Information

Welche Mechanismen sind für die Herunterregulierung oder den Verlust der MHC-1-Expression auf der Oberfläche von Krebszellen verantwortlich?

Welche Mechanismen sind für die Herunterregulierung oder den Verlust der MHC-1-Expression auf der Oberfläche von Krebszellen verantwortlich?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Es wird allgemein angenommen, dass die Herunterregulierung oder der Verlust der MHC-1-Expression auf der Oberfläche von Krebszellen am Mechanismus der Immunabwehr beteiligt ist. Es scheint sehr attraktiv zu sein, aber ich kenne die Mechanismen der Herunterregulierung oder des Verlusts von MHC-1 bei Krebszellen nicht. Würden Sie mir den molekularen Mechanismus verraten,


Es gibt keinen einzigen Mechanismus (wie zu erwarten, da es keine evolutionäre Beziehung zwischen den Krebsarten verschiedener Individuen gibt). Die häufigsten Mechanismen sind verschiedene Formen von Mutationen, die von Punktmutationen in einzelnen MHC-Molekülen bis hin zu großen Deletionen des MHC-Locus reichen. Auch Mutationen in Genen, die an der Antigenprozessierung beteiligt sind, die selbst nicht Teil des MHC-Locus sind (z. B. TAP, b2-Mikroglobulin), sind relativ häufig. Epigenetische Veränderungen sind ebenfalls keine Seltenheit. Es gibt mehrere relativ aktuelle Bewertungen, darunter


Grenzen in der Immunologie

Die Zugehörigkeiten der Herausgeber und Gutachter sind die neuesten Angaben in ihren Loop-Forschungsprofilen und spiegeln möglicherweise nicht ihre Situation zum Zeitpunkt der Überprüfung wider.


  • Artikel herunterladen
    • PDF Herunterladen
    • ReadCube
    • EPUB
    • XML (NLM)
    • Ergänzend
      Material
    • EndNote
    • Referenzmanager
    • Einfache TEXT-Datei
    • BibTex


    TEILEN EIN

    Arzneimittelresistenz bei Krebs: Mechanismen und Bekämpfungsstrategien

    Die Entwicklung einer Arzneimittelresistenz gegenüber der konventionellen Therapie ist einer der wichtigsten Gründe für das Versagen der Chemotherapie bei Krebs. Die verschiedenen zugrunde liegenden Mechanismen für die Entwicklung von Arzneimittelresistenzen bei Tumoren umfassen Tumorheterogenität, einige Veränderungen der Zellspiegel, genetische Faktoren und andere neue Mechanismen, die in den letzten Jahren hervorgehoben wurden. Im vorliegenden Szenario müssen sich die Forscher auf diese neuartigen Mechanismen und ihre Strategien zur Bekämpfung konzentrieren. Die kleinen Moleküle, Peptide und Nanotherapeutika sind entstanden, um die Medikamentenresistenz bei Krebs zu überwinden. Die Wirkstoffabgabesysteme mit Targeting-Einheit verbessern die Ortsspezifität, die rezeptorvermittelte Endozytose und erhöhen die Wirkstoffkonzentration innerhalb der Zellen, wodurch die Wirkstoffresistenz minimiert und ihre therapeutische Wirksamkeit verbessert wird. Diese therapeutischen Ansätze funktionieren, indem sie die verschiedenen Wege modulieren, die für die Arzneimittelresistenz verantwortlich sind. Dieser Review konzentriert sich auf die verschiedenen Mechanismen der Arzneimittelresistenz und die jüngsten Fortschritte bei therapeutischen Ansätzen zur Verbesserung der Sensitivität und Wirksamkeit von Chemotherapeutika.

    Grafik abstrakt

    Dies ist eine Vorschau von Abonnementinhalten, auf die Sie über Ihre Institution zugreifen können.


    Materialen und Methoden

    Zelllinien und Kulturbedingungen

    Nach informierter Zustimmung zu den vom Memorial Sloan Kettering Cancer Center (MSKCC) vom Institutional Review Board genehmigten Protokollen wurden periphere mononukleäre Blutzellen (PBMC) von HLA-typisierten gesunden Spendern und Patienten durch Ficoll-Dichtezentrifugation gewonnen. Die Quellen zum Erhalten der humanen Mesotheliom-Zellinien JMN und Meso34 wurden zuvor beschrieben und wurden durch IMPACT-Sequenzierung als einzigartige Zelllinien verifiziert (Ergänzungstabelle S1 Ref. 3). HEK293T, PC9, SKMEL5, UACC257, SW480, CFPAC1, H827, H1975, H1299 und A549 wurden von ATCC zwischen den Jahren 2012 und 2016 bezogen und nicht weiter validiert. Die TPC1-Zelle wurde aus dem Labor von Dr. James Fagin bezogen, wo die Zelllinie durch IMPACT-Sequenzierung validiert und von 2014 bis 2016 (MSKCC) verwendet wurde. Die Melanomlinie B16-F10 wurde ursprünglich von I. Fidler (MD Anderson Cancer Center) bezogen und von 2015 bis 2016 verwendet und nicht weiter validiert. Zelllinien wurden 2 bis 3 Monate in RPMI, ergänzt mit 10 % FBS und 2 mmol/l 1-Glutamin, gehalten, sofern nicht anders angegeben. HEK293T wurden in Dulbecco's modifiziertem Medium mit 10 % FBS und 2 mmol/l-Glutamin gezüchtet. Zellen wurden regelmäßig auf Mykoplasmen.

