind in der Regel stromaufwärts, aber in einigen Fällen auch stromabwärts der TSS angeordnet
  • Die Aktivität eines Promotorelements hängt von dem TF ab, der daran bindet. Einige TFs können den gesamten genomischen Locus kontrollieren, d.h. sie beeinflussen mehrere Gene – sowohl stromaufwärts als auch stromabwärts.

7.5B: Der Promoter und die Transkriptionsmaschinerie

  • Beigetragen von Boundless
  • Allgemeine Mikrobiologie bei Boundless

Gene sind organisiert, um die Kontrolle der Genexpression zu erleichtern. Die Promotorregion befindet sich unmittelbar stromaufwärts der kodierenden Sequenz. Diese Region kann kurz (nur wenige Nukleotide lang) oder ziemlich lang (Hunderte von Nukleotiden lang) sein. Je länger der Promotor, desto mehr Platz für Proteine ​​zum Binden. Dies verleiht dem Transkriptionsprozess auch mehr Kontrolle. Die Länge des Promotors ist genspezifisch und kann sich zwischen den Genen dramatisch unterscheiden. Folglich kann sich auch der Grad der Kontrolle der Genexpression zwischen den Genen ziemlich dramatisch unterscheiden. Der Zweck des Promotors besteht darin, Transkriptionsfaktoren zu binden, die die Initiation der Transkription steuern.

Abbildung: Veranstalter: Ein generalisierter Promotor eines Gens, das von RNA-Polymerase II transkribiert wurde, wird gezeigt. Transkriptionsfaktoren erkennen den Promotor. RNA-Polymerase II bindet dann und bildet den Transkriptionsinitiationskomplex.

Innerhalb der Promotorregion, direkt stromaufwärts der Transkriptionsstartstelle, befindet sich die TATA-Box. Diese Box ist einfach eine Wiederholung von Thymin- und Adenindinukleotiden (wörtlich TATA-Wiederholungen). Die RNA-Polymerase bindet an den Transkriptionsinitiationskomplex, was die Transkription ermöglicht. Um die Transkription zu initiieren, bindet zuerst ein Transkriptionsfaktor (TFIID) an die TATA-Box. Die Bindung von TFIID rekrutiert andere Transkriptionsfaktoren, einschließlich TFIIB, TFIIE, TFIIF und TFIIH an die TATA-Box. Sobald dieser Transkriptionsinitiationskomplex zusammengesetzt ist, kann die RNA-Polymerase an ihre stromaufwärts gelegene Sequenz binden. Wenn sie zusammen mit den Transkriptionsfaktoren gebunden wird, wird die RNA-Polymerase phosphoryliert. Dadurch wird ein Teil des Proteins aus der DNA freigesetzt, um den Transkriptionsinitiationskomplex zu aktivieren und die RNA-Polymerase in die richtige Orientierung zu bringen, um mit der Transkription zu beginnen Mediatorproteine.

Zusätzlich zu den allgemeinen Transkriptionsfaktoren können andere Transkriptionsfaktoren an den Promotor binden, um die Gentranskription zu regulieren. Diese Transkriptionsfaktoren binden an die Promotoren eines spezifischen Satzes von Genen. Sie sind keine allgemeinen Transkriptionsfaktoren, die an jeden Promotorkomplex binden, sondern werden an eine bestimmte Sequenz auf dem Promotor eines bestimmten Gens rekrutiert. Es gibt Hunderte von Transkriptionsfaktoren in einer Zelle, die jeweils spezifisch an ein bestimmtes DNA-Sequenzmotiv binden. Wenn Transkriptionsfaktoren direkt stromaufwärts des kodierten Gens an den Promotor binden, werden sie als cis-wirkende Elemente bezeichnet, da sie sich auf demselben Chromosom direkt neben dem Gen befinden. Die Region, an die ein bestimmter Transkriptionsfaktor bindet, wird als Transkriptionsfaktor-Bindungsstelle bezeichnet. Transkriptionsfaktoren reagieren auf Umweltreize, die dazu führen, dass die Proteine ​​ihre Bindungsstellen finden und die Transkription des benötigten Gens initiieren.


Inhalt: Vorlage vs. Coding Strang

Vergleichstabelle

EigenschaftenVorlagenstrangCodierstrang
Alternative NamenAntisense-, Minus- oder nicht-kodierender StrangSense-, Plus- oder Non-Template-Strang
FunktionFungiert als Vorlage für die RNA-SyntheseBestimmt die Sequenzen des RNA-Strangs
RichtungspolaritätBewegt sich in eine 3’-5’-RichtungBewegt sich in 5’-3’ Richtung
Ablesen durch RNA-PolymeraseRNA-Polymerase liest den Matrizenstrang vom 3’- zum 5’-EndeRNA-Polymerase liest den kodierenden Strang nicht
NukleotidbasensequenzSeine Basensequenz ist komplementär sowohl zum kodierenden Strang als auch zur mRNASeine Basensequenz ist die gleiche wie die der neu gebildeten mRNA, aber Uracil ersetzt Thymin
Genetische KodierungTemplate-Strang haben „Anticodons“Codierungsstrang hat „Codons“
Bildung von WasserstoffbrückenZum Zeitpunkt der Transkription bildet sich vorübergehend eine Wasserstoffbrücke zwischen dem Template-Strang und der neu synthetisierenden mRNAKeine solchen Bindungsformen

Definition von Template-Strang

Der Matrizenstrang ist einer der DNA-Stränge, dessen Basensequenz beim Aufbau von mRNA durch komplementäre Basensequenzierung hilft. Vorlagenstrang oder „Antisense-Strang” läuft rein 3’- 5’ Richtung, entgegengesetzt zum Kodierstrang. Es enthält komplementäre Nukleotidsequenzen zur transkribierten mRNA.

Nach der Transkription wird die mRNA, bevor sie in reife mRNA umgewandelt wird, bestimmten posttranskriptionellen Modifikationen unterzogen. Der Template-Strang enthält auch „Anticodons“, die Triplett-Codes oder Triplett-Nukleotidsequenzen tragen, die komplementär zur Anticodon-Sequenz der t-RNA sind.

Die Anticodierung hilft bei der Anlagerung der spezifischen Aminosäure an die t-RNA, um mithilfe von rRNA ein Protein oder eine Peptidkette zu bilden. Eine RNA-Polymerase liest den Matrizenstrang, um eine RNA-Transkript durch Erkennen der Promotorgene oder -sequenzen. Daher ist die RNA-Polymerase diejenige, die über die Initiierung der Transkription und die Beendigung des Translationsprozesses entscheidet.

Beispiel

Angenommen, der Schablonenstrang trägt 5’- A T C G C G T A – 3’ Gensequenz. Die RNAP wird zuerst an die Promotorregion der DNA-Sequenz binden und die Transkription fördern. Durch die Bindung von RNAP an die Promotorstelle wird der Matrizenstrang transkribieren, um das primäre mRNA-Transkript zu bilden.

Wie wir besprochen haben, bildet die mRNA komplementäre Basensequenzen zu der des Matrizenstrangs. Daher trägt mRNA 3’- U A G C G C A U – 5’ Basenfolge.

Definition des Codierungsstrangs

Es ist einer der DNA-Stränge mit einer quadratischen Basensequenz mit der primären mRNA oder der transkribierten mRNA. Die Basensequenz der mRNA, die dem kodierenden Strang ähnlich ist, weist die gleichen Nukleotidbasen auf, mit Ausnahme von Thymin. In mRNA ist Uracil die stickstoffhaltige Base, die Thymin ersetzt.

Codierung oder „Sinnesstrang” läuft in a 5’- 3’ Richtung, entgegengesetzt zum Schablonenstrang. Da die RNAP den Matrizenstrang verwendet, um die mRNA zu transkribieren, ist der andere Strang der Sense-Strang, der einen komplementären Strang zu dem der Matrize bildet. Es enthält Triplett Codons, die für die spezifische Aminosäure kodieren, um Proteine ​​durch die mRNA-Translation aufzubauen.

Beispiel

Angenommen, der Schablonenstrang trägt 5’- A T C G C G T A – 3’ Gensequenz. Der kodierende Strang erzeugt komplementäre Paare relativ zum Matrizenstrang nach dem Watson- und Crick-Modell.

Daher ist die Basensequenz des Sense-Strangs 3’- T A G C G C A T – 5’. Die RNAP bindet an die Promotorregion der DNA-Sequenz und fördert den Transkriptionsprozess.

Durch die Anheftung von RNAP an die Promotorstelle wird der Matrizenstrang transkribiert, um das primäre Transkript mit einer Basensequenz zu bilden 3’- U A G C G C A U – 5’.


Auf welchem ​​Strang befinden sich die Promotor- und Enhancer-Sequenzen bei der Transkription?

