Information

Problem beim Auffinden der Sequenz der Taq-Polymerase

Problem beim Auffinden der Sequenz der Taq-Polymerase


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Wie ich weiß, kann Taq Polymerase in Thermus aquaticus gefunden werden, also suche ich nach der Proteinliste von Thermus aquaticus und habe diese: http://www.ncbi.nlm.nih.gov/genome/proteins/1724?project_id= 55053 . Nach dem Filtern nach 'Polymerase' fand ich eine Menge Protein namens Polymerase:

  • Proteinregion der DNA-Polymerase-Beta-Domäne
  • DNA-Polymerase I
  • DNA-Polymerase III, Alpha-Untereinheit
  • DNA-Polymerase III, Beta-Untereinheit
  • DNA-Polymerase III, Delta-Untereinheit
  • DNA-gerichtete DNA-Polymerase -…

Ich weiß nicht, was sie bedeuten und nach welchem ​​Protein suche ich?


Nachdem ich auf einen geklickt habe, habe ich die Sequenz nicht im A-T-G-X-Format:

URSPRUNG
1 msgvdallll gvelsraiit aysvyaivli lggflarlpt rweervealg gsfylagvil 61 wryyaggday dldlflrasg Mallvlprlv rvvlreyggg r

Was bedeutet es und wie kann man damit arbeiten?


Laut dem Papier hier ist "Taq Polymerase" die DNA Polymerase I aus Thermus aquaticus. (Das Papier enthält übrigens die komplette Sequenz des betreffenden Gens.)

Einen Proteinsequenzeintrag beim NCBI finden Sie hier. Dies zeigt die Sequenz der Aminosäuren im Protein, nicht die DNA-Sequenz des Gens. Mehrere Zeilen von oben sehen Sie:

DBSOURCE-Locus TTHDNAP-Zugang D32013.1

wobei das letzte Wort als Link markiert ist. Folgen Sie diesem Link zur DNA-Sequenz. Dieser Eintrag enthält die Zeile:

CDS 1… 2499

was Ihnen sagt, dass sich das Initiator-ATG des Gens direkt am Anfang der gezeigten Sequenz befindet, dass die 3026 bp-Sequenz jedoch viel nachgeschaltete DNA enthält. Wenn Sie in dieser Zeile auf CDS klicken, wird die kodierende Sequenz in der DNA hervorgehoben.

Ein sehr flüchtiger Vergleich dieser Sequenz mit derjenigen in dem Artikel, auf den ich verlinkt habe, legt nahe, dass es sich um das gleiche Gen handelt.


Vielen Dank Alan Boyd, unten ist die Antwort für diese Proteincode-Mittel:

A Alanin P Prolin B Aspartat/Asparagin Q Glutamin C Cystin R Arginin D Aspartat S Serin E Glutamat T Threonin F Phenylalanin U Selenocystein G Glycin V Valin H Histidin W Tryptophan I Isoleucin Y Tyrosin K Lysin X . beliebiges Glutamat M * Translationsstopp N Asparagin - Lücke unbestimmter Länge

Quelle von NCBI: http://www.ncbi.nlm.nih.gov/BLAST/blastcgihelp.shtml


Alles, was Sie über Taq Polymerase wissen müssen

Taq-Polymerase ist eines der am weitesten verbreiteten Enzyme in der Molekularbiologie. Seit seiner Entdeckung im Jahr 1965 1 ist Taq zum Rückgrat der PCR und aller nachgelagerten Anwendungen geworden, die diese Technologie ermöglicht. Diese leistungsstarke Polymerase ist die Standardwahl für die meisten Amplifikations- und Klonierungsverfahren sowie diagnostische Tests, Markergen-DNA-Sequenzierung und vieles mehr.

Was macht Taq-Polymerase so besonders? Im heutigen Artikel werfen wir einen Blick auf die Vor- und Nachteile von Taq, was Sie brauchen, um die besten PCR-Ergebnisse mit der Taq-Polymerase zu erzielen, und einige Taq-Derivate, die Ihnen helfen können, bessere Ergebnisse für spezielle Anwendungen zu erzielen.


Xba I-Subklonierungsproblem - (26. Mai 2008 )

Hallo zusammen!
Ich habe versucht, ein PCR-Produkt in einen pBI121-Vektor zu klonieren, in XbaI-XhoI-Stellen, und ich habe positive Klone durch Kolonie-PCR gefunden. Ich habe Minipreps gemacht und diese Klone mit verschiedenen RE-Aufschlüssen, mit internen und externen Restriktionsseiten überprüft, und in allen Fällen hatte ich schöne Banden mit der richtigen Größe. außer als ich versuchte, Whit XbaI wieder zu verdauen!!!
Ich habe alles versucht, ich habe erneut eine Ligation und Transformation durchgeführt, mit einem neuen PCR-Produkt, das mit einem neuen XbaI verdaut wurde. Ich habe TOPO, pBluescript, pUC verwendet. immer habe ich das gleiche Ergebnis: Kolonie-PCR-positive, Miniprepr-RE-Verdau-positive. außer Pfingstmontag Xba. Die Seite ist weg! Ich weiß nicht was ich tun kann! Ich werde diese Klone sequenzieren, aber im Moment kann ich keine logische Erklärung finden!
Kann mir jemand helfen. Ich werde sehr dankbar sein!

welchen Bakterienstamm verwendest du? In einigen Einstellungen wird die XbaI-Stelle methyliert (wenn ihr TC folgt). Dies würde also erklären, warum Sie Ihr Plasmid nicht mit XbaI schneiden können, selbst wenn Sie Ihr (unmethyliertes) PCR-Produkt leicht schneiden könnten

GATC-Sequenzen in dam+ E. coli-Stämmen sind am Adenin methyliert. Diese Methylierung hemmt das Schneiden durch XbaI, wenn es die Stelle überlappt. Also, Seiten mit Sequenz . gaTCTAGA. oder Sequenz. TCTAGAtc. wird nicht schneiden.