    Als Target wurden die HLA-A*02:01-positiven Mesotheliomzelllinien JMN und Meso34 sowie die Melanomzelllinie SK-MEL5 im ADCC-Assay verwendet. Antikörper (3 μg/ml) ESKM (15), PRAME oder seine Isotypkontrolle hIgG1 wurden mit Zielzellen und frischen gesunden Spender-PBMCs bei unterschiedlichen Effektor/Ziel-Verhältnissen für 6 Stunden zusammen mit den angegebenen Vehikel- oder Trametinib-Dosen in RPMI-ergänzt . inkubiert mit 10 % FBS. Der Überstand wurde geerntet und die Zytotoxizität wurde durch einen 51 Cr-Freisetzungsassay (Perkin Elmer) gemessen.

    Klonogener Abtötungsassay

    B16F10-Zellen wurden 72 Stunden lang entweder mit 0,1 % DMSO oder 1 μmol/l Trametinib behandelt. B16F10-Zellen (1 × 10 4 ) wurden dann als Ziele verwendet und in vitro–aktivierte Pmel-T-Zellen (5 × 10 4 ) als Effektoren, isoliert aus der Milz von Pmel (GP100) B6.Cg-Thy1a/Cy Tg(TcraTcrb)8Rest/J-Mäusen (The Jackson Laboratory).

    Gepooltes RNAi-Screening

    Eine benutzerdefinierte shRNA-Bibliothek, die auf das gesamte Komplement von 526 menschlichen Kinasen abzielt, wurde unter Verwendung von miR30-adaptierten DSIR-Vorhersagen entwickelt, die mit „Sensor“-Regeln (sechs shRNAs pro Gen) verfeinert und durch PCR-Klonierung eines Pools von Oligonukleotiden konstruiert wurden, die auf 12 000 angepassten Arrays synthetisiert wurden (Agilent Technologies und CustomArray) wie zuvor beschrieben (16). Die Liste der Gene wurde der KinBase-Datenbank (http://kinase.com/human/kinome/) entnommen und manuell kuratiert. Nach der Sequenzüberprüfung wurden 3.156 shRNAs (5–6 pro Gen) mit Positivkontrolle HLA-A– und Negativkontrolle Renilla–targeting shRNAs in gleichen Konzentrationen in einem Pool kombiniert. Es wurden JMN-Mesotheliomzellen verwendet, die das Tet-On-rt-TA3-Gen stabil exprimierten. Dieser Pool wurde in den TRMPV-Neo-Vektor subkloniert und in dreifacher Ausfertigung in Tet-on-JMN-Mesotheliom-Krebszellen unter Verwendung von Bedingungen transduziert, die überwiegend zu einer einzelnen retroviralen Integration führen und jede shRNA in einer berechneten Anzahl von mindestens 1.000 Zellen darstellen (Abb. 1A). . Transduzierte Zellen wurden 6 Tage lang unter Verwendung von G418 (1 mg/ml Invitrogen) selektiert. Bei jeder Passage wurden mehr als 3 × 10 7 Zellen aufrechterhalten, um die Bibliotheksdarstellung während des gesamten Experiments zu bewahren. Nach der Induktion wurden T0-Proben entnommen (∼3 × 10 7 Zellen pro Replikat, n = 3) und die Zellen wurden anschließend in Gegenwart von Doxycyclin (2 μg/ml) kultiviert, um die shRNA-Expression zu induzieren. Nach 4 Tagen (Tf) wurden etwa 3 × 10 6 shRNA-exprimierende (dsRed + /Venus + ) Zellen für jedes Replikat unter Verwendung eines FACSAriaII (BD Biosciences) sortiert. DAPI-negative, dsRed + /Venus + -Zellen wurden durch FACS in drei Populationen von BB7-Niedrig-, BB7-Mittel- und BB7-Hochbindung sortiert (Fig. 1). Genomische DNA aus Tf-Proben wurde durch zwei Runden Phenolextraktion unter Verwendung von PhaseLock-Röhrchen (5′) und anschließender Isopropanol-Präzipitation isoliert. Deep-Sequencing-Matrizenbibliotheken wurden durch PCR-Amplifikation von shRNA-Führungssträngen wie zuvor beschrieben erzeugt (16). Bibliotheken wurden auf einem Illumina Genome Analyzer bei einer Endkonzentration von 8 pmol/L analysiert 50 Nukleotide des Leitstrangs wurden mit einem benutzerdefinierten Primer (miR30 .) sequenziertÖkoRISeq, TAGCCCCTTGAATTCCGAGGCAGTAGGCA). Treffer mit weniger als 100 Reads aus dem Illumina HiSeq wurden eliminiert, da sie nicht über dem Hintergrund lagen.