Hallo, ich habe mich gefragt, auf welchem ​​Strang diese Sequenzen bei der Transkription auftreten. Viele der Quellen, die ich gesehen habe, geben an, dass Promotoren auf dem CODING-Strang vorkommen, aber die RNA-Polymerase den Matrizenstrang transkribiert, aber viele Bilder, die ich gesehen habe, zeigen sowohl den Promotor auf dem GLEICHEN Strang als auch den, der transkribiert wird (Vorlage). Bindet die RNA-Polymerase also an Promotoren und Enhancer auf dem kodierenden Strang oder Matrizenstrang?

Dies ist eines der Bilder, über die ich spreche, warum zeigen die Enhancer- und Promotorsequenzen auf demselben Strang, der transkribiert wird, sind diese Sequenzen wirklich auf dem Matrizenstrang?

Ja, was für ein schreckliches Bild. Ich denke, das ist einzelsträngige DNA, die keine transkriptionelle Aktivität hätte. Der Enhancer, der Promotor, sind Regionen doppelsträngiger DNA. Es ist semantisch falsch zu fragen, auf welchem ​​Strang sie sich befinden.

Entschuldigung, ich glaube, ich habe meine Frage falsch formuliert. Ich meinte, welcher Strang die Promotorsequenz hat an welche RNA-Polymerase bindet.

Ich hätte angenommen, dass die RNA-Polymerase nur an den Promotor eines Strangs binden kann und nicht an den anderen, da ein Strang zum anderen komplementär ist (unter der Annahme, dass die Transkriptionsfaktoren/RNA-Polymerase nur eine spezifische Promotor-Bindungsstelle haben) ), sorry, wenn ich das falsch formuliert habe oder eine zu große Annahme gemacht habe.

Habe ich Recht, wenn ich sage, dass die RNA-Polymerase an die Promotoren auf dem bindet? Kodierungsstrang aber transkribiert die Schablonenstrang, oder bindet RNA-Polymerase an beide Stränge-Promotoren/die Template-Strang-Promotoren?

EDIT: Egal, ich habe die Antwort in einem Lehrbuch gefunden, danke trotzdem für alles!


Prä-RNA und mRNA

Nach der Transkription müssen eukaryotische Prä-mRNAs mehrere Verarbeitungsschritte durchlaufen, bevor sie translatiert werden können. Auch eukaryotische (und prokaryotische) tRNAs und rRNAs werden prozessiert, bevor sie als Komponenten in der Proteinsynthesemaschinerie fungieren können.

MRNA-Verarbeitung

Die eukaryotische Prä-mRNA durchläuft eine umfangreiche Verarbeitung, bevor sie translatiert werden kann. Die zusätzlichen Schritte der eukaryotischen mRNA-Reifung erzeugen ein Molekül mit einer viel längeren Halbwertszeit als eine prokaryontische mRNA. Eukaryotische mRNAs halten mehrere Stunden, während die typischen E coli mRNA dauert nicht länger als fünf Sekunden.

Prä-mRNAs werden zunächst mit RNA-stabilisierenden Proteinen umhüllt, die die Prä-mRNA vor Abbau schützen, während sie verarbeitet und aus dem Zellkern exportiert wird. Die drei wichtigsten Schritte der Prä-mRNA-Prozessierung sind das Hinzufügen von stabilisierenden und signalgebenden Faktoren an den 5'- und 3'-Enden des Moleküls und das Entfernen von dazwischenliegenden Sequenzen, die die entsprechenden Aminosäuren nicht angeben. In seltenen Fällen kann das mRNA-Transkript nach der Transkription „bearbeitet“ werden.

5′ Kappen

Während die Prä-mRNA noch synthetisiert wird, a 7-Methylguanosin-Kappe wird durch eine Phosphatbindung an das 5'-Ende des wachsenden Transkripts angefügt. Diese Einheit (funktionelle Gruppe) schützt die entstehende mRNA vor Abbau. Darüber hinaus erkennen Faktoren, die an der Proteinsynthese beteiligt sind, die Kappe, um die Translation durch Ribosomen zu initiieren.

3′ Poly-A-Schwanz

Sobald die Elongation abgeschlossen ist, wird die Prä-mRNA durch eine Endonuklease zwischen einer AAUAAA-Konsensussequenz und einer GU-reichen Sequenz gespalten, wobei die AAUAAA-Sequenz auf der Prä-mRNA verbleibt. Ein Enzym namens Poly-A-Polymerase fügt dann eine Kette von ungefähr 200 A-Resten hinzu, die als bezeichnet wird Poly-A-Schwanz. Diese Modifikation schützt die prä-mRNA weiter vor Abbau und signalisiert den Export der zellulären Faktoren, die das Transkript benötigt, in das Zytoplasma.

Prä-mRNA-Spleißen

Eukaryotische Gene bestehen aus Exons, die proteinkodierenden Sequenzen entsprechen (Ex-on bedeutet, dass sie Exgedrückt) und intervening sequenzen genannt Introns (intron bezeichnet ihre intdienende Rolle), die an der Genregulation beteiligt sein können, aber während der Verarbeitung aus der prä-mRNA entfernt werden. Intronsequenzen in mRNA kodieren keine funktionellen Proteine.

Die Entdeckung von Introns kam in den 1970er Jahren für Forscher überraschend, die erwarteten, dass Prä-mRNAs Proteinsequenzen ohne weitere Verarbeitung spezifizieren würden, wie sie es bei Prokaryonten beobachtet hatten. Die Gene höherer Eukaryoten enthalten sehr oft ein oder mehrere Introns. Diese Regionen können regulatorischen Sequenzen entsprechen, jedoch ist die biologische Bedeutung von vielen Introns oder sehr langen Introns in einem Gen unklar. Es ist möglich, dass Introns die Genexpression verlangsamen, weil es länger dauert, prä-mRNAs mit vielen Introns zu transkribieren. Alternativ können Introns nicht-funktionelle Sequenzreste sein, die während der Evolution von der Fusion alter Gene übrig geblieben sind. Dies wird durch die Tatsache unterstützt, dass separate Exons oft separate Proteinuntereinheiten oder -domänen kodieren. Größtenteils können die Sequenzen von Introns mutiert werden, ohne dass das Proteinprodukt letztendlich beeinflusst wird.

Alle Introns einer Prä-mRNA müssen vor der Proteinsynthese vollständig und präzise entfernt werden. Wenn der Prozess auch nur um ein einziges Nukleotid fehlschlägt, würde sich der Leserahmen der wieder zusammengefügten Exons verschieben und das resultierende Protein wäre dysfunktional. Der Vorgang des Entfernens von Introns und des Wiederverbindens von Exons wird als . bezeichnet Spleißen (Abbildung 5). Introns werden entfernt und abgebaut, während sich die Prä-mRNA noch im Kern befindet. Das Spleißen erfolgt durch einen sequenzspezifischen Mechanismus, der sicherstellt, dass Introns entfernt und Exons wieder mit der Genauigkeit und Präzision eines einzelnen Nukleotids verbunden werden. Das Spleißen von Prä-mRNAs wird durch Komplexe von Proteinen und RNA-Molekülen durchgeführt, die als Spleißosomen bezeichnet werden.

Übungsfrage

Abbildung 5. Prä-mRNA-Spleißen beinhaltet die präzise Entfernung von Introns aus dem primären RNA-Transkript. Der Spleißprozess wird durch Proteinkomplexe, die als Spleißosomen bezeichnet werden, katalysiert, die aus Proteinen und RNA-Molekülen, den sogenannten snRNAs, bestehen. Spleißosomen erkennen Sequenzen am 5'- und 3'-Ende des Introns.

Fehler beim Spleißen werden mit Krebs und anderen menschlichen Krankheiten in Verbindung gebracht. Welche Mutationen können zu Spleißfehlern führen?

Beachten Sie, dass mehr als 70 einzelne Introns vorhanden sein können und jedes den Prozess des Spleißens – zusätzlich zum 5′-Capping und dem Hinzufügen eines Poly-A-Schwanzes – durchlaufen muss, um ein einzelnes, translatierbares mRNA-Molekül zu erzeugen.

RNA-Editierung in Trypanosomen

Abbildung 6. Trypanosoma brucei ist der Erreger der Schlafkrankheit beim Menschen. Die mRNAs dieses Pathogens müssen durch Zugabe von Nukleotiden modifiziert werden, bevor die Proteinsynthese erfolgen kann. (Kredit: Änderung der Arbeit von Torsten Ochsenreiter)

Die Trypanosomen sind eine Gruppe von Protozoen, zu denen der Erreger gehört Trypanosoma brucei, die beim Menschen die Schlafkrankheit verursacht (Abbildung 6). Trypanosomen und praktisch alle anderen Eukaryoten haben Organellen, die Mitochondrien genannt werden, die die Zelle mit chemischer Energie versorgen. Mitochondrien sind Organellen, die ihre eigene DNA exprimieren und von denen angenommen wird, dass sie die Überreste einer symbiotischen Beziehung zwischen einem Eukaryonten und einem verschlungenen Prokaryonten sind. Die mitochondriale DNA von Trypanosomen stellt eine interessante Ausnahme von The Central Dogma dar: Ihre Prä-mRNAs haben nicht die richtigen Informationen, um ein funktionelles Protein zu spezifizieren. Dies liegt in der Regel daran, dass der mRNA mehrere U-Nukleotide fehlen. Um dies zu beheben, führt die Zelle einen zusätzlichen RNA-Verarbeitungsschritt namens RNA-Editierung durch.