Hallo, dieses Problem kann durch ein einzigartiges Merkmal der Sequenz, es kann dazu neigen, Nebel durch die Taq-Polymerase einzuführen. Sie können Hight-Fidelity-Polymerase wie Pfu ausprobieren. Ich schlage vor, dass Sie Primer mit XbaI-Stelle auf dem 5-Überhang entworfen haben. Sie können andere Primer mit längeren specer6bp hinter der Restriktionsstelle verwenden
Viel Glück
Hallo zusammen

Hallo, ich habe eine andere Erklärung, Girl next lab hat ein ähnliches Problem, sie hat ein geklontes pcr-Produkt sequenziert und herausgefunden, dass die Primer verwechselt wurden, es gab einen Fehler in den Primern. Die Firma hat schlechte Grundierungen geliefert
Bitte wiederholen Sie die Ergebnisse, an denen ich interessiert bin

Baxa, ich denke, mein Problem wird mit einem Stammdamm gelöst werden, aber wir hatten auch Probleme mit schlechten Primern. In diesen Fällen hat das Unternehmen dies erneut kostenlos getan. Wenn ich dir bei irgendetwas helfen kann, sag es mir einfach. Und danke auch für deine Antworten!

VIELEN DANK!!!!Sie haben mein Problem gelöst! Ich habe einen Primer mit der Sequenz TCTAGAtc verwendet. in einem DH5-alfa E. coli-Stamm!
DANKE!!!!


Materialen und Methoden

Konstruktion rekombinanter Plasmide

Eine Nukleotidsequenz der Thermus aquaticus Gen, das ein Stoffel-Fragment des Taq DNA-Polymerase wurde aus der GenBank-Datenbank (Zugangsnummer J04639.1) erhalten. Die T. Wassermann Stamm (ATCC25104) wurde verwendet, um eine genomische DNA zu isolieren, die dann als Matrize verwendet wurde, um a . zu amplifizieren taq Stoffel-Fragment-Gen unter Verwendung des Standard-PCR-Amplifikationsprotokolls mit einer Hypernova-DNA-Polymerase (BLIRT SA, Gdansk, Polen). Ein DNA-Fragment des taq Stoffel entsprechend den Nukleotiden 997 bis 2626 wurde in PCR unter Verwendung der Primer erhalten: F 5’ AATTTTGTTTAACTTTAAGAAGGAGATATACATATG GCCCTGGAGGAGGCCCC (vorwärts) und R 5’ GCAAGCTTGTCGACGGAGCTCGAATTCGGATCCTTAatggtggtggtggtggtg CTCCTTGGCGGAGAGCCAG (rückwärts). Die Primer enthielten Sequenzen, die komplementär zu den taq Stoffel-Gen (unterstrichen), eine zum pET-30 Ek/LIC-Vektor komplementäre Sequenz (kursiv) und eine Oligohistidin-Tag-Sequenz (Kleinbuchstaben). Ein Stopcodon (TTA) wurde dem reversen Primer unmittelbar nach der Oligohistidinsequenz hinzugefügt. Nach der Amplifikation wurde das PCR-Produkt (1703 bp) mit der DNA des pET-30 Ek/LIC-Vektors (Novagen, Madison, WI, USA) vermischt, der durch BamHallo und NdeI Enzyme (NEB, UK) und anschließend wurde die Mischung in einem Klonierungsexperiment verwendet, bei dem das OverLap Assembly Kit verwendet wurde (A&A Biotechnology, Polen). Die E. coli TOP10 (Invitrogen, USA) Zellen wurden mit Hilfe eines Klonierungsgemisches transformiert und mehrere Kolonien wurden auf das Vorhandensein eines rekombinanten Plasmids unter Verwendung eines Gelretardationsassays und der Restriktionsanalyse untersucht.

Fusion mit a NeqSSB-ähnlich Gen am N-terminalen Ende von a taq Das Stoffel-Fragment, das den Nukleotiden 997 bis 2626 entspricht, wurde in PCR unter Verwendung der Primer erhalten: F1 5’ GAGAGGCCGATGGAGGGGTCGACATGATC GCCCTGGAGGAGGCCC (vorwärts) und R1 5’ GCAAGCTTGTCGACGGAGCTCGAATTCGGATCCTTAatggtggtggtggtggtg CTCCTTGGCGGAGAGCCAG (rückwärts). Die Primer enthielten Sequenzen, die komplementär zu den taq Stoffel-Gen (unterstrichen), eine zum pET-30 Ek/LIC-Vektor komplementäre Sequenz (kursiv), eine Sequenz für 6 Aminosäure-Linker-Reste (fett) und eine Oligohistidin-Tag-Sequenz (Kleinbuchstaben). Das Stopcodon (TTA) wurde dem reversen Primer unmittelbar nach der Oligohistidinsequenz hinzugefügt.

Die DNA des pBAD/NeqSSB-likeHT-Plasmids [13] wurde als Matrize für die Amplifikation des NeqSSB-ähnlich Gen unter Verwendung des Standard-PCR-Amplifikationsprotokolls. Der Vorwärtsprimer war F2 5’ ATTTTGTTTAACTTTAAGAAGGAGATATACATATG GATGAAGAGGAACTAATACAACTAATAATAGAAAAAACT (es enthielt eine Sequenz, die komplementär zum NeqSSB-ähnlich Gen (unterstrichen) und eine zum pET-30 Ek/LIC-Vektor komplementäre Sequenz (kursiv)), während der reverse Primer R2 5’ TCCTCCAGGGC . warGATCATGTCGACCCCTCC ATCGGCCTCTCCTTTAAAAGCTTTTA (es enthielt eine Sequenz, die komplementär zum NeqSSB-ähnlich Gen (unterstrichen) und eine Sequenz für 6 Aminosäure-Linker-Reste (fett gedruckt). Als Ergebnis der PCR-Amplifikation wurden die folgenden zwei Produkte erhalten: a taq Stoffel-Gen (1703 bp) und a NeqSSB-ähnlich Gen (793 bp). Anschließend wurden die PCR-Produkte mit der DNA des pET-30 Ek/LIC-Vektors (Novagen, Madison, WI, USA) vermischt, die durch BamHallo und NdeI Enzyme (NEB, UK) und die resultierende Mischung wurde in einem Klonierungsexperiment verwendet, in dem das OverLap Assembly Kit verwendet wurde (A&A Biotechnology, Polen). Das Klonschema der Fusion NeqSSB-TaqS Polymerase ist in S1 Abb.

E. coli TOP10 (Invitrogen, USA) Zellen wurden mit Hilfe des Klonierungsansatzes transformiert und mehrere Kolonien wurden mittels eines Gel-Retardations-Assays und der Restriktionsanalyse auf das Vorhandensein eines rekombinanten Plasmids untersucht. Das resultierende pET30/NeqSSB-TaqS-Plasmid enthielt ein vollständiges NeqSSB-ähnliche Sequenz, ein 6-Aminosäuren-Linker (GGVDMI), eine Sequenz des Taq Stoffel-DNA-Polymerase (Aminosäurereste von 317 bis 832) und als His-Tag-Domäne, die die Reinigung des rekombinanten Proteins unter Verwendung der Metallaffinitätschromatographie ermöglicht.