    Screen nach Kinase-Regulatoren von Oberflächen-HLA. EIN, ein TRMPV-induzierbarer shRNA-retroviraler Vektor wurde zur Transduktion von JMN verwendet (HLA-A*02:01-positive humane Mesotheliom-Linie). TRE ist das Tet-responsive Element, das die Expression des Fluorophors dsRed und der shRNA-Haarnadel steuert. Der konstitutive PGK-Promotor treibt das Venus-Fluorophor zusammen mit der Neomycin-Resistenzkassette an. B, Western-Blot- und Durchflusszytometriedaten, die den Knockdown von HLA-A unter Verwendung eines retroviralen TRMPV-Systems mit einer positiven Kontroll-shRNA zu HLA-A02 zeigen. Die shRen ist eine negative Kontroll-shRNA, die gegen die Renilla Gen. C, Schema, das die Workflow-Pipeline für den Bildschirm der Regulatoren von Oberflächen-HLA-A darstellt. D, Wasserfalldiagramm, das die Verteilung von shRNA-Konstrukten gegen MAP2K1 und EGFR als log-fache Differenz zwischen der BB7-hochsortierten Population und der BB7-niedrigsortierten Population zeigt. E, Der shRNA-Knockdown von MAP2K1 und EGFR in JMN-Zellen validiert sie als negativen Regulator von Oberflächen-HLA-A. BB7.2 ist ein für HLA-A02 spezifischer mAb. Als Negativkontrolle diente shRNA gegen Renilla, als Positivkontrolle eine shRNA gegen HLA-A. Der Bildschirm wurde in dreifacher Ausführung erstellt. Inhibitionsexperimente wurden mindestens zweimal mit ähnlichen Ergebnissen durchgeführt und die gezeigten Daten sind repräsentativ. Der Student T Es wurde ein Test durchgeführt, um jeden shRNA-Gen-Knockdown-MFI mit der shRen-Kontrolle zu vergleichen (*, 0,05 **, 0,01 ***, ≤ 0,001 ****, ≤ 0,0001).

    Relative Darstellungen jeder einzelnen shRNA wurden bestimmt und in jeder gegebenen sortierten Population verglichen. Wir trennten die Treffer phänotypisch in negative Regulatoren (die Population 1 SD unter der mittleren Fluoreszenzintensität) oder positive Regulatoren (die Population 1 SD über der mittleren Fluoreszenzintensität) von HLA-A*02:01. Das Verhältnis des shRNA-Rankings zwischen der hohen und der niedrigen Population wurde verglichen, wobei ein hohes Verhältnis auf einen mutmaßlich negativen Regulator von Oberflächen-HLA-A*02:01 hinweist. Die Bewertungskriterien für ein Gen als a Negativ Regulator von HLA-A*02:01 basierte darauf, dass zwei oder mehr shRNA-Konstrukte in den oberen 5 % für den mehrfachen Unterschied in der relativen Repräsentation zwischen BB7-Hochpopulation und BB7-Niedrigpopulation bewertet wurden, wobei andere Konstrukte innerhalb von 1 SD des Mittelwerts lagen Veränderung. Die Genprodukte mit mindestens zwei shRNA-Sequenzen im oberen 5%-Verhältnis wurden für die weitere Validierung mit anderen Methoden ausgewählt. Dieselbe Discovery-Pipeline wurde zum Identifizieren verwendet positiv Regulatoren von HLA-A*02:01. Zur Validierung wurde der LT3GEPIR-shRNA-Vektor verwendet (Ref. 17 Supplementary Table S2). Zellen wurden transduziert und mit Puromycin selektiert, dann mit Doxycyclin (2 μg/ml) für 96 Stunden induziert, bevor die BB7-, W6/32-, ESK- oder PRAME-Expression durch Durchflusszytometrie ausgewertet wurde.

    Antikörper

    Antikörper, die für die Durchflusszytometrie und Western-Blot-Analyse verwendet werden, sind in der Ergänzungstabelle S3 beschrieben. Für die Durchflusszytometrie verwendete monoklonale Antikörper (mAb) waren spezifisch für HLA-A02 (BB7.2), pan-HLA-ABC (W6/32), WT1-Peptid RMF gebunden an HLA-A02 (ESK1), PRAME-Peptid ALY gebunden an HLA -A02 (Pr20), H2-Kb (AF6-88.5.5.3) und H2-Kq (KH114). Andere in diesem Bericht verwendete Antikörper sind ebenfalls in der Zusatztabelle S3 aufgeführt.