Andere Gene im mitochondrialen Genom kodieren für 40 bis 80 Nukleotide lange Leit-RNAs. Eines oder mehrere dieser Moleküle wechselwirken durch komplementäre Basenpaarung mit einigen der Nukleotide im prä-mRNA-Transkript. Die Leit-RNA hat jedoch mehr A-Nukleotide als die Prä-mRNA U-Nukleotide zum Binden hat. In diesen Regionen schleift die Leit-RNA aus. Die 3'-Enden von Guide-RNAs haben einen langen Poly-U-Schwanz, und diese U-Basen werden in Regionen des Prä-mRNA-Transkripts eingefügt, an denen die Guide-RNAs eine Schleife bilden. Dieser Prozess wird vollständig durch RNA-Moleküle vermittelt. Das heißt, Leit-RNAs – und nicht Proteine ​​– dienen als Katalysatoren bei der RNA-Bearbeitung.

RNA-Editing ist nicht nur ein Phänomen von Trypanosomen. In den Mitochondrien einiger Pflanzen werden fast alle Prä-mRNAs editiert. RNA-Editierung wurde auch bei Säugetieren wie Ratten, Kaninchen und sogar Menschen identifiziert. Was könnte der evolutionäre Grund für diesen zusätzlichen Schritt in der Prä-mRNA-Verarbeitung sein? Eine Möglichkeit besteht darin, dass die Mitochondrien, die Überreste alter Prokaryonten sind, eine ebenso alte RNA-basierte Methode zur Regulierung der Genexpression haben. Um diese Hypothese zu untermauern, unterscheiden sich Änderungen an prä-mRNAs je nach zellulären Bedingungen. Obwohl spekulativ, könnte der Prozess der RNA-Editierung ein Überbleibsel aus einer Urzeit sein, als RNA-Moleküle anstelle von Proteinen für die Katalyse von Reaktionen verantwortlich waren.


Problem: Basierend auf dem unten stehenden DNA-Strang und angenommen, dass sich der Promotor für dieses Gen links befindet, für welche Proteinsequenz unten kodiert diese Sequenz? (Angenommen, das erste Nukleotid ist der Anfang des ersten Codons)5' - ATGTTGAAAATGCCGTAGAGGC - 3ɺ. Met-Leu-Lys-Met-Pro-ArgB. Met-Leu-Lys-Met-ProC. Met-Leu-Lys-Met-Pro-stop-ArgD. Met-ProE. Pro-Met-Lys-Leu-Met

Der Translationsprozess verwendet Codons, die als Referenz für die entsprechende Aminosäuresequenz dienen. Wie gesagt, zeigt die Sequenz das erste Nukleotid als Beginn des ersten Codons. Dies erfordert daher nur eine direkte Umwandlung in ein mRNA-Transkript (d. h. der gezeigte Strang ist nicht der Remplate-Strang). Neben den entsprechenden Aminosäuren kodieren die Codons auch für zwei unterschiedliche Signale: den Start und die Beendigung des Translationsprozesses. Das Startcodon ist AUG, während die Stoppcodons UAG, UGA und UAA sind.

Problemdetails

Basierend auf dem unten stehenden DNA-Strang und angenommen, dass sich der Promotor für dieses Gen links befindet, für welche Proteinsequenz unten kodiert diese Sequenz? (Angenommen, das erste Nukleotid ist der Anfang des ersten Codons)


Antworten und Antworten

Ja, es ist der biologische Promotor.

Eine Promotorsequenz bindet Proteine ​​(einschließlich einer RNA-Polymerase), die an der Transkription der DNA eines Gens in eine mRNA beteiligt sind.
Diese befinden sich normalerweise in der Nähe des Gens, das sie beeinflussen, und bringen die Transkriptionsmaschinerie in die Nähe des DNA-Strangs. Die Promotorsequenz sagt einigen Transkriptionsfaktoren, wo die DNA zu binden ist. Andere Sequenzen und andere Faktoren können ebenfalls beteiligt sein.
Die Promotorsequenz kann von Gen zu Gen variieren und (vermutlich abhängig von den Proteinen, die die Zelle gerade herstellt) in verschiedenen Zelltypen funktionell sein oder nicht.
Regionsspezifische Promotoren aktivieren ein Gen in einer anatomischen Region (wie einem Teil des sich entwickelnden Gehirns). Zelltypspezifische Promotoren schalten das Gen in Zellen eines bestimmten Typs (wie Mikrogliazellen) ein.
Ein Suizidgen bewirkt, dass die Zelle, die es exprimiert, abstirbt.
Höchstwahrscheinlich bezogen sie sich auf die Entnahme der DNA, die die Promotorsequenz und die Suizidgensequenz enthält, aus dem Tier (oder die Herstellung) und kombinierte sie in vitro (in Glas, dh im Labor, nicht im Tier) und dann sie zurück in das Genom des Tieres (mehrmals, bis sie einen Fall fanden, in dem es so funktionierte, wie sie es wollten). Alternativ könnten andere Ansätze verwendet werden, um dies zu tun, aber dies ist am einfachsten.

Auf diese Weise erhalten sie ein Tier, das ein Gen für ein Suizidprotein besitzt, das durch den Promotor für einen bestimmten Zelltyp kontrolliert wird, wodurch es stirbt.
Wenn sich das Tier noch fortpflanzen kann, könnte es als genetische Linie vermehrt und gezüchtet werden, um mehr Tiere mit ähnlicher genetischer Ausstattung zu erhalten, wodurch viele verwandte Experimente ermöglicht werden.

Dies ist heutzutage in der Entwicklungsbiologie üblich. Darüber hinaus können viele (theoretisch fast alle) Proteine ​​zu experimentellen Zwecken in ein ähnlich kontrolliertes Genom eingefügt werden. Fluoreszierende Proteine ​​gehören zu den offensichtlichsten Beispielen. Hier sind einige Bilder von GFP (grün fluoreszierendes Protein) in verschiedenen Organismen.


2. PUC Biologie Molekulare Basis der Vererbung 1 Mark Fragen und Antworten

Frage 1.
Benennen Sie die Bestandteile eines Nukleosids?
Antworten:
Sie sind
(a) Pentosezucker
(b) Stickstoffbase.

Frage 2.
Nennen Sie die Purine der DNA?
Antworten:
(a) Adenin
(b) Guanin

Frage 3.
Nennen Sie die Pyrimidine der DNA?
Antworten:
(a) Cytosin
(b) Thymin

Frage 4.
Wer hat das Doppelhelix-Modell für DNA vorgeschlagen?
Antworten:
Watson und Crick.

Frage 5.
Nennen Sie die RNA-Typen.
Antworten:

Frage 6.
Erwähnen Sie die Stickstoffbase, die in RNA vorhanden ist, aber nicht in DNA.
Antworten:
Uracil

Frage 7.
Erwähnen Sie die Stickstoffbase, die in DNA, aber nicht in RNA vorhanden ist.
Antworten:
Thymin

Frage 8.
Wer hat Nukleinsäuren entdeckt?
Antworten:
Friedrich Miescher.

Frage 9.
Wer hat die halbkonservative Natur der DNA-Replikation entdeckt?
Antworten:
Meselson und Stahl.

Frage 10.
Was ist polycistronische mRNA?
Antworten:
mRNA, die genetische Informationen vieler Gene für die Synthese von Proteinmolekülen trägt, wird als polycistronische mRNA bezeichnet.

Frage 11.
Wer hat den Namen „Nucleinsäure“ gegeben?
Antworten:
Altmann.

Frage 12.
Was sind die beiden Komponenten von Adenosin?
Antworten:
Ribose-Zucker und Adenin-Stickstoff-Base.

Frage 13.
Gen definieren?
Antworten:
Das Gen ist der Teil der DNA, der für die Kontrolle der Expression eines Charakters verantwortlich ist.

Frage 14.
Cistron definieren?
Antworten:
Cistron ist die Struktureinheit des Gens, die die genetische Information eines Charakters enthält.

Frage 15.
Definiere Muton.
Antworten:
Es ist eine kleine Einheit von Cistron, bei der eine Mutation auftritt, die eine Veränderung des Gens verursacht.

Frage 16.
Aufklärung definieren.
Antworten:
Es ist die kleinste DNA-Einheit, die zur genetischen Rekombination fähig ist.

Frage 17.
Definieren Sie den genetischen Code.
Antworten:
Die Reihenfolge der Anordnung von Stickstoffbasen in der DNA, die die Reihenfolge der Anordnung von Aminosäuren während der Proteinsynthese bestimmt, wird als „genetischer Code“ bezeichnet.