Die Nukleotidsequenzen der resultierenden rekombinanten Plasmide pET30/TaqS und pET30/NeqSSB-TaqS wurden durch DNA-Sequenzierung (Genomed, Polen) bestätigt.

Expression und Reinigung von TaqS- und NeqSSB-TaqS-DNA-Polymerasen

Die Plasmide pET30/TaqS und pET30/NeqSSB-TaqS wurden in die E. coli BL21 (DE3) RIL (Novagen, USA). Die Zellen mit einem rekombinanten Plasmid wurden bis zu einem OD . gezüchtet600 von 0,4 in Luria-Bertani-Medium bei 37 °C unter Zugabe von Kanamycin und Chloramphenicol in einer Konzentration von jeweils 50 µg/ml und wurden durch IPTG bei einer Endkonzentration von 1 mM für 24 h induziert. Die Zellen wurden bei 5000x . zentrifugiertg für 12 min und die Pellets wurden in 20 ml Puffer A (50 mM Tris-HCl pH 9, 0,5 M NaCl und 5 mM Imidazol) resuspendiert. Die Proben wurden fünfmal 45 s lang bei 4 °C desintegriert und bei 10000x . zentrifugiertg für 15min. Der Überstand wurde 15 min bei 70 °C hitzebehandelt und die denaturierten Wirtsproteine ​​wurden durch Zentrifugation entfernt. Anschließend wurde das Protein in einem einstufigen Verfahren gereinigt. Wir verwendeten die Ni 2+ -Affinitätschromatographietechnik. Der Überstand und das produzierte Enzym wurden auf eine His•Bind-Säule (Novagen, USA) gegeben, die zuvor hergestellt und mit Puffer A äquilibriert wurde. Die rekombinanten Proteine ​​wurden zweimal mit Waschpuffer B (50 mM Tris-HCl&sub2; pH 9, 0,5 M NaCl und 40 mM Imidazol) und dann mit dem Elutionspuffer C (50 mM Tris-HCl pH 9, 0,5 M NaCl und 300 mM Imidazol) eluiert. Die eluierten Fraktionen wurden dreimal gegen Puffer D (100 mM Tris-HCl pH 8, 100 mM KCl, 0,2 mM EDTA) dialysiert. Die Spurenmengen der genomischen Bakterien-DNA wurden mit 25 U Benzonase (Merck, Darmstadt, Deutschland) und MgCl&sub2;2 bei der Endkonzentration von 5 mM. Anschließend wurde die Proteinprobe 1 h bei 37 °C inkubiert. Das Enzym wurde durch 15-minütige Inkubation bei 70ºC inaktiviert, während die denaturierten Proteine ​​durch Zentrifugation entfernt wurden. Die endgültige Formulierung wurde für die Lagerung vorbereitet (50 mM Tris-HCl pH 8, 50 mM KCl, 1 mM DTT, 0,1 mM EDTA, 1 % Tween 20, 1 % Nonidet P-40 und 50 % Glycerin).

DNA-Polymerase-Aktivitätsassay

Wie im EvaEZ Fluorometric Polymerase Activity Assay Kit Manual (Biotium, Hayward, USA) angegeben, wurde die DNA-Polymeraseaktivität in einer isothermen Reaktion bei 72 °C unter Verwendung des MyGo/Pro Real-Time PCR-Instruments (IT-IS International Ltd., UK) gemäß der Definition einer Einheit Enzymaktivität („Eine Einheit der DNA-Polymeraseaktivität ist herkömmlicherweise definiert als die Enzymmenge, die während einer 30-minütigen Inkubation 10 nmol Nukleotide einbaut“ [14]). Die aktive DNA-Polymerase verlängerte den Primer zu einem doppelsträngigen Produkt, das in der Lage ist, den EvaGreen-Farbstoff zu binden, was die Fluoreszenz erhöht. Das Fluoreszenzniveau wurde mit der Polymeraseaktivität und der Zahl der gebundenen Nukleotide korreliert [14–16]. Die Tätigkeit wurde in Bezug auf einen Werbespot ermittelt Taq DNA-Polymerase (Thermo Scientific, USA) mit einer Aktivität von 1 U/μl.

Optimierung der PCR-Amplifikation

Wir haben die Arbeitsbedingungen optimiert für NeqSSB-TaqS DNA-Polymerasen. Die Reaktionen wurden unter Verwendung verschiedener Pufferzusammensetzungen mit verschiedenen pH-Werten durchgeführt, die verschiedene Konzentrationen von MgCl&sub2;2, KCl und (NH4)2SO4. In all diesen Reaktionen verwendeten wir 1 mM von jedem dNTP, 0,4 mM von jedem Primer und eine Miniprep-Plasmid-DNA als PCR-Matrize mit einer einzigartigen bekannten Zielsequenz und Größe (PCR-Produkt von 300 bp). Die PCR wurde unter Verwendung von 1 U des gereinigten durchgeführt NeqSSB-TaqS DNA-Polymerase oder TaqS DNA-Polymerase in 20 µl des Reaktionsgemisches mit 5 ng einer DNA-Matrize. Die PCR wurde wie folgt durchgeführt: eine anfängliche Denaturierung bei 94 °C für 1 min 25 Denaturierungszyklen bei 94 °C für 15 s, Annealing bei 55 °C für 15 s und Verlängerung bei 72 °C für 15 s. Nach dem letzten Zyklus wurde die Probe 5 min bei 72 °C inkubiert.

Um das optimale MgCl . zu bestimmen2 Konzentration wurde die PCR bei steigenden Konzentrationen von MgCl . durchgeführt2 (0–9 mM) unter Verwendung eines Tris-HCl-Puffers. Weiterhin wurde die PCR mit verschiedenen Konzentrationen von KCl und (NH4)2SO4 (10–90 mM) für verschiedene pH-Werte im Bereich von 7,0 bis 9,0 für einen Tris-HCl-Puffer (pH-Werte wurden bei einer Temperatur von 25°C gemessen).