    Echtzeit-PCR

    Gesamt-RNA wurde unter Verwendung von Qiagen RNA Easy Plus (Qiagen #74134) extrahiert, nachdem die Zellen 48 Stunden lang mit dem angegebenen Inhibitor behandelt worden waren. RNA wurde unter Verwendung von qScript cDNA SuperMix (Quanta Biosciences Gaithersburg) in cDNA umgewandelt. Echtzeit-Assays wurden mit TaqMan-Echtzeitsonden (Life Technologies) für humanes HLA-A (Hs01058806_g1), Beta-2-Mikrogobulin (β2M) (Hs00187842_m1), TAP1 (Hs00388677_m1), TAP2 (Hs00241060_m1) und TBP (Hs00427620_m1) mit 50 ng cDNA. Zur Beurteilung der Genexpression mittels RT-PCR PerfeCTa. FastMix. II (Quanta) wurden Reaktionen in dreifacher Ausführung unter Verwendung von Standard-Thermocycling-Bedingungen (2 Minuten bei 50 °C, 10 Minuten bei 95 °C, 40 Zyklen von 15 Sekunden bei 95 °C und 1 Minute bei 60 °C) durchgeführt. Als interne Kontrolle wurde TBP verwendet, und die CT-Methode wurde für relative mRNA-Berechnungen verwendet.

    Promoterbasierte Studien

    Der GLuc-Luciferase-Promotor wurde von Genecoepia (GeneCoepia Rockville) mit dem β2m Promotor stromaufwärts des GLuc-Enzyms kloniert. Die Normalisierung erfolgte auf SEAP (unter dem konstitutiv aktiven SV40-Promotor). Die Zellen wurden mit 5E3-Zellen/Vertiefung ausgesät und 72 Stunden mit den angegebenen Arzneimitteln behandelt. Die Lumineszenzquantifizierung wurde unter Verwendung des Secrete-Pair Dual Luminescence Assay Kit (GeneCoepia Rockville) getestet.

    Durchflusszytometrische Studien

    Zelllinien wurden dreifach in einer 6-Well-Gewebekulturplatte mit einer Dichte von 1E5 Zellen/Well ausgesät und über Nacht anhaften gelassen. Am nächsten Tag wurden die Zellen entweder mit Vehikelkontrolle (0,1% DMSO), Arzneimitteln oder Inhibitoren in den angegebenen Konzentrationen behandelt. Die Zellen wurden dann 72 Stunden nach der Inhibitorbehandlung isoliert und mit PBS gewaschen. Die Zellen wurden anschließend mit BB7.2 (HLA-A02 – spezifischer mAb), W6/32 (HLA-ABC – spezifischer mAb) oder AF6-88.5.5.3 (H2-K b – spezifischer mAb Ebiosciences) gefärbt. Die Zellen wurden mit Propidiumiodid auf Lebensfähigkeit gefärbt. Die Zellen wurden auf einem BD Accuri C6-Durchflusszytometer analysiert.

    Überexpression von β2m

    Mensch β2M-cDNA wurde in den MSCV-Puromycin-Vektor kloniert.

    Überexpression von mutiertem EGFR und NRAS

    Der retrovirale pBABE-Vektor, der entweder EGFR codiert, das die L858R-Mutation trägt, wurde verwendet, um die H1299-Zelllinie unter Verwendung von HEK293T/amphoteren Zellen stabil zu transduzieren und wurde 5 Tage in Puromycin (2,5 &mgr;g/ml) selektiert. EGFR L858R war ein Geschenk von Matthew Meyerson (Dana-Farber Cancer Institute, Boston, Massachusetts) (Addgene Plasmid # 11012).

    Für die Überexpression von NRAS wurde das pBABE NRAS Q61K-Plasmid verwendet, um H827-Zellen ähnlich wie oben beschrieben zu transduzieren und in Puromycin (2 &mgr;g/ml) selektiert. pBabe N-Ras 61K war ein Geschenk von Channing Der (Addgene-Plasmid # 12543).

    Studien mit niedermolekularen Inhibitoren

    Verbindungen wurden von SelleckChem bezogen. Medikamente wurden in subzytostatischen Dosen durch Titration unter Verwendung des Cell Titer Glo-Assays (Promega) verwendet. Alle Medikamente wurden verwendet in vitro in den angegebenen Dosen in 1% DMSO. Experimente wurden mindestens zweimal mit ähnlichen Ergebnissen durchgeführt und die gezeigten Daten sind repräsentativ.

    SiRNA-Knockdown

    Die JMN-Zelllinie wurde mit einer verwürfelten Kontroll-siRNA oder siRNA gegen STAT1, STAT3 und RelA behandelt. Die Zellen wurden mit dem angegebenen Arzneimittel 24 Stunden nach dem siRNA-Knockdown für 72 Stunden behandelt, bevor sie durch Durchflusszytometrie auf Oberflächen-HLA-A untersucht wurden. Details zum shRNA-Konstrukt sind in der Ergänzungstabelle S2 angegeben.