Frage 18.
Triplet-Code definieren?
Antworten:
Ein Satz von drei Nukleotiden, der eine Aminosäure spezifiziert, bildet einen Triplett-Code.

Frage 19.
Transkription definieren?
Antworten:
Der Vorgang der Übertragung der genetischen Botschaft von DNA zu mRNA in Nukleotidsprache wird als Transkription bezeichnet.

Frage 20.
Übersetzung definieren?
Antworten:
Der Prozess, bei dem das Protein gemäß der in den Codons der mRNA enthaltenen Botschaft synthetisiert wird, wird als Translation bezeichnet.

Frage 21.
Wer hat das „Operon-Konzept“ vorgeschlagen?
Antworten:
Jakob und Monade.

Frage 22.
Nennen Sie das Initiator-Triplett-Cordon der Proteinsynthese?
Antworten:
AUG

Frage 23.
Genetischen Code definieren
Antworten:
Beziehung zwischen der Sequenz von Nukleotiden oder Basen auf mRNA und der Sequenz von Aminosäuren im Polypeptid.

Frage 24.
Was ist übersetzen.
Antworten:
Der Vorgang der Übersetzung der Nukleotidsprache der mRNA in die Aminosäuresprache durch tRNA wird als Translation bezeichnet.

Frage 25.
Transkription definieren.
Antworten:
Die Synthese von Messenger-RNA auf einer DNA-Matrize in Gegenwart des RNA-Polymerase-Enzyms wird als Transkription bezeichnet.

Frage 26.
Erklären Sie (in einer oder zwei Zeilen) die Funktionen der folgenden:
(a) Promotor (b) tRNA (c) Exons.
Antworten:
(a) Promotor: Er fungiert als Initiationssignal, das als Erkennungszentrum für die RNA-–-Polymerase fungiert, vorausgesetzt, das Operatorgen ist eingeschaltet.

(b) tRNA: Sie fungiert als Trägermolekül, das Aminosäuren auf Ribosomen für die Synthese von Polypeptiden überträgt.

(c) Exons: Dies sind kodierende Sequenzen oder exprimierte Sequenzen in einem eukaryontischen Gen.

Frage 27.
Geben Sie das Initiationscodon für die Proteinsynthese an. Benennen Sie die Aminosäure, für die es kodiert?
Antworten:
Initiationscodon – AUG und es kodiert für Methionin.

Frage 28.
In welche Richtung wird der neue DNA-Strang während der DNA-Replikation synthetisiert.
Antworten:
51 bis 31

Frage 29.
Nennen Sie das Enzym, das während der Synthese die kurzen Stücke im nacheilenden Strang verbindet
Antworten:
Ligase.

Frage 30.
Nennen Sie das Enzym, das bei der Bildung der Peptidbindung hilft?
Antworten:
Peptidyltransferase.

Frage 31.
Nennen Sie die drei Nonsense-Codons?
Antworten:
UAA, UAG, UGA.

Frage 32.
Erwähnen Sie die Doppelfunktionen von AUG?
Antworten:
AUG kodiert für die Aminosäure Methionin und fungiert auch als Initiatorcodon.

Frage 33.
Heterochromatin ist im Vergleich zu Euchromatin transkriptionell inaktiv. Einen Grund geben.
Antworten:
Heterochromatin ist dichter gepackt als Eurchromatin (braucht mehr Zeit zum Abwickeln während der Transkription)

2. PUC Biologie Molekulare Basis der Vererbung Zwei Mark Fragen und Antworten

Frage 1.
Was sind "Unsinn-Codons", benennen Sie sie.
Antworten:
Von 64 Triplett-Codons kodieren nur 61 für Aminosäuren. Drei Codons, die nicht für Aminosäuren codieren, werden als Nonsense-Codons bezeichnet.
Dies sind UAA, UAG und UGA. Sie werden auch als ‘Terminator-Codons’ bezeichnet.

Frage 2.
Was ist ein Nukleotid? Gib ein Beispiel.
Antworten:
Nukleotid ist eine monogene Nukleinsäureeinheit. Es besteht aus einem Pentosezucker, der mit einer Stickstoffbase und einer Phosphatgruppe verbunden ist. Die Base und der Zucker sind durch eine glykosidische oder N-ribosidische Bindung verbunden und der Zucker und das Phosphat sind durch eine Esterbindung verbunden.
B.: Nukleosid + Phosphat = Nukleotid
Desoxyadenosin + Phosphat = Desoxyadenylsäure

Frage 3.
Nennen Sie die verschiedenen Nukleotide der DNA.
Antworten:
(a) Desoxyadenylsäure oder Köder-Adenosinmonophosphat (dAMP)
(b) Desoxyguanylsäure oder Desoxyguanosinmonophosphat (dGMP)
(c) Desoxycytidylsäure oder Desoxycytidinmonophosphat (d CMP)
(d) Desoxythymidylsäure oder Desoxythymidinmonophosphat (dTMP).

Frage 4.
Nennen Sie 4 Unterschiede zwischen -RNA und DNA.
Antworten:

RNA DNA
1. Einzeldrähtig 1. Doppelsträngig.
2. Zuckerkomponente ist Desoxyribose. 2. Zuckerkomponente ist Ribose.
3. Stickstoffbasen sind Adenin, Guanin, Cytosin und Uracil 3. Stickstoffbasen sind Adenin, Guanin, Cytosin und Thymin.
4. genetisches Material in bestimmten Pflanzen und Tieren und nimmt an der Proteinsynthese teil. 4. Genetisches Material in allen Organismen mit Ausnahme bestimmter Pflanzen und Tiere.

Frage 5.
Wenn das Codon der mRNA während der Translation AUG ist, dann
1. Welche Anticodonsequenz hat die entsprechende tRNA?
2. Nennen Sie die Aminosäure, die von dieser tRNA getragen wird.
Antworten:
UAC ist das Anticodon und Methionin ist die Aminosäure.

Frage 6.
Nennen Sie vier Zeichen des genetischen Codes?
Antworten:

  1. Genetischer Code ist universell
  2. Es ist ein Drilling in der Natur
  3. Es ist nicht überlappend und sehr sequentiell
  4. Es ist entartet.

Frage 7.
Geben Sie einen Bericht über mRNA an.
Antworten:

  • mRNA wird durch Transkription auf einer DNA-Matrize synthetisiert und ist dazu komplementär.
  • Die mRNA-Synthese wird am 51-Ende initiiert und schreitet in Gegenwart des RNA-Polymerase-Enzyms zum 31-Ende fort.
  • Es fungiert als Bote, um die genetische Information von der DNA zur zytoplasmatischen Stelle der Proteinsynthese zu transportieren.
  • Es hat eine sehr kurze Lebensdauer und wird von Ribonukleasen gebrochen.

Frage 8.
Unterscheiden Sie zwischen Sense- und Antisense-Strängen der DNA.
Antworten:

Sinnesstränge Antisense-Stränge
1. Es enthält Informationen über ein spezifisches Polypeptid. wenn Synthese. 1. Es ist nicht an der mRNA-Synthese beteiligt.
2. Hat eine Promotorregion für die Bindung von RNA-Polymerase 2. Hat keinen Promotor für die RNA-Polymerase
3. Hat eine zur mRNA komplementäre Sequenz. 3. Sequenz von Nukleotiden ähnlich der mRNA.
4. Auch Vorlage genannt. 4. Auch nicht kodierender Strang genannt.

Frage 9.
Nennen Sie zwei beliebige Anwendungen des DNA-Fingerabdrucks.
Antworten:
A. Identifizierung von Kriminellen in Fällen im Zusammenhang mit Vergewaltigung, Mord usw.
B. Ermittlung des wirklichen Vaters von Kindern im Rahmen von Vaterschaftsstreitigkeiten.

Frage 10.
Nennen Sie das Enzym, das katalysiert
(a) Replikation von DNA und
(b) Bildung von RNA
Antworten:
(a) Topoisomerase.
(b) RNA-Polymerase

Frage 11.
Unterscheiden Sie zwischen Exoiis und Introns.
Antworten:
Exons:
(a) Sie sind die kodierende Sequenz des DNA/RNA-Transkripts, die Teile der mRNA bilden und für verschiedene Regionen des Polypeptids kodieren.
(b) Sie werden während des Spleißens zusammengefügt, um die Informationen kontinuierlich zu machen.

Introns:
(a) Introns sind nicht kodierende Sequenzen des DNA/RNA-Transkripts, die nicht Teil der mRNA werden.
(b) Sie werden beim Spleißen entfernt.

Frage 12.
Gruppieren Sie die folgenden als stickstoffhaltige Basen und Nukleoside: Adenin, Cytidin, Thymin, Guanosin, Uracil und Cytosin.
Antworten:
Stickstoffbasen-Adenin, Thymin, Uracil, Cytosin. Nukleoside, Cytedin, Guanosin.