Die Thermostabilität wurde wie von Dabrowski und Kur [17] beschrieben getestet. Das gereinigte NeqSSB-TaqS und TaqS-DNA-Polymerasen wurden 1, 5, 10, 20, 40 und 60 Minuten auf 95 °C und 99 °C erhitzt.

In all unseren Experimenten amplifizierten wir ein 300 bp-Zielfragment in einer PCR unter Verwendung der gleichen Menge des Enzyms unter optimalen Bedingungen. Wir trugen 10 ul jedes PCR-Produkts zur Visualisierung durch Agarosegelelektrophorese auf. Die relative Aktivität der Polymerase wurde durch Densitometrie unter Verwendung des Programms GelAnalyzer 2010a (http://www.gelanalyzer.com/) bewertet. Das Programm maß die Fläche unterhalb des Peaks, der die Intensität des von der Bande auf dem Gel emittierten Lichts darstellt. Der Peak des größten Feldes (die höchste optische Dichte) repräsentiert eine 100 % Polymeraseaktivität. Peaks mit kleineren Feldern (weniger intensives Licht) wurden mit dem größten Peak verglichen und ihre Aktivität als Prozentsatz dieses Wertes bestimmt.

PCR-Amplifikationsraten-Assay

Die PCR-Amplifikationsrate wurde nach einigen Modifikationen unter Verwendung des von Lee et al. [11]. Wir verwendeten die DNA eines pET 30-Plasmids mit den bekannten Zielsequenzen als Matrize für die PCR, um die Produkte mit einer Länge von 300, 500 und 1000 bp zu erhalten.

Die Amplifikation erfolgte mit NeqSSB-TaqS und TaqS DNA-Polymerasen unter den optimalen Bedingungen für eine PCR. Jede PCR umfasste die anfängliche Denaturierung bei 94 °C für 2 min und 25 Zyklen bei 94 °C für 15 s, bei 55 °C für 15 s und bei 72 °C für 5, 10, 15,…60 s. Die PCR-Produkte wurden unter Verwendung des Standard-1%-Agarose-Gels einer Elektrophorese unterzogen.

Prozessivitätsanalyse

Der Prozessivitätstest wurde nach einigen Modifikationen wie in [18] beschrieben durchgeführt. 85 µl 20 mM Tris-HCl pH 8,3, 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, 290 μM von jedem der vier dNTPs, 40 nM Primer-Template ( 5′-GGGGATCCTCTAGAGTCGACCTGC und 5' TATCGGTCCATGAGACAAGCTTGCTTGCCAGCAGGTCGACTCTAGAGGATCCCC ), 3 μl EvaGreen Fluorescent DNA-Färbung (Jena, Germany Bioscience) U der getesteten Polymerase wurden 5 min bei 50°C vorinkubiert. Die Reaktionen wurden durch gleichzeitige Zugabe von 7,5 µl 50 mM MgCl . ausgelöst2 und 7,5 &mgr;l einer 0,6 mg/&mgr;l Heparinfalle, und die Polymerisation wurde bei 72°C ablaufen gelassen. Nach 0, 1, 2, 5 und 10 min wurden Aliquots (10 µl) entnommen, um den Thermoblock (4 °C) abzukühlen, und die Längen der verlängerten Produkte wurden durch einen Schmelzpunkt unter Verwendung einer MyGo/PRO Real-time PCR . bestimmt (IT-IS International Ltd., GB). Die Reaktion umfasste die folgenden Phasen: ein Vorschmelzen für 10 s bei 95 °C (eine Anstiegsrate von 5 °C/s), die anfängliche 60-Sekunden-Phase bei 60 °C (eine Anstiegsrate von 4 °C/s). s) und die letzte 1-Sekunden-Stufe bei 97 °C (eine Anstiegsrate von 0,201 °C/s). Die Prozessivität wurde durch Vergleich der Schmelztemperaturprofile von Produkten unterschiedlicher Länge, die als Marker dienten, bestimmt. Das Markerprodukt wurde in einer PCR unter Verwendung des gleichen Primers wie oben beschrieben und der synthetischen Matrizen erhalten, die die Bildung von Produkten mit einer Länge ermöglichten, die die Länge des Primers um 1, 2, 3 bis zu 20 nt überstieg.

Primer-Schablonen-Bindung

Die Bindung von Polymerasen an das Primer-Template ( 5'-CTTCATTACACCTGCAGCTCT und 5'-CACAGCCCTGTCCCTCTTCTTC ) erfolgte bei verschiedenen Annealing-Temperaturen im Bereich von optimalen 55 °C bis 72 °C, bei Verwendung von Primern für die PCR-Amplifikation eines humanen CCR5-Gen [19].

Resistenz gegen Inhibitoren

Die Wirkung von PCR-Inhibitoren wie 0,84 µg bis 54 µg Lactoferrin (Sigma-Aldrich, St. Louis, USA), 4,7 ng bis 600 ng Heparin (Sigma-Aldrich, St. Louis, USA) und Humanblut (aus ein gesunder Freiwilliger) in Konzentrationen von 0,15 % bis 10 % auf die katalytische Aktivität von NeqSSB-TaqS und TaqS-DNA-Polymerasen wurden in einer PCR unter Verwendung der genomischen DNA von Staphylococcus aureus als Template und Primer für die spezifischen nuc Gen [20].

Darüber hinaus wurde die Resistenz gegen im menschlichen Vollblut vorhandene Inhibitoren unter Verwendung von Primern für die Amplifikation des humanen CCR5-Gens [19] ohne Zugabe von Templates getestet. PCRs wurden wie von Kermekchiev et al. [21] unter Zugabe von Blut zur Mischung (in Konzentrationen von 0,15 % bis 10 %).

DNA-Bindungspräferenzen

Um die Fähigkeit von DNA-Polymerasen zu demonstrieren, verschiedene DNA-Typen (ssDNA und dsDNA) zu binden, und ihre Präferenzen für die Bindung von einzel- oder doppelsträngiger DNA zu demonstrieren, führten wir den elektrophoretischen Mobilitäts-Shift-Assay-Test der Polymerase-DNA-Komplexe durch. Der Test wurde mit Fluorescein-markierten Oligonukleotiden (dT) durchgeführt. 76 am 5'-Ende und ein PCR-Produkt mit einer Länge von 100 bp, wie in der von Olszewski et al. 2015 [13]. Die Ausgangsprodukte wurden mit einem 2% Agarosegel Ethidiumbromid im UV-Licht analysiert.