    Transgenes EGFR L858R Mausmodell

    FVB CC10-rtTA/EGFR-L858R-Mäuse wurden als freundliches Geschenk vom Harold Varmus-Labor (Weill Cornell Medicine) erhalten. Mäuse wurden gemäß dem MSKCC Institutional Review Board nach Protokoll 96-11-044 gezüchtet. Die für das Experiment verwendeten Mäuse waren heterozygot für CC10-rtTA und EGFR-L858R, wie durch quantitative PCR-Genotypisierung nachgewiesen wurde. Im Alter von 4 bis 6 Wochen wurde den Mäusen Doxycyclin über Futterpellets (625 mg/kg Harlan-Teklad) für >6 Wochen verabreicht. Mäuse wurden durch Anästhesie unter 2% Isofluran abgebildet und Lungenfeldbilder wurden auf einem Bruker 4.7T Biospec Scanner (Bruker Biospin Inc.) Magnetresonanztomograph (MRI) im Kleintier-Bildgebungskern des MSKCC aufgenommen. Die Bilder wurden mit der Osirix Imaging Software analysiert. In axialen und koronalen MR-Bildern wurde bestätigt, dass Lungenkrebs bei Mäusen retikulonoduläre Erscheinungen und Konsolidierungen aufweist, im Einklang mit früheren Daten, die an den transgenen Mäusen veröffentlicht wurden (18).

    Die Mäuse wurden getötet, sobald bestätigt wurde, dass sie Lungentumore hatten (nicht-induzierte Kontrollmäuse wurden ebenfalls verwendet, die genotypisch identisch waren, aber keine Dox-Diät erhielten). Die Lungen wurden isoliert und mit Collagenase IV in HBSS mit Ca 2+ und Mg 2+ 1 Stunde lang 37ºC behandelt. Die Zellen wurden dann gesammelt, mit Maus-FcR-Block (Miltenyi) blockiert, gezählt und mit Maus-CD45 (30-F11 Biolegend), menschlichem EGFR (AY13 Klon Biolegend) und Maus H2-K q (KH114, Klon Abcam) Antikörpern gefärbt. Die durchflusszytometrische Analyse wurde auf Fortessa (BD Biosciences) durchgeführt.

    CC10/L858R-Microarray-Daten

    Expressionsdaten von Gewebe, das aus WT- und EGFR-L858R-transgenen Mäusen isoliert wurde, stammen aus einer früheren Studie (GSE17373) und wurden auf statistisch signifikante Daten selektiert (P < 0,05) für PDCD1 (PD-1), CD274 (PD-L1), TAP1, TAP2, H2-K d , und β2M Genexpression zwischen tumortragendem EGFR L858R-Lungengewebe und normalem Lungengewebe (19, 20).


    Die Mechanismen der deregulierten Expression von miRNAs

    Die abnormale Expression von miRNAs könnte eine maligne Transformation von Zellen induzieren oder Tumorzellen resistent gegen Chemotherapeutika machen. Als nächstes werden wir die Mechanismen der Fehlregulation der miRNA-Expression in arzneimittelresistenten Zellen überprüfen. Offensichtlich wird uns die Untersuchung der Mechanismen der miRNA-Fehlregulation helfen, die Medikamentenresistenz zu überwinden. Nach den Ergebnissen aktueller Studien umfasst der Mechanismus der miRNA-Deregulierung hauptsächlich die Amplifikation oder Deletion des miRNA-Gens, die epigenetische Regulation, die Deregulierung von Transkriptionsfaktoren und die Dysregulation von Schlüsselgenen/Proteinen der miRNA-Biogenese und -Prozessierung [19]. Darüber hinaus könnte kompetitive endogene RNA (ceRNA) auch die Menge an intrazellulärer miRNA reduzieren, indem sie kompetitiv an miRNAs bindet, wie in Abb. 2 dargestellt.

    Die Mechanismen der deregulierten Expression von microRNAs. Verschiedene Mechanismen können die Expression von miRNA . fördern oder/und hemmen

    Genamplifikation und Deletion

    Die Orte von etwa 50% aller humanen miRNA-Gene befinden sich in fragilen Regionen oder krebsassoziierten Stellen, wie z. Gene an diesen Stellen waren normalerweise anfälliger für Deletion, Translokation oder Amplifikation. Beispielsweise wurden die Deletionen am 13q14-Chromosom am häufigsten bei Chromosomenanomalien beobachtet. Sowohl miRNA-15a als auch miRNA-16-1 liegen innerhalb von 13q14 und werden bei mehr als der Hälfte der chronisch lymphatischen Leukämie (CLL) häufig deletiert und/oder herunterreguliert [115]. Ein gegenteiliges Beispiel war die miRNA-17

    92-Familie, die sich im Bereich von 13q31-q32 befindet. Es wurde beobachtet, dass diese Region in einer Vielzahl von Tumoren amplifiziert wird, was zu einer Erhöhung der Menge an reifen miRNAs führte und so die Tumorentwicklung förderte [116].