Frage 13.
Wenn eine doppelsträngige DNA 20 % Cytosin enthält, berechnen Sie 4 He Prozent Adenin in der DNA.
Antworten:
Der Anteil an Cytosin = 20 (angegeben)
Daher ist der Guanin-% = 20.
Der Prozentsatz von Thymin + Adenin beträgt 100 – (20 + 20) = 60.
Daher beträgt der Adenin-% 60/2 = 30%

Frage 14.
Wenn die Sequenz eines DNA-Strangs wie folgt geschrieben wird: 5’ATGCATGCATGCATGCA TGCATGCA TGC-3’Schreiben Sie die Sequenz des komplementären Strangs in Richtung 5′ → 3′ auf.
Antworten:
Gegebene DNA-Sequenz5′-
ATGCATGCATGCATGCATGCATGCA TGC-3′
Sequenz des komplementären Strangs in 3′ → 5’Richtung3′-
TACG’I ACGTACGTACGI ACGTACGT ACG-5’
Diese Sequenz von komplementären Strängen in 5′ → 3′ Richtung’
wird die Umkehrung der obigen Reihenfolge sein-
5′-GCATGCATGCATGCATGCATGCATG CAT-3′.

Frage 15.
Wenn die Sequenz des kodierenden Strangs in einer Transkriptionseinheit wie folgt geschrieben ist: 5’-ATGCATGCATGCATGCATGCATGC ATGC-3’ Notieren Sie die Sequenz der mRNA.
Antworten:
Die Sequenz des kodierenden Strangs in einer Transkriptionseinheit ist S’-
ATGCATGCATGCATGCATGCATGC ATGC-31
Die Sequenz des Matrizenstrangs ist 3′-
3 TACGTACGTACGTACGTACGTACGT ACG-5’
Somit ist die Sequenz der mRNA 5′-
AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3′

Frage 16.
Definiere die Begriffe
(a) Transkription
(b) Übersetzung.
Antworten:
(a) Der Vorgang der Übertragung einer genetischen Botschaft von DNA zu mRNA in Nukleotidsprache wird als Transkription bezeichnet.

(b) Der Prozess, durch den das Protein gemäß der in den Codons der mRNA enthaltenen Botschaft synthetisiert wird, wird als Translation bezeichnet.

2. PUC Biologie Molekulare Basis der Vererbung Drei Punkte Fragen und Antworten

Frage 1.
Wie entsteht Nukleosom? Zeichnen Sie ein Diagramm des Nupleosoms.
Antworten

  • Bei Eukaryoten ist die DNA um ein positiv geladenes Histon-Oktamer gewickelt, das als Nukleosom bezeichnet wird.
  • Ein typisches Nukleosom besteht aus 200 bp DNA-Helix.
  • Die Nukleosomen sind die sich wiederholenden Einheiten, die Chromatinfasern bilden.
  • Die Chromatinfasern kondensieren im Metaphasestadium der Zellteilung, um Chromosomen zu bilden.
  • Die Verpackung von Chromatin auf höherer Ebene erfordert einen zusätzlichen Satz von Proteinen, die als nicht histon chromosomale (NHC) Proteine ​​bezeichnet werden.
  • In einem Kern sind bestimmte Bereiche des Chromatins lose gepackt und färben sich heller als die anderen Bereiche, die als Euchromatin bezeichnet werden.
  • Die anderen Regionen sind dicht gepackt und färben sich dunkler und werden als Heterochromatin bezeichnet.
  • Euchromatin ist transkriptionell aktiver als Heterochromatin.

Frage 2.
Erklären Sie die Ereignisse nach der Transkription bei Eukaryoten.
Antworten:
Transkription in Eukaryoten

  • Bei Eukaryoten sind die Strukturgene monocistronisch und „gespalten“.
  • Sie haben kodierende Sequenzen, die Exons genannt werden, die Teil der mRNA sind, und nicht-kodierende Sequenzen, die Introns genannt werden, die nicht Teil der mRNA sind und beim Spleißen entfernt werden.
  • In Eukaryoten gibt es neben der RNA-Polymerase in den Organellen mindestens drei verschiedene RNA-Polymerasen im Zellkern, die wie folgt funktionieren:


RNA-Polymerase I transkribiert rRNAs (26S, 18S und 5.8S)
RNA-Poymerase II transkribiert den Vorläufer der mRNA (genannt als heterogene nukleäre RNA (hnRNA)) und
RNA-Polymerase III katalysiert die Transkription von tRNA.

  • Das primäre Transkript enthält sowohl Exons als auch Introns und wird einem als Spleißen bezeichneten Prozess unterzogen, bei dem die Introns entfernt und die Exons in einer bestimmten Reihenfolge verbunden werden, um mRNA zu bilden.
  • Die hnRNA durchläuft zwei zusätzliche Prozesse, die als „Capping“ und „Tailing“ bezeichnet werden.
  • Beim Capping wird Methylguanosintriphosphat an das 5’Ende der hnRNA angefügt.
  • Beim Tailing werden Adenylatreste (ca. 200-300) am 3. Ende der hnRNA hinzugefügt.
  • Die vollständig prozessierte hnRNA wird als mRNA bezeichnet und vom Zellkern in das Zytoplasma freigesetzt.

2. PUC Biologie Molekulare Basis der Vererbung Fünf Mark Fragen und Antworten

Frage 1.
Beschreiben Sie die Regulation des lac-Operons in E.coli.
Antworten:

Die Regulation der Genwirkung ist bei E. coli-Bakterien im Hinblick auf die Verwertung von Laktose durch die Bakterien gut untersucht.

Die Verwertung von Lactose in E. coli benötigt drei Enzyme, nämlich B-Galactosidase, B-Galactosidase-t-Permease und B-&ggr;-Galactosid-Transacetylase. Diese werden von Z-, Y- bzw. a-Genen produziert. Enzym RNA-Polymerase-Enzym initiiert die Synthese dieser 3 Enzyme. Der Mechanismus des lac-Operons kann in zwei Schritten untersucht werden, nämlich:

(a) Ausgeschalteter Mechanismus: Wenn Lactose im Medium fehlt, produziert das Regulatorgen ein Repressorprotein, das an das Operatorgen bindet. Dadurch wird die Bewegung der RNA-Polymerase auf die Strukturgene blockiert, so dass keine Synthese von mRNA aus den Strukturgenen Z,Y und a stattfindet, also keine Synthese von Enzymen stattfindet. Dies wird als ausgeschalteter Mechanismus bezeichnet

(b) Eingeschalteter Mechanismus: Wenn dem Kulturmedium Lactose zugesetzt wird, dringen einige seiner Moleküle in die Bakterienzelle ein und eines von ihnen bindet sich selbst mit einem Repressor. Es induziert eine strukturelle Veränderung des Repressorproteins und macht es inaktiv. Dieser inaktive Repressor wird von der Operatorregion gelöst. Nun bewegt sich die RNA-Polymerase entlang der DNA und als Ergebnis produzieren die Strukturgene Z, Y und a mRNA. Diese mRNA synthetisiert 3 Enzyme, die für den Laktosestoffwechsel notwendig sind. Dies wird als eingeschalteter Mechanismus bezeichnet.

Frage 2.
Beschreiben Sie die semikonservative Methode der DNA-Replikation.
Antworten:
Der Prozess der Bildung einer neuen DNA-Kopie aus der bestehenden wird als DNA-Replikation bezeichnet. Sie erfolgt nach einem semikonservativen Verfahren, dh ein Strang des Elternmoleküls wird im Tochtermolekül der DNA konserviert. Dieser Mechanismus wurde von Watson und Crick vorgeschlagen und experimentell von Meselson und Stahl bewiesen.

Voraussetzungen: DNA-Vorlagen. Unwindase, RNA-Primer, RNA-Polymerase, DNA-Polymerase I und III, DNA-Lygase und DeOxyribonukleotide

Schritte:
1. Abwickeln der DNA: Aufgrund der Aktivität von REN findet an einer bestimmten Stelle das Nicken des DNA-Strangs statt, um Orisit zu bilden. Das Abwickeln der DNA erfolgt von Orisit mit Hilfe des Enzyms Unwindase oder Helicase. Die beiden getrennten DNA-Stränge sehen wie eine ‘y’-Form aus und werden als Replikationsgabel bezeichnet. Die getrennten DNA-Stränge dienen als Matrizen für die Synthese neuer Stränge.

2. Synthese des RNA-Primers: RNA-Primer ist ein kurzes RNA-Segment (8-10 Nukleotide), das mit Hilfe von RNA-Polymerase oder Primase auf einer DNA-Matrize synthetisiert wird. Die Synthese des RNA-Primers ist erforderlich, da das Enzym DNA-Polymerase III die Synthese eines neuen DNA-Strangs auf der Matrize nicht direkt initiieren kann.