High Fidelity DNA Polymerase: Wie viele Mutationen pro kb amplifizierter DNA o - (17.10.2005)

Ich habe neulich mit meinem Kollegen über neue Tricks beim Klonen gesprochen und was er mir erzählt hat, war wirklich erstaunlich:

Bei der Herstellung eines transgenen Mausmodells führte er eine PCR mit einem 2-kb-DNA-Fragment mit High Fidelity Taq Polymerase (Roche) durch, um es in seiner Klonierungsstrategie zu verwenden. später sequenzierte er das amplifizierte Produkt, um KEINE MUTATIONEN zu finden.

Ich denke, es ist ein schönes Thema für das Forum:

Wie weit kann man mit High-Fidelity-DNA-Polymerase gehen? Hat jemand Erfahrung mit der zuverlässigen Amplifikation von 3 kb Fragmenten? 4kb?

Ich habe PCR-Produkte von 3 oder 4 kb viele Male ohne Fehler unter Verwendung von High-Fidelity-Polymerase kloniert und sequenziert.

Hi
Ich habe einen Klon von 13 kb sequenziert und nur eine Mutation ist aufgetreten.
Übrigens, pol ist jetzt Korrekturleser und Sie können leicht 5kb ohne Fehler erwarten.

Ich habe dieselbe Polymerase für eine 2,2-kb-Amplifikation verwendet. 2 Klone überprüft, 1 hatte eine Mutation, der andere nicht. Es ist also Glückssache bei der Auswahl der Klone.

das ist wirklich cool, 3-4 kb und keine Mutationen. wir reden über DNA-Polymerase von Roche, oder? Es würde mir beim Klonen sehr helfen. Ich würde lieber eine Reihe von Klonen seqieren, anstatt Zeit mit den zeitlosen RDs und Gelisolierungen zu verschwenden.

Mit "von Roche" meinen Sie bei ihnen gekauft oder Taq-basierend? Ich habe die HiFi-Polymerase von Invtrogen verwendet (siehe hier), aber es ist eine Mischung aus Taq und ein weiteres Enzym.

Jede der thermostabilen Hi-Fi-Polymerasen (z. Pfu von Pyrococcus furiosus, Vent (auch bekannt als Tli) von Thermococcus litoralis, usw.) sollte gut funktionieren.

Mit "von Roche" meinen Sie bei ihnen gekauft oder Taq-basierend? Ich habe die HiFi-Polymerase von Invtrogen verwendet (siehe hier), aber es ist eine Mischung aus Taq und ein weiteres Enzym.

Jede der thermostabilen Hi-Fi-Polymerasen (z. Pfu von Pyrococcus furiosus, Vent (auch bekannt als Tli) von Thermococcus litoralis, usw.) sollte gut funktionieren.

Ich meine das Expand High Fidelity PCR System, Cat # 1 732 641, das von Roche Applied Science verkauft wird. Es besteht aus einer Enzymmischung, die thermostabile Taq-DNA-Polymerase und Tgo-DNA-Polymerase enthält. Sie erwähnen, dass dieses System DNA-Fragmente bis zu 5 KB effizient amplifizieren kann. Andererseits sagen sie kein Wort über die Anzahl möglicher Mutationen, wenn man ein solches Fragment amplifiziert.

Die meisten Hifi-Enzyme sind in der Tat Mischungen aus Taq und einer Korrektur-Polymerase (wie Tgo). Sie haben eine höhere Wiedergabetreue als Taq und sind gut darin, längere Fragmente zu amplifizieren.

Diese Mischungen haben jedoch eine geringere Wiedergabetreue als reine Korrekturleseenzyme, wie die erwähnten Homebrew. Aber selbst mit diesen Enzymen können Sie nie garantieren, dass Ihre Klone überhaupt keine Mutationen aufweisen. Sie sollten immer überprüfen, da keine Polymerase eine Null-Fehlerrate hat.

Ich denke, das Expand High Fidelity PCR System von Roche sollte für Sie gut funktionieren. Der Erfolg Ihres Klonens (Erfolg ist definiert als das Einfangen eines Klons ohne Sequenzfehler) hängt immer von den zwei sehr zutreffenden Punkten von vairus ab – dass keine Taq-Mischung so gut ist wie eine reine High-Fidelity-Polymerase, und dass es keine fehlersichere Polymerase (eine gute Sache für die Evolution, übrigens).

Sie sollten daher Ihre Klone sequenzieren, bevor Sie fortfahren, um sicherzustellen, dass Sie mit einer unveränderten Kopie der interessierenden DNA arbeiten.

Manchmal führe ich mehrere separate Transformationen durch und wähle Kolonien aus jeder aus, um sicherzustellen, dass jeder Klon durch ein separates Ereignis erzeugt wird und meine Klone somit keine Geschwister voneinander sind. Glücklicherweise habe ich bei dem Dutzend Mal, als ich Gene >3 kb mit PCR klonierte, nie einen Sequenzfehler gefunden.

Ich habe keine Probleme mit meinen 5-6kb Produkten mit Triple Master von Eppendorf. Soweit ich mich erinnere, hatte keiner meiner Klone bis heute Mutationen.
Clarice


Zelluläres Klonen

Einzellige Organismen, wie Bakterien und Hefen, produzieren auf natürliche Weise Klone von sich selbst, wenn sie sich durch binäre Spaltung, die als . bekannt ist, ungeschlechtlich replizieren zelluläres Klonen. Die Kern-DNA dupliziert sich durch den Prozess der Mitose, wodurch eine exakte Nachbildung des genetischen Materials entsteht.

Übungsfrage

Abbildung 1. Dieses Diagramm zeigt die Schritte beim molekularen Klonen.

Sie arbeiten in einem molekularbiologischen Labor und Ihr Laborpartner hat die fremde genomische DNA, die Sie klonen wollen, über Nacht auf dem Labortisch hinterlassen, ohne sie im Gefrierschrank zu lagern. Als Ergebnis wurde es durch Nukleasen abgebaut, aber immer noch im Experiment verwendet. Das Plasmid hingegen ist in Ordnung. Welche Ergebnisse würden Sie von Ihrem molekularen Klonierungsexperiment erwarten?

  1. Es gibt keine Kolonien auf der Bakterienplatte.
  2. Es wird nur blaue Kolonien geben.
  3. Es wird blaue und weiße Kolonien geben.
  4. Es werden nur weiße Kolonien sein.