    Untersuchungen zum Zusammenhang zwischen der Deregulierung der Arzneimittelresistenz im Zusammenhang mit miRNAs und Genamplifikation und -deletion sind noch selten. Studien haben gezeigt, dass die Expressionsniveaus von miRNA-219-2 und miRNA-199b mit der Prognose und dem Behandlungseffekt von Imatinib bei Patienten mit CML in Zusammenhang stehen. Die Abnahme der miRNA-199b-Expression könnte die CML-Patienten resistent gegen Imatinib machen [117]. Etwa 15–18 % der CML-Patienten zeigten Gendeletionen um die Translokationsbruchpunkte auf dem(9)-Chromosom [118]. Mehrere Studien haben gezeigt, dass eine Deletion in 9q gleichzeitig mit der Ph-Translokation für die Expression des bcr-abl Fusionsgen. Es wurde festgestellt, dass MiRNA-219-2 und miRNA-199b zentromerisch auf die abl1 Gen innerhalb der chromosomalen Region bei 9q34, das bei CML-Patienten mit der(9)-Deletionen häufig verloren ging, induzierte eine Downexpression von miRNA-199b und miRNA-219-2, was zu einer Resistenz der CML gegenüber Imatinib führte [117, 119].

    MiRNA-21 wurde Berichten zufolge bei verschiedenen Krebsarten hochreguliert, was die Arzneimittelresistenz von Tumorzellen fördern könnte (Tabelle 1). Hirataet al.[120] bewiesen, dass die Überexpression von miRNA-21 bei Eierstockkrebs durch die Amplifikation der chromosomalen Region 17q23-25 ​​verursacht wurde, was zu einer geringen Expression von PTEN (das Zielgen von miRNA-21). Chaluvally-Raghavan et al. [121] zeigten direkt die Beziehung zwischen der miRNA-Genamplifikation und der Resistenz gegen Tumorarzneimittel. Sie fanden heraus, dass miRNA-569, die in einer Untergruppe von Eierstock- und Brustkrebs überexprimiert wurde, zumindest teilweise aufgrund der 3q26.2-Amplifikation. Herunterregulierung des Tumorproteins p53 induzierbares nukleäres Protein 1 (TP53INP1) durch miRNA-569 induzierte Expression trug zu den Auswirkungen von miRNA-569 auf das Überleben und die Proliferation von Zellen bei. Das Targeting von miRNA-569 sensibilisiert Eierstock- und Brustkrebszellen für CDDP, indem es den Zelltod sowohl in vitro als auch in vivo erhöht. Wie bereits erwähnt, ist die Hochregulation der miRNA-17

    92-Familie war mit der Genamplifikation verbunden, und dies führte zur Förderung der Arzneimittelresistenz bei vielen Tumorarten (Tabelle 1). Hayashitaet al. [122] fanden heraus, dass die miRNA-17

    92-Cluster, der sieben miRNAs umfasst und im Intron 3 des C13orf25 Gen bei 13q31.3, wurde bei Lungenkrebs deutlich überexprimiert, insbesondere bei der SCLC-Krebshistologie. Die Amplifikation dieser Region ist die direkte Ursache für die Überexpression der miRNA-17-Familie, die das Wachstum von Lungenkrebszellen fördert.

    Methylierung und Histonmodifikationen von miRNA-Genen

    DNA-Methylierung und Histon-Modifikationen können die Genexpression verändern, ohne die DNA-Sequenz zu verändern. DNA-Methylierung bezeichnet die Anlagerung einer Methylgruppe (-CH3) an den Cytosinring eines CpG-Dinukleotids an der Kohlenstoff-5-Position, die durch DNA-Methyltransferasen (DNMTs) katalysiert wird [123]. DNA-Methylierung führt zu Gen-Silencing und dient als alternativer Mechanismus der Gen-Inaktivierung. Posttranslationale Modifikationen wie Acetylierung, Methylierung und Phosphorylierung, die an aminoterminalen Histonschwänzen auftreten, sind stark mit aktiver Gentranskription oder Transkriptionsrepression assoziiert [124]. Im Allgemeinen ist die Acetylierung von Histonen durch Histonacetyltransferase (HAT) mit einer Genaktivierung verbunden, und eine Hypoacetylierung durch Histondeacetylasen (HDACs) ist mit einer Geninaktivierung verbunden. Die Histon-Methylierung ist sowohl mit der Genaktivierung als auch mit der Stummschaltung verbunden. So ist beispielsweise die Trimethylierung von Lysin 27 von Histon H3 (H3K27) ein Silencing-Zeichen, und eine Methylierung von Lysin 4 (H3K4) wurde an den Promotoren aktiver Gene gefunden [125]. DNA-Methylierung und Histon-Modifikationen sind die epigenetischen Mechanismen, die zur Deregulierung der miRNA-Expression bei Krebserkrankungen führen. Es gibt eine kollaborative Rolle zwischen DNA-Methylierung und Histon-Modifikationen bei der Stummschaltung von tumorsuppressiven miRNAs bei Krebs [123].