3. Bildung von führenden und nacheilenden Strängen: Die Bildung neuer DNA-Stränge durch das DNA-Polymerase-Enzym kann nur in Richtung 5′ bis 3′ erfolgen. Die Synthese neuer komplementärer Stränge erfolgt an beiden Templaten in entgegengesetzter Richtung. Ein neuer komplementärer Strang, der in Richtung der Replikationsgabel auf dem Template-Strang gebildet wird, ist kontinuierlich und wird als führender Strang oder kontinuierlicher Strang bezeichnet. Die Synthese des anderen neuen komplementären Strangs aus der Replikationsgabel erfolgt diskontinuierlich am Elternstrang und wird als nachlaufender Strang oder diskontinuierlicher Strang bezeichnet. Dieser nachlaufende Strang hat kleine Segmente des RNA-Primers, an die DNA-Nukleotide gebunden sind. Diese werden Okazaki-Fragmente genannt.

4. Bildung und Trennung des Tochter-DNA-Moleküls: In diesem Schritt werden RNA-Primer durch die DNA-Polymerase I entfernt und die Lücken werden durch die DNA-Nukleotide durch das gleiche Enzym aufgefüllt. Dann werden kurze DNA-Segmente durch DNA-Lipase verbunden, wodurch ein kontinuierlicher DNA-Strang entsteht. Somit hat jedes Tochter-DNA-Molekül einen alten Elternstrang und einen neuen Strang und folgt daher einer halbkonservativen DNA-Methode. Reproduzieren

Frage 3.
Beschreiben Sie fünf beliebige Eigenschaften des genetischen Codes.
Antworten:
Die Eigenschaften des genetischen Codes sind:
(a) Triplett-Code: Der genetische Code ist ein Triplett-Code. Es bedeutet, dass drei Basen der DNA für eine Aminosäure kodieren.

(b) Der genetische Code ist universell: Dies bedeutet, dass ein bestimmtes mRNA-Codon in allen lebenden Organismen für dieselbe Aminosäure kodiert. Zum Beispiel: AUG kodiert in allen Organismen für die Aminosäure Methionin.

(c) Der genetische Code ist von Redundanz degeneriert: Einige der Aminosäuren werden von zwei oder mehr Codons codiert. Diese redundanten Codons für dieselben Aminosäuren werden als degenerierte Codons bezeichnet und diese Eigenschaft wird als Degeneration bezeichnet.

(d) Genetischer Code ist nicht überlappend: Bei dieser Eigenschaft wird die Base eines Codons nicht von den benachbarten Codons geteilt.

(e) Genetischer Code ist ohne Komma: Genetischer Code hat kein Satzzeichen in der Nachricht. Sobald das Lesen der Nachricht mit dem Initiatorcodon AUG beginnt und fortgesetzt wird, bis das Terminatorcodon erreicht ist.

Frage 4.
Erklären Sie das Experiment von Avery, um zu zeigen, dass DNA als genetisches Material fungiert.
Antworten:

Im Jahr 1928 entdeckte Griffith, der an der Pathogenität von Streptokokken-Pneumonie arbeitete, einen Prozess namens Transformation. Dieses Bakterium ist für eine Form von Lungenentzündung verantwortlich, die Mäuse tötet. Es gibt zwei Bakterienstämme – glatter Stamm (S) mit einer gallertartigen Hülle und ein ‘rauer Stamm (R) ohne den gallertartigen Mantel. Bakterien vom glatten Stamm sind vom virulenten Typ und töten die Mäuse, während Bakterien vom rauen Stamm vom avirulenten Typ sind und die Mäuse nicht töten.

Wenn lebende Bakterien des groben Stamms (R) injiziert werden, stirbt die Maus nicht. Wenn lebende glatte Bakterien injiziert werden, stirbt die Maus. Wenn jedoch durch Hitze abgetötete glatte Bakterien (S) injiziert werden, stirbt die Maus nicht. Wenn den Mäusen eine Mischung aus durch Hitze abgetöteten glatten Bakterien (S) und lebenden rauen Bakterien (R) injiziert wird, stirbt sie. Einige Eigenschaften von durch Hitze abgetöteten glatten Bakterien hatten das R-Bakterium in virulente Typen umgewandelt. Diese Aktivität wurde von Griffith als Transformationsprinzip bezeichnet.

1944 erweiterten Avery, MacLeod und Me Carty Griffiths Experiment, um das Transformationsprinzip zu identifizieren. Sie vermischten den Stamm ‘R’ mit DNA, die aus dem Bakterienstamm ‘S’ gewonnen wurde. Wenn das Enzym (DNAase), das DNA verdaut oder abbaut, diesen Mischungen zugesetzt wurde, gab es keine Transformation vom R- zum S-Typ. Aber wenn das Enzym Proteasen, die Proteine ​​verdauen, dem Medium zugesetzt wurde, wurde die Umwandlung vom R- zum S-Typ nicht verhindert. Dies bestätigte, dass das transformierende Prinzip DNA war.

Frage 5.
Beschreiben Sie das Doppelhelixmodell der DNA
Antworten:
Watson und Crick schlugen 1953 ein Modell zur Erklärung der Struktur der DNA vor, das als Doppelhelix-Modell bezeichnet wird. Nach diesem Modell ist
(a) DNA besteht aus zwei Polynukleotidketten, die spiralförmig um eine zentrale Achse gewunden sind, um eine Doppelhelix zu bilden.

(b) Die beiden Polynukleotidketten einer Doppelhelix sind entgegengesetzt gerichtet. Eine Kette verläuft in Richtung 5′ → 3′ und die andere in Richtung 3′ → 5′.

(c) Wasserstoffbrücken werden zwischen stickstoffhaltigen Basen gebildet. Die Basenpaarung in der DNA besteht aus einem Purin und einem Pyrimidin. Weiterhin paart sich Adenin (A) immer mit Thymin (T) und Guanin (G) immer mit Cytosin. Diese Basenpaarung wird als komplementäre Basenpaarung bezeichnet. Zwischen A und T werden zwei Wasserstoffbrückenbindungen gebildet und zwischen G und C werden drei Wasserstoffbrückenbindungen gebildet.

(d) Die Gesamtmenge von A ist gleich der von T und die Gesamtmenge von G ist gleich der von C. in DNA-Molekülen. Diese Beziehung zwischen Basenpaaren ist als die Regel von Chargoff bekannt. Es wird als A = T, C = G dargestellt.

(e) Das Rückgrat der DNA-Helix besteht aus Zucker und Phosphat.

(f) One double helical turn is ‘S’ shaped and contains one major groove and a minor groove. One complete turn of the helix is 34A° in length and it consists of 10 base pairs. Thus the distance between two adjacent bases is 3.4A0. The constant distance between the two strands is 20A°.

Frage 6.
Briefly explain the steps involved in DNA Anger printing?
Antworten:

This is a technique which helps in the establishment of the identity of a person by detecting and comparing specific nucleotide sequences in DNA of individuals.
This technique was developed by Alec Jeffreys and his associates.
Steps:
A. Collection of sample: Sample like blood, semen, hair, saliva or any other tissue even in the dried state are collected.

B. Extraction of DNA: The material collected is subjected to high speed centrifugation which separates the DNA from the cell.

C. Fragmenting DNA: The DNA in the sample is treated with restriction endonucleases to obtain smaller restriction fragments.

D. Separating DNA fragments: The smaller fragments of DNA are made to run on an agarose gel plate by electrophoresis technique in which depending on molecular size and shape, the nucleotides produce distinct bands in the gel.

e. Extracting DNA from gel: The double stranded DNA fragment in the gel it denatured into single strands by exposing the gel into an alkaline solution (NaOH). Then by Southern blotting technique, these single stranded DNA fragments are transferred onto a nitrocellulose filter or a nylon membrane.

F. Tagging radioactive probes: A probe is radio actively labelled synthetic DNA. The nitrocellulose filter is now incubated with these radioactive probes. The probes act as specific nucleotide detectors and binds or hybridises with the specific nucleotides present in DNA fragments on the filter.

g. Auto radiography: An x-ray film is placed on the filter to obtain autoradiographic prints. The film is then processed to observe visible hydridised pattern of bands. This is the genetic finger print or DNA finger print.

h. Comparison: Comparison of two genetic finger prints with great care can provide information about the degree of similarities or differences.

Question 7.
Enlist the goals and applications of Human Genome project.
Antworten:
The objectives of HGP are :
A. To identify the estimated 1,00,000 genes present in the 23 human chromosomes.
B. To determine the sequence of 3 billion base pairs that make up human DNA.
C. To store this information in a Data Base.
D. To improve tools for data analysis.
e. To address ethical, legal and social issues that may arise from the project.

Applications of HGP:
A. It will help in understanding the functioning of genes and genetic regulation.
B. Many genes associated with human diseases like cystic fibrosis, breast cancer, muscle
disorders, cardio vascular diseases, diabetes etc have been identified. This helps in understanding the disease development and formulating new methods of diagnosis and treatment.
C. Helps in medical diagnosis and treatment.