Mutagenese

Um den Enzymen neue Eigenschaften zu verleihen, die in ihren nativen Gegenstücken nicht zu finden sind, werden sie Mutationen unterzogen, wobei sich der Punkt in einer Reihe von Gensequenzen ändert, die für das jeweilige Protein kodieren. Wissenschaftler nutzen solche Möglichkeiten der Genomveränderung und führen Mutationen durch einen spontanen oder gezielten Mutageneseprozess ein.

Um Enzymen mit neuen Eigenschaften zu versehen, die in den nativen Gegenstücken nicht zu finden sind, werden sie Mutationen unterzogen, Punktänderungen in einer Reihe von Gensequenzen, die für das jeweilige Protein kodieren. Wissenschaftler nutzen solche Möglichkeiten der Genomveränderung und führen Mutationen in einem spontanen oder gezielten Mutageneseprozess ein.

Die zufällige Mutagenese besteht in der Exposition des jeweiligen Mikroorganismus gegenüber der Wirkung physikalischer oder chemischer Mutagene, d. h. UV-Strahlung, verschiedene Arten von ionisierender Strahlung, Alkylierungsmittel usw. Zufallsmutationen können auch mit PCR-Techniken eingeführt werden. Unter diesen Methoden kann man die drei beliebtesten unterscheiden. Die erste davon ist das DNA-Shuffling, bei dem das DNase-Enzym verwendet wird, um die DNA zu schneiden, die das gegebene Protein kodiert, das einer Modifikation von zufälligen Fragmenten von 50 bis 100 bp unterzogen werden soll, und dann die PCR-Reaktion ohne Verwendung von Primern durchzuführen. Durch das Schneiden erhaltene DNA-Fragmente, die auf der Grundlage von Komplementaritätsprinzipien und DNA-Polymerase kombiniert wurden, füllen Lücken zwischen ihnen. Als Ergebnis einer solchen durchgeführten Reaktion entstehen Mutationen. Nach einigen Amplifikationszyklen entsteht ein modifiziertes Gen, das erneut einer PCR-Reaktion unterzogen wird, diesmal mit Primern, die das Ende des Gens des gegebenen Proteins definieren und es ermöglicht, es in den Expressionsvektor zu klonieren (Stemmer 1994). Eine andere Technik zum Erhalten einer Zufallsmutation ist die Verwendung von Mutatorstämmen. Dieses Verfahren besteht darin, das Gen, das einer Mutagenese unterzogen werden soll, in ein Plasmid zu klonieren. Dann eine Transformation in modifiziertes E coli Belastung durchgeführt wird, der eine oder wenige grundlegende DNA-Reparaturpfade beraubt wurden (mutS, mutD, oder Köter). Das Fehlen eines DNA-Reparatursystems führt während der Replikation zu Veränderungen des genetischen Materials, das in den Stamm eingetragen wird, wodurch das Zielgen zufällige Mutationen erfährt. Ein Nachteil dieser Methode ist, dass die modifizierte E coli Stamm verliert schnell seine Lebensfähigkeit, weil die Gene, die grundlegende Vitalfunktionen kodieren, auch Mutationen durchlaufen, die keine Reparaturpfade aufweisen, was zu zufälligen Veränderungen während der Genreplikation führt. Es ist auch möglich, die Technik der „fehleranfälligen PCR“ zu verwenden. Es besteht darin, DNA-Polymerase mit reduzierter Replikationstreue aufzutragen und in den Reaktionspuffer zu geben, der so moduliert ist, dass die Reaktion unspezifisch war. Das Enzym führt aufgrund seiner geringen Katalysespezifität Mutationen in neue DNA-Stränge ein. Die Kontrolle der Zusammensetzung in der Reaktionsmischung ermöglicht die Einstellung von Fehlerhäufigkeiten, die in neu synthetisierte DNA-Stränge eingetragen werden. Die Häufigkeit der durch DNA-Polymerase angeführten Mutationen beträgt etwa 1–3 Veränderungen auf 1 kbp (Hanson-Manful und Patrick 2013).

Gezielte Mutationen verwenden hauptsächlich PCR-Reaktionen, so dass Sequenzänderungen kontrolliert eingeleitet werden können. Bei solchen Techniken sind sowohl externe als auch interne modifizierte Primer anwendbar, die nicht-komplementäre Nukleotide zur Matrix aufweisen und auf diese Weise die gewünschte Mutation einführen (Reikofski und Tao 1992 Ho et al. 1989).

Techniken der gerichteten und zufälligen Mutagenese wurden bei der Herstellung von Polymerasen mit verbesserten nützlichen Eigenschaften in der Molekulardiagnostik und Gentechnik verwendet. Die gebräuchlichste Polymerase, die solchen Modifikationen unterzogen wird, ist die bekannteste und am häufigsten angewendete Taq Polymerase aus Thermus aquaticus. Mutationen, die zu Veränderungen der Replikationstreue der DNA durch Polymerase führen, umfassen den hochkonservierten O-Helix-Bereich. Dies ist ein Bereich, der aus 12 Aminosäureresten von 659 bis 671 Aminosäuren besteht, der auch ein Teil des Raums ist, der das Enzym mit DNA und Nukleotiden zu einem neuen Strang bindet. Untersuchungen zeigen, dass Veränderungen in vier von 12 Aminosäureresten (Arg-659, Lys-663, Phe-667 und Tyr-671) zu einer signifikanten Verschlechterung der Replikationstreue um Taq DNA-Polymerase. Darüber hinaus führt eine Änderung von 667 Phe auf Tyr zu einer häufigeren Aktivierung von ddNTP zu neu synthetisierter strangförmiger DNA, was in Techniken der Sequenzierungsmethode von Sanger erwünscht ist (Suzuki et al. 1997, 2000). Die Gewinnung von Enzymen mit reduzierter Replikationstreue wird auch bei Mutagenesetechniken mit fehleranfälliger PCR angewendet, wo solche Polymerasen erwünscht sind.

In die Aminosäurereste Glu-742 und Ala-743 in der Subdomäne der Finger von . eingeführte Mutationen Taq DNA-Polymerase erweisen sich als sehr wichtig für die Affinität der Polymerase zur DNA-Matrix. Studien legen nahe, dass dies für die Dehnungsfähigkeit des Enzyms entscheidend ist. Die jeweils untersuchten Mutationsvarianten führten zu einer Erhöhung der DNA-Affinität und zu schneller verlängerten Primern im Vergleich zu einem Wildstamm. Mutationen in diesem Bereich stellen ein Potenzial dar, Polymerasen mit verbesserter Prozessivität, Produktivität und Reaktionsgeschwindigkeit zu erhalten (Yamagami et al. 2014).