    Es wurde angenommen, dass miRNA-34a ein Tumorsuppressor ist. miRNA wurde in vielen Arten von Tumorzellen herunterreguliert und hatte die Wirkung, die Empfindlichkeit von Tumorzellen gegenüber Chemotherapeutika zu verbessern (Tabelle 1). Lodyginet al. [126] zeigten, dass der Verlust der miRNA-34a-Expression im Zusammenhang mit der Methylierung seines Promotors auf der CpG-Insel in der Mehrheit (79,1%) der Proben von primärem Prostatakarzinom vorhanden war. Danach wurde eine häufige Methylierung des miRNA-34a-Promotors in primären Melanomproben (62,5%), Melanom (43,2%), Blase (33,3%), Lunge (29,1%), Brust (25,0%), Niere (21,4%) gefunden. , Pankreas- (15,7 %) und Dickdarm- (13,0 %) Krebszelllinien. Bei NSCLC haben Gallardo et al. [127] zeigten, dass die Expression von miRNA-34a bei Patienten mit miRNA-34a-Hypermethylierung im Vergleich zu Patienten mit unmethylierter miRNA-34a signifikant reduziert war.

    MiRNA-320a wurde in Tumorzellen häufig downexprimiert. In chemoresistenten Zellen war die Herunterregulation von miR-320a mit einer Promotor-Methylierung der miR-320a-kodierenden Sequenz verbunden [33]. Saitoet al. [128] fanden heraus, dass die kombinierte Behandlung von humanen Blasenkrebszellen mit dem Demethylierungsreagenz 5-Aza-2′-desoxycytidin (5-Aza-CdR) und dem HDAC-Inhibitor 4-Phenylbuttersäure (PBA) einen signifikanten Einfluss auf die Expression von miRNAs. Es könnte die Expression von miRNAs, einschließlich miRNA-127, erhöhen. Ein weiteres Beispiel für die Methylierungsregulation bei der Arzneimittelresistenz-assoziierten miRNA ist miRNA-149. MiRNA-149 wurde herunterreguliert und war an der Chemoresistenz in ADM-resistenten menschlichen Brustkrebszellen (MCF-7/ADM) beteiligt. Die Herunterregulation von miRNA-149 stand im Zusammenhang mit der Hypermethylierung seiner 5′-UTR. Mit herunterregulierter miRNA-149 wird das Zielgen GlcNAc N-Deacetylase/N-Sulfotransferase-1 (NDST1) hochexprimiert wurde, so erhöhte sich die Resistenz von humanen Brustkrebszellen MCF-7 gegen ADM [28]. Yanget al. [85] fanden heraus, dass miRNA-130b in multiresistenten Eierstockkrebszellen herunterreguliert war. MiRNA-130b-Hypermethylierung wurde sowohl in Eierstockkrebsgeweben als auch in arzneimittelresistenten Zelllinien gefunden, und der Methylierungsgrad war negativ mit seiner Expression korreliert. Die Demethylierung mit 5-Aza-CdR führte zur Reaktivierung der miRNA-130b-Expression in arzneimittelresistenten Eierstockkrebszelllinien, wodurch die Zellsensibilität gegenüber CDDP und Taxol erhöht wurde. Ein intuitiverer Beweis war, dass die Methylierung der miR-129-5p-CpG-Insel in Magenkrebszellen die Expression von miR-129-5p reduzierte und die Zellen dazu veranlasste, eine Arzneimittelresistenz zu erwerben. Im Vergleich zur Expression in Elternzellen wurde die Expression von miR-129-5p in einer mit einem 5-Aza-CdR behandelten multiresistenten Zelllinie wiederhergestellt [129].

    Wie oben erwähnt, ist miRNA-21 eine krebserregende miRNA in verschiedenen Geweben, und ihre Hochregulierung kann die Tumorentwicklung und Chemoresistenz fördern. Songet al. [130] sammelten retrospektiv 41 Fälle von Patienten mit fortgeschrittenem Bauchspeicheldrüsenkrebs, die empfindlich oder resistent gegen Gemcitabin (GEM) waren, und bewerteten die Spiegel der im Serum zirkulierenden miRNA-21, um eine Korrelation mit der zytotoxischen Aktivität zu bestimmen. Die Histonacetylierung im miRNA-21-Promotor wurde auch in GEM-sensitiven und GEM-resistenten duktalen Adenokarzinomen des Pankreas (PDAC) untersucht. Sie fanden heraus, dass die Histonacetylierungsspiegel am miRNA-21-Promotor in PDAC-Zellen nach der Behandlung mit GEM erhöht waren und die durch Histonacetylierung in der Promotorzone induzierte Hochregulierung von miRNA-21 mit einer Chemoresistenz gegen GEM und einem erhöhten bösartigen Potenzial in Bauchspeicheldrüsenkrebszellen verbunden war . Darüber hinaus wurde miRNA-214, das die Entwicklung von Gebärmutterhalskrebs hemmte, durch DNA-Methylierung und Histon-Deacetylierung downexprimiert, was zu Tumorentstehung und Arzneimittelresistenz führte [111]. Andere Beispiele waren miRNA-375 und miRNA-200. Studien zeigten, dass die Expression dieser beiden miRNAs in arzneimittelresistenten Brustkrebszellen herunterreguliert war. Eine Behandlung mit einem Demethylierungsmittel in Kombination mit einem HDAC-Inhibitor könnte die Expression dieser miRNAs in Zellen wiederherstellen [131, 132].