Question 8.
Briefly explain the process of Translation during protein synthesis?
Antworten:

Translation is the second step during protein synthesis in which using genetic information on mRNA in nucleotide language, protein synthesis takes place on the ribosome in the amino acid lineage. mRNA carrying coded message for the synthesis of protein will be released into cytoplasm. With the help of this mRNA translation occurs in four steps.
Sie sind

  1. Activation and selection of Amino acids
  2. Chain initiation
  3. Chain elongation
  4. Chain termination.

1. Activation and selection of amino acids: In this step, amino acid combines with ATP in the presence of amino acid synthetase and forms activated amino acid and this process is known as activation. The activated amino acid thus will be picked up by specific +RNA molecule and form amino acid + RNA.
Amino acid + ATP → Activated amino acid.
Activated amino acid + +RNA → Amino acid +RNA

2. Chain initiation: During this process, initially mRNA attaches to smaller ribosomal subunit. Then +RNA carrying methionine attaches to the initiator codon (AUG) of mRNA. Now larger ribosomal subunit attaches to mRNA, such that the +RNA with amino acid coincides at P-Site. Soon after this, another +RNA with a second amino acid attaches to A-site peptide bond is formed, between the first amino acid occupying A-site. Chain initiation needs ATP and proteins called initiation factors.

3. Chain elongation: Soon after chain initiation, ribosomal subunits slide along mRNA. This shifts the +RNA occupying A-site automatically to the P-site. Now to the emptied A-site, +RNA carrying third amino acid gets attached. With this peptide bond is established between second and third amino acids. This results in the growing of polypeptide chain referred to as chain elongation. Chain elongation requires GTP, elongation factors and Mg+2 ions.,

4. Chain termination: As soon as the sliding ribosomal subunits arrive at the terminator codons, the protein synthesis is stopped with the association of releasing factors to the larger subunit of ribosome. This is known as chain termination.

Soon after chain termination, newly formed polypeptide chain undergoes processing and attains specific structure.

Question 9.
Differentiate between continuous and discontinuous synthesis of DNA.
Antworten:
Continous synthesis:
(a) One stand of DNA is synthesised as a continuou.s stretch in the 5′ 3′ direction
(b) The template strand of DNA strand is with 3′ → 5′ polarity.
(c) No need of enzyme ligase (fof joining).
(d) There is no need for primers. ‘

Discontinuous synthesis:
(a) Short stretches are synthesised in the 5′ → 3′ direction from replication fork,
(b) The DNA strand with 5′ → 3’ polarity is the template Strand for this.
(c) DNA ligase enzyme is required for joining short stretches.
(d) There is need for primers.

Question 10.
Describe the process Of transcription of mRNA in an Eukaryotic cell.
Antworten:
1. In eukaryotes, the structural genes are monocistronic and‘split’.

2. They have coding sequences called exons that form part of mRNA and non-coding sequences, called introns, that do not form part of the mRNA and are removed during splicing.

3. In eukaryotes, there are atleast three different RNA polymerases in the nucleus, apart from the RNA polymerase in the organelles, which function as follows:

RNA polymerase I transcribes rRNAs (26S, 18S and 5.8S)
RNA poymerasell transcribes the precursor of mRNA (called as heterogenouus nuclear RNA (hnRNA)) and
RNA-polymerase HI catalyses transcription of tRNA.

4. The primary transcript contains both exons and introns and it is subjected to a process-, called splicing, where the introns are removed and the exons are joined in a definite order to form mRNA. V

5. The hnRNA undergoes two additional processes called ‘capping’ and ‘tailing’.

6. In capping, methyl guanosine triphosphate is added to the 5 ‘ end of hnRNA.

7. In tailing, adenylate residues (about 200-300) are added at the 3’ end of hnRNA.

8. The fully processed hnRNA is called mRNA and is released from the nucleus into the cytoplasm.

Question 11.
List any four salient features of human genome project.
Antworten:

  1. The human genome contains 3164.7 million nucleotide bases.
  2. The average gene consists of 3000 bases.
  3. The largest known human gene being dystrophin at 2.4 million bases.
  4. The total number of gene is estimated at 30,000.
    99.9 percent nucleotide base sequences are same in all the people.
  5. The function of 50% genes discovered is still unknown.
  6. Less than 2 percent of the genome, codes for proteins.
  7. Repeated sequences make up very large portion of hurpan genome.
  8. Chromosome I has the most genes (2968) and Y has the fewest (231).
  9. It is identified about 1.4 million locations where single-base DNA differences (SNPs – single nucleotide polymorphism) occur in humans.

Question 12.
Represent diagrammatically hershey-Chase experiment. What did this experiment prove?
Antworten:
1. The proof for DNA as the genetic material came from the experiments of Alfred Hershey and Martha Chase (1952), who worked with bacteriophages.

2. The bacteriophage on infection injects only the DNA into the bacterial cell and not the protein coat the bacterial cell treats the viral DNA as its own and subsequently manufactures more virus particles.

3. They made two different preparations of the phage in one, the DNA was made radioactive with 32P and in the other, the protein coat was made radioactive with 35S.

4. These two phage preparations were allowed to infect the bacterial cells separately.

5. Soon after infection, the cultures were gently agitated in a blender to separate the adhering protein coats of the virus from the bacterial cells.

6. The culture was also centrifuged to separate the viral coat and the bacterial cells.

7. It was found that when the phage containing radioactive DNA was used to infect the bacteria, its radioactivity was found in the bacterial cells (in the sediment) indicating that the DNA has been injected into the bacterial cell.

8. So, DNA is the genetic material and not proteins.

Question 13.
Draw the schematic structure and explain the different regions of a transcription unit.
Antworten:
Transcription Unit
A transcription unit in DNA is defined primarily by the three regions in the DNA:

There is a convention in defining the two strands of the DNA in the structural gene of a transcription, unit. Since the two strands have opposite polarity and the DNA-dependent RNA polymerase also catalyse the polymerisation in only one direction, that is 5′ → 3′, the strand that has the polarity 3′ → 5′ acts as a template, and is also referred to as template strand.

The other strand which has the polarity ( 5’ → 3′) and the sequence same as RNA (except thymine at the place of uraciil), is displaced through transcription. Strangely, this strand (which does not code for anything) is referred to as coding strand. All the reference point while defining a transcription unit is made with coding strand. To explain the point, a hypothetical sequence from a transcription unit is represented below:
3′ -ATGCATGCATGCATGCATGCATGC-5′ Template Strand
5′ – TACGTACGTACGTACGTACGTACG-3′ Coding Strand
Can you now write the sequence of RNA transribed from the above DNA?

The promoter and terminator flank the structural gene in a transcription unit. The promoter is said to be located towards 5′ – end (upstream) of the structural gene (the reference is made with respect to the polarity of coding strand). It is a DNA sequence that provides binding site for RNA polymerase, and it is the presence of a promoter in a transcription unit that also defines the template and coding strands.

By switching its position with terminator, the definition of coding and template strands could be reversed. The terminator is located towards 3′ – end (downstream) of the coding strand and it usually defines the end of the process of transcription. (Fig). There are additional regulatory sequences that may be present further upstream or downstream to the promoter.

Question 14.
Explain the different steps involved in translation.
Antworten:
The process of translation of nucleotide language of mRNA into amino acid language by tRNA is called translation. This process occurs in the cytoplasm of the cell both in prokaryotes and eukaryotes. The process of translation involves the following steps.

  1. Activation of aminoacids
  2. Initiation of polypeptide chain.
  3. Elongation of polypeptide chain.
  4. Termination of polypeptide chain.

1. Activation of aminoacids: Amino acids are present in the cytoplasm and are in inactive form These are combined with ATP in presence of an enzyme aminoacyl synthetase and Mg++ ions : forming activated aminoacid.

This activated amino acid then combines with 3 end of tRNA forming aminoacyl-tRNA complex , or charged RNA and AMP is released.

2. Initiation of polypeptide chain: In this process, mRNA gets attached to 30s ribosomal subunit. Now the tRNA carrying activated aminoacid, methioninp gets attached to the first codon of mRNA. It takes place in presence of GTP and initiation factors [IF1, IF2, IF3]. This is the initiation complex. Now 50s ribosomal sub-unit combines with 30s ribosomal unit forming 70s ribosome. The first tRNA-aminoacid complex is now at ‘P’ site of ribosome.

3. Elongation of polypeptide chain: The ‘A’ site of 50s ribosome is now free and so the second tRNA with second activated aminoacid is get attached at ‘A’ site. A peptide bond is formed between 1 st and 2 nd aminoacid in presence of peptidyl transferase at ‘P’ site. Now the ribosome moves a distance of one codon so that the ‘A’site become vacant. Meanwhile the 3rd tRNA with 3 rd aminoacid gets attached to ‘A’ site. Again the ribosome moves on mRNA by one codon and bonding takes place between 2 nd and 3 rd aminoacid at ‘P’ site. 1st tRNA is released through ‘E’ site. This process continues till all the codons on mRNA are completely read. Thus polypeptide chain elongates along the mRNA.