Angesichts des zunehmenden Bedarfs, PCR-Reaktionen durchzuführen, wobei in der Reaktionsmischung viele Verbindungen enthalten sind, die Polymerase-Inhibitoren sind, wurde Forschung betrieben, um neue (mutierte) Polymerasen zu finden, die gegenüber ihrer Anwesenheit nicht empfindlich sind. Die ersten positiven Ergebnisse, die zur Einführung eines neuen Produkts führten, betrafen die Modifikation von Taq DNA-Polymerase. Viele Mutanten wurden getestet und unter den ausgewählten waren diejenigen mit dem höchsten Anwendungspotenzial. Sie zeichneten sich durch eine viel höhere Resistenz gegen im Blut enthaltene Inhibitoren in Bezug auf Wildproteine ​​aus und ermöglichten eine effiziente Aufnahme von Amplikons bei 20 % Blutkonzentration im Reaktionsansatz. In den Positionen 708 und 707 wurden Mutationen im Bereich der Zinkfinger durchgeführt. Mutationen in Position 708 sorgten für Resistenz gegenüber der Blutprobe. In dieser Position in der nativen Polymerase gefundene Glutaminsäure wurde gegen Valin, Lysin, Leucin und Tryptophan ausgetauscht (Kermekchiev et al. 2009).

Veränderungen der Aminosäurereste in 706, 707 und 708 können zur Bildung von heißstartenden Polymerasen führen. Ein Austausch von Tryptophan in Position 706 gegen Arginin, Isoleucin 707 gegen Leucin und Glutaminsäure 708 gegen Asparagin führt zu einer Abnahme der Proteinaktivität bei tiefen Temperaturen, was die Spezifität der PCR-Reaktion erhöht (Kermekchiev et al. 2009) .


  1. Wenn die Primer in der Lage sind, Dimere zu bilden, führt eine Erhöhung ihrer Konzentration nur zur Bildung von Primer-Dimeren und verbessert nicht die Amplifikation des gewünschten PCR-Produkts. Von Primern abgeleitete Oligomere werden möglicherweise die Reaktion verunreinigen.
  2. Wenn die Primer keine Primer-Dimere bilden, führt eine Erhöhung der Primerkonzentration wahrscheinlich zu einer unspezifischen Primerbindung und zur Bildung von unechten, unerwünschten PCR-Produkten.

Um jedoch kurze PCR-Zielsequenzen zu amplifizieren, ist eine sorgfältige Berechnung der optimalen Primerkonzentration erforderlich. Wenn die Länge des Zielfragments beispielsweise 100 bp beträgt, ist eine größere Anzahl von PCR-Produktmolekülen erforderlich, um eine bestimmte Menge amplifizierter DNA (in Nanogramm) bereitzustellen, als für ein größeres Zielfragment. Um die erforderliche Anzahl von PCR-Produktmolekülen zu erzeugen, kann eine größere Anzahl von Primern benötigt werden. Daher kann eine Konzentration von Primern von mehr als 1 &mgr;M für kurze Zielsequenzen notwendig und wünschenswert sein.


Yellowstone-Nationalpark – Geburtsort von Taq

Ich war noch nie im Yellowstone-Nationalpark, aber er steht auf meiner Liste der Orte, die ich besuchen möchte, nicht nur wegen der wunderschönen Landschaft und der spektakulären heißen Quellen und Geysire, sondern auch, weil er der Ursprungsort eines der berühmtesten Moleküle ist in der Molekularbiologie.

Thomas Brock ist ein Biologe im Ruhestand, der seine Karriere Anfang der 1950er Jahre als Mikrobiologe begann. Er zog die Natur dem Labor vor, also suchte er nach Möglichkeiten für mehr ökologische Studien und startete 1963 ein Programm, das sich auf die Untersuchung von Mikroben konzentrierte, die in Geysiren und heißen Quellen leben. Diese Pools wurden als natürlich vorkommende Steady-State-Ökosysteme angesehen. Sort of like a controlled lab setting, but outdoors. Brock hoped that organisms the hot water pools would allow him to better understand the physiological limits of photosynthesis, but he soon made a much more interesting discovery.

Brock took samples from springs at different temperatures, and found many more microbes than he originally thought possible. Some of them even lived at temperatures higher than 73°C, which was at the time thought to be the upper limit for life. One of the sites he studied was a spring in the Lower Geyser Basin, called Mushroom Spring. In October 1966, Brock isolated culture YT-1 of a new micro organism, from a sample he had collected in Mushroom Spring at a temperature of 73°C on September 5th. He initially called his new discovery Caldobacter trichogenes, but by the time the first article about the discovery was published, the name had already changed to Thermus aquaticus.

Together with other extremophiles that Brock found in Yellowstone, culture YT-1 was dutifully recorded, and sent to the American Type Culture Collection (ATCC) where it was made available for other scientists to study.

In 1983, Kary Mullis, a scientist working at Cetus Corporation in California, had an idea to optimise the process of replicating small DNA samples in vitro. He developed a technique called PCR, or polymerase chain reaction, which uses temperature changes to unravel double stranded DNA, and small primer DNA sequences together with an enzyme called DNA polymerase to generate new strands of DNA on each half of the unraveled strand. Unravel those newly formed DNA strands, and the process starts over, each round doubling the amount of DNA.

One problem with this new technique was the the high temperatures required to unravel DNA also damaged the DNA polymerase. Other Cetus researchers set out to find a polymerase that could survive at the high temperatures needed for PCR.

All organisms have their own DNA polymerase, but our human version, for example, is optimized for our body temperature of about 37°C, and doesn’t survive extremely high temperatures. But organisms that live at high temperatures must also have polymerases that can stand the heat, and this is what they were looking for.

The researchers from Cetus analysed several of the samples that Brock had collected and deposited with ATCC, until they found what they were after in sample YT-1 of Thermus aquaticus – or Taq for short.

The technology to rapidly replicate DNA samples using PCR with Taq polymerase revolutionised modern molecular biology and is an indispensable tool in forensics. Any research involving genetics, cloning, or identifying the function of new genes will at some point have involved the use of Taq polymerase. You’ve seen the technique in action in the fictional crime labs of Law and Order, CSI, and several other shows and movies. An advertisement for a PCR machine went viral online a few years ago. Taq polymerase was the molecule of the year in 1989, and Kary Mullis won the Nobel Prize in 1993 – but PCR would not have been possible without the bacteria that Thomas Brock isolated decades earlier from a hot spring in Yellowstone.

Taq polymerase was such a success, both scientifically and commercially, that National Parks changed its regulation about research on park grounds. They haven’t seen any money from the molecule that Mullis brought to fame, and are now working with agreements that state that benefits of any “bio-prospecting” on park grounds should be shared with National Parks.

And Brock? He didn’t get any money out of his discovery either, but he didn’t mind. As quoted in TIME magazine:

“Yellowstone didn’t get any money from it. I didn’t get any money, either, and I’m not complaining. The Taq culture was provided for public research use, and it has given great benefit to mankind.”


Now for the details on how DNA Sequencing works: DNA sequencing reactions are just like the PCR reactions for replicating DNA (refer to the previous page DNA Denaturation, Annealing and Replication). The reaction mix includes the template DNA, free nucleotides, an enzyme (usually a variant of Taq polymerase) and a 'primer' - a small piece of single-stranded DNA about 20-30 nt long that can hybridize to one strand of the template DNA.

MOST of the time when a 'T' is required to make the new strand, the enzyme will get a good one and there's no problem. MOST of the time after adding a T, the enzyme will go ahead and add more nucleotides. However, 5% of the time, the enzyme will get a dideoxy-T, and that strand can never again be elongated. It eventually breaks away from the enzyme, a dead end product.

Sooner or later ALL of the copies will get terminated by a T, but each time the enzyme makes a new strand, the place it gets stopped will be random. In millions of starts, there will be strands stopping at every possible T along the way.

Gel electrophoresis can be used to separate the fragments by size and measure them. In the cartoon at left, we depict the results of a sequencing reaction run in the presence of dideoxy-Cytidine (ddC).

Well, OK, it's not so easy reading just C's, as you perhaps saw in the last figure. The spacing between the bands isn't all that easy to figure out. Imagine, though, that we ran the reaction with *all four* of the dideoxy nucleotides (A, G, C and T) present, and with *different* fluorescent colors on each. NOW look at the gel we'd get (at left). The sequence of the DNA is rather obvious if you know the color codes . just read the colors from bottom to top: TGCGTCCA-(etc).

That's exactly what we do to sequence DNA, then - we run DNA replication reactions in a test tube, but in the presence of trace amounts of all four of the dideoxy terminator nucleotides. Electrophoresis is used to separate the resulting fragments by size and we can 'read' the sequence from it, as the colors march past in order.

In a large-scale sequencing lab, we use a machine to run the electrophoresis step and to monitor the different colors as they come out. Since about 2001, these machines - not surprisingly called automated DNA sequencers - have used 'capillary electrophoresis', where the fragments are piped through a tiny glass-fiber capillary during the electrophoresis step, and they come out the far end in size-order. There's an ultraviolet laser built into the machine that shoots through the liquid emerging from the end of the capillaries, checking for pulses of fluorescent colors to emerge. There might be as many as 96 samples moving through as many capillaries ('lanes') in the most common type of sequencer.

At left is a screen shot of a real fragment of sequencing gel (this one from an older model of sequencer, but the concepts are identical). The four colors red, green, blue and yellow each represent one of the four nucleotides.

We don't even have to 'read' the sequence from the gel - the computer does that for us! Below is an example of what the sequencer's computer shows us for one sample. This is a plot of the colors detected in one 'lane' of a gel (one sample), scanned from smallest fragments to largest. The computer even interprets the colors by printing the nucleotide sequence across the top of the plot. This is just a fragment of the entire file, which would span around 900 or so nucleotides of accurate sequence.

The sequencer also gives the operator a text file containing just the nucleotide sequence, without the color traces.

As you have seen, we can get the sequence of a fragment of DNA as long as 900 or so nucleotides. Groß! But what about longer pieces? The human genome is 3 *billion* bases long, arranged on 23 pairs of chromosomes. Our sequencing machine reads just a drop in the bucket compared to what we really need!

To do it, we break the entire genome up into manageable pieces and sequence them. There are two approaches currently in use:

  • The Publically-funded Human Genome Project: The National Institutes of Health and the National Science Foundation have funded the creation of 'libraries' of BAC clones. Each BAC carries a large piece of human genomic DNA on the order of 100-300 kb. All of these BACs overlap randomly, so that any one gene is probably on several different overlapping BACs. We can replicate those BACs as many times as necessary, so there's a virtually endless supply of the large human DNA fragment.

In the Publically-funded project, the BACs are subjected to shotgun sequencing (see below) to figure out their sequence. By sequencing all the BAC's, we know enough of the sequence in overlapping segments to reconstruct how the original chromosome sequence looks.

Imagine, for example that you have hundreds of 500-piece puzzles, each being assembled by a team of puzzle experts using puzzle-solving computers. Those puzzles are like BACs - smaller puzzles that make a big genome manageable. Now imagine that Celera throws all those puzzles together into one room and scrambles the pieces. They, however, have scanners that scan all the puzzle pieces and huge computers that figure out where they all go.

It is controversial still as to whether the Celera approach will succeed on a puzzle as large as the human genome. Whether it does or not, they have certainly stirred up the intellectual pot a bit.


Schau das Video: PCR Method Video (Juli 2022).


Bemerkungen:

  1. Nell

    Es gibt eine Website für die Frage, die Sie interessiert.

  2. Padruig

    All dies ist dynamisch und sehr positiv

  3. Mobar

    Was hier gut organisiert ist, ist Kriminalität. Unschuld ist ein Zustand, der mit Gefühlen tiefgreifender Befriedigung unvereinbar ist. Gibt es ein Leben auf dem Mars, gibt es ein Leben auf dem Mars, aber es gibt eine dicke, dicke Schicht Schokolade, die ich verstehe: mit einer Frau zu leben, aber mit demselben?! ... "Andere sind nicht besser" - die Inschrift auf dem Spiegel. Knochenbrüche schweben nicht! Liebe ist wie ein Feuer, du wirst keinen Stock werfen, es wird ausgehen.

  4. Gyasi

    Eine keine schlechte Frage

  5. Treasigh

    Sie haben ins Schwarze getroffen. Es scheint mir, es ist ein sehr ausgezeichneter Gedanke. Da stimme ich dir voll und ganz zu.

  6. Ichtaca

    Unter uns reden.



Eine Nachricht schreiben