4. Termination and release of polypeptide chain: The process of protein synthesis continues till the arrival of terminator codon on mRNA at.‘A’ site. The terminator codon may be UAA, UAG and UGA. These codons do not code for any aminoacids. During this process the enzyme peptidyl synthetase catalyses the cleavage of polypeptide chain from the last tRNA. Here releasing factors RF1, RF2, and RF3 are involved. Thus the polypeptide chain is finally released.

  • The speed of transcription is 30 nucleotides per second in bacteria.
  • The speed of translation 20 aminoacids per second in bacteria.

Question 15.
What is operon? With a diagram describe how is lac operon switched off and switched on.
Antworten:
Regulation of gene action is well studied in E.coli bacteria with regard to utilization of lactose by the bacteria. This is an example for inductive operon because, the gene expression is turned on by the addition of lactose [Inducer] into the medium.

Utilization of lactose in E.coli needs three enzymes namely P-galactosidase, p-galactoside permease and P-galactoside transacetylase. These are produced by z, y and a structural genes respectively in presence of RNA polymerase enzyme. This enzyme is bound to the promoter region of DNA. This enzyme has to move along the structural genes to initiate the synthesis of mRNA for these 3 enzymes.

The mechanism of Lac Operon can be studied under two steps namely.

1. Switched off Mechanism: When lactose is absent in the medium, the regulator gene produces repressor protein which binds with the operator gene. The repressor protein is an allosteric protein with 2 specific sites. One is active site with which it binds to operator gene and another is effecter site at which the lactose molecule can bind. Thus movement of RNA polymerase on the structural genes is blocked. So there is no synthesis of mRNA from the structural genes z,y and a. So there is no synthesis of enzymes. This is called Switched OFF mechanism.

2. Switched on Mechanism: When lactose is added to the culture medium some of its molecules enter into the bacterial cell and one of them binds itself with repressor. It induces the repressor protein to undergo structural change and makes it inactive. This inactive repressor becomes detached from the operator region. Now the RNA polymerase moves along the


Transcription: Biology Notes on Transcription

Transcription is the process of copying genetic information from one strand of the DNA into RNA. In transcription, only a segment of DNA or only one out of the two stands is copied into RNA. Unlike replication, which once set in, the total length of DNA of organisms gets duplicated. In transcription only a segment of DNA or only one of the strands is copied into RNA.

Reasons why both the strand are not copied at the same time during transcription:

(i) If both the strands code for RNA, two complementary (different) RNA molecules and two different proteins would be formed hence, the genetic information transfer machinery would become complicated.

(ii) Since, the two RNA molecules produced would be complementary to each other, they would bind together to form a double-stranded RNA without carrying out translation.

A transcription unit in DNA is defined by three regions:

The two strands of DNA have opposite polarity and the enzyme DNA-dependent RNA polymerase catalyses the polymerisation in only one direction (5’→ 3′ direction), the other strand with 3′ → 5′ polarity acts as a template and is known as template strand. The strand with 5’→ 3′ polarity has the same sequence as RNA (except thymine at the place of uracil) is displaced during transcription and is known as coding strand.

(i) Promoter is a DNA sequence that provides binding site for RNA polymerase. It is located at 5′ end (upstream) of structural gene. Its presence defines the template and coding strands.

(ii) Structural gene in a transcription unit is flanked by the promoter and terminator. The definition of coding strand and template strand could be reversed by switching the positions of promoter and terminator.

(iii) Terminator is located at the 3′ end (downstream) of the coding strand. It defines the end of transcription process.

Transcription Unit and the Gene:

(i) Gene is the functional unit of inheritance. The DNA sequence coding for tRNA or rRNA molecule also define a gene.

(ii) Cistron is a segment of DNA that codes for a polypeptide.

(iii) In a transcription unit, the structural gene could be:

(a) Monocistronic (mostly in eukaryotes).

(b) Polycistronic (mostly in bacteria or prokaryotes).

(iv) Exons Monocistronic genes in eukaryotes have interrupted coding sequences or expressed sequences as that appear in mature or processed RNA called as exons. Introns or intervening sequences do not appear in mature or processed RNA. They only interrupt exons.

(v) The promoter and regulatory sequences of a structural gene also affect the inheritance of a character. That is why, sometimes the regulatory sequences are loosely defined as regulatory genes.


On which strand does the promoter sit? - Biologie

In genetics, a Promoter is a region of DNA that facilitates the transcription of a particular gene. Promoters are typically located near the genes they regulate, on the same strand and upstream .
Ganzer Artikel >>>

Learn Search Engine Marketing and SEO Tips & Advice from Professional SEOs
Ganzer Artikel >>>

Transcription start Seite? ˅. Die basale Promoter. An Analogy . Link to a discussion of how the DNA sequence of Promoter sites can be determined. .
Ganzer Artikel >>>

. Netpromoter.com is the official website for the Net Promoter Gemeinschaft. . Netz Promoter, NPS, and Net Promoter Score are trademarks of Satmetrix Systems, Inc. .
Ganzer Artikel >>>

Promoter n. One that promotes, especially an active supporter or advocate. . Promoter DNA by an activator protein binding to its own DNA binding Seite? ˅ nearby. .
Ganzer Artikel >>>

Bedeutung von Promoter Seite? ˅ as a legal term. Was macht Promoter Seite? ˅ mean in law? . Promoter (redirected from Promoter Seite? ˅) Also found in: Medical, .
Ganzer Artikel >>>

Willkommen zu Promoter Heaven PTC Site! Paid To Click Ads worth $1 to $5 . Copyright © 2008 Promoter Heaven PTC Site. Site By Premiere-PTC-Network .
Ganzer Artikel >>>

Platinum KeyWords will help you optimize your web Seite? ˅ and get more visitors. . Platinum keywords is a very valuable tool for web Seite? ˅ promotion .
Ganzer Artikel >>>

My-Easy-Promoter automates your website submissions with the scheduler, meta tag utitlity, link checker, html validator, ranking utility and more!
Ganzer Artikel >>>

MySpace profile for DJ KENDO DJ/Veranstalter Seite? ˅ only with pictures, videos, personal blog, interests, information about me and more
Ganzer Artikel >>>

The Best Site of Reggaeton on . Boston urban Promoter. Nationwide printing, graphic design, and . 185. Top Event Promoter Web Sites is powered by .
Ganzer Artikel >>>

New Neural Network Algorithms for Improved Eukaryotic Promoter Site Recognition . of the organization and sequence of the eukaryotic polymerase II Promoter Seite? ˅. .
Ganzer Artikel >>>

Promote your web Seite? ˅ to thousands of search engines, Free For All links pages, Classified Ads sites and Message Boards! Absolutely free! Quick and easy! .
Ganzer Artikel >>>

Encyclopedia article about Promoter Seite? ˅. Information about Promoter Seite? ˅ in the Columbia Encyclopedia, Computer Desktop Encyclopedia, computing dictionary.
Ganzer Artikel >>>

Easy Website Promoter, ie. Traffic Builder and WebSite Promotional Tools to help submit your Seite? ˅ and increase traffic and hits FAST!
Ganzer Artikel >>>

Promoter sites typically have a complex structure consisting of multiple . Earlier work on Promoter Seite? ˅ recognition, involved statistical studies of polymerase II .
Ganzer Artikel >>>

. surveys followed with interactive reporting web sites that allow dynamic viewing of survey results. . Netz Promoter® Events. Your browser does not support .
Ganzer Artikel >>>

. Seite? ˅ promotion and Search engine optimization with Internet marketing company Net Promoter. . Web Seite? ˅ Förderung. Nachrichten. Earn Cash. Order. About company .
Ganzer Artikel >>>

Web Seite? ˅ submission and Search Engine Optimization software - Page Promoter . Page Promoter will help you accomplish all principal Web Seite? ˅ promotion tasks in .
Ganzer Artikel >>>

Web Seite? ˅ promotion, internet marketing, search engine submission and Seite? ˅ submission software that drives guaranteed traffic to . addweb website Promoter 8.0 .
Ganzer Artikel >>>


Schau das Video: Dr. med. Babykickl hat sich die Lösung ergoogelt! (Juni 2022).


Bemerkungen:

  1. Azraff

    Sie die abstrakte Person

  2. Dudley

    Wunderbar, das sind sehr wertvolle Informationen

  3. Matteo

    Ich entschuldige mich, aber meiner Meinung nach haben Sie nicht Recht. Ich schlage vor, es zu diskutieren.

  4. Mordecai

    Bemerkenswerterweise ist es die lustige Antwort

  5. Yozshukora

    Sie machen einen Fehler. Lassen Sie uns darüber diskutieren.

  6. Kirklyn

    Meiner Meinung nach ist es wirklich, ich werde an der Diskussion teilnehmen. Gemeinsam können wir zu einer richtigen Antwort kommen.



Eine Nachricht schreiben