    Anomalie der Transkriptionsfaktoren

    Transkriptionsfaktoren, auch trans-wirkende Faktoren genannt, sind Proteine, die direkt oder mit Hilfe anderer Proteine ​​spezifisch an cis-wirkende Elemente in der Promotorregion eines eukaryontischen Gens binden und so die Gentranskription aktivieren oder hemmen können.

    Der bekannteste Transkriptionsfaktor bei der miRNA-Regulation ist p53. P53 kann als Tumorsuppressor wirken und seine Expression wird hochreguliert, wenn die DNA beschädigt wurde. Es ist mit der Regulierung von Hunderten von Genen verbunden. 2007 gaben mehrere Laboratorien fast gleichzeitig bekannt, dass die miRNA-34-Familie, einschließlich der miRNA-34a, ein direktes Ziel von p53 ist und durch dieses Molekül signifikant hochreguliert werden könnte [133]. MiRNA-34a, die allgemein als Tumorsuppressor-miRNA gilt, verbessert die Empfindlichkeit von Tumorzellen gegenüber Chemotherapeutika. P53 erkennt direkt die Promotoren der miRNA-34-Familie und aktiviert die Transkription dieser miRNAs [134]. Zwei mit p53, p63 und p73 assoziierte Transkriptionsfaktoren weisen unterschiedliche Funktionen in Zellen auf. P73 vermittelt Chemosensitivität, während p63 die Zellproliferation und das Überleben fördert. Oryet al. [135] zeigten, dass p63 und p73 die Expression von miRNA-193a-5p regulieren können. MiRNA-193a-5p, deren Expression durch p63 unterdrückt wurde, wurde durch pro-apoptotische p73-Isoformen sowohl in normalen Zellen als auch in Tumorzellen in vivo aktiviert. Die Chemotherapie verursachte eine p63/p73-abhängige Induktion dieser miRNA, wodurch die Chemosensitivität aufgrund der miRNA-vermittelten Feedback-Hemmung von p73 eingeschränkt wurde. Wichtig ist, dass die Hemmung von miRNA-193a diese Rückkopplung unterbrach und dadurch die Lebensfähigkeit der Tumorzellen unterdrückte und eine dramatische Chemosensitivität sowohl in vitro als auch in vivo induzierte. Eine andere Studie [136] berichtete, dass das p53-Familienmitglied und die p63-Isoform, ΔNp63α, die miRNA-205-Transkription fördert und EMT in menschlichen Blasenkrebszellen kontrolliert -205 „Wirts“-Gen (miRNA-205HG) und verringerte die Bindung von RNA Pol II an die miRNA-205HG fördernd, hemmend miRNA-205HG Transkription.

    Eine weitere Medikamentenresistenz-assoziierte miRNA, miRNA-125b, wird durch mehrere Transkriptionsfaktoren reguliert. Beim kutanen T-Zell-Lymphom Überexpression von c-Myc reprimierte die miRNA-125b-5p-Transkription und sensibilisierte Lymphomzellen gegen Bortezomib [137]. Allerdings ist die Überexpression von Schnecke die Expression von miRNA-125b durch die Schnecken-aktivierte Wnt/β-Catenin/TCF4-Achse dramatisch erhöht. Schnecke vermittelte Chemoresistenz, indem sie Bak1 durch Hochregulierung von miRNA-125b unterdrückte. Es wurde berichtet, dass der Peroxisom-Proliferator-aktivierte Gamma-Rezeptor (PPARγ), ein multifunktionaler Transkriptionsfaktor, Antitumorwirkungen durch Hemmung der Proliferation und Induktion von Differenzierung und Apoptose hat. Luo et al. [138] zeigten, dass PPARγ die Expression von miR-125b fördern kann, indem es direkt an das responsive Element in der Promotorregion des miRNA-125b-Gens bindet.

    Andere chemoresistenzbezogene miRNAs wie miRNA-320a, miRNA-155, miRNA-200 und miRNA-21 wurden durch die Transkriptionsfaktoren v-ets Erythroblastosevirus E26 Onkogen Homolog 1 (ETS-1) reguliert [33], Smad4 [ 139], achaete scute-like 2 (Ascl2) [140] bzw. Krüppel-like factor 9 (KLF9) [141], wie in Abb. 2 gezeigt.

    Fehlregulation der miRNA-Biogenese und -Prozessierung

    Der Prozess der miRNA-Biogenese und -Reifung ist in Abb. 1 dargestellt. Der gesamte Stoffwechselweg erfordert eine Reihe von Schlüsselenzymen und Proteinen, darunter zwei RNA-III-Endonukleasen, Drosha und Dicer1, den Cofaktor DGCR8, den Transporter EXP5, den Cofaktor TRBP2 und Argonaute ( AGO) [142]. Während der miRNA-Prozessierung werden diese Proteine ​​reguliert, und deren Deregulierung kann zu einer abnormalen Expression von miRNAs führen. Dieser Artikel konzentriert sich auf Studien zur Regulation der Verarbeitung von miRNAs, die an der Arzneimittelresistenz beteiligt sind.

    Kovaltschuket al. [143] zeigten erstmals, dass DOX-resistente MCF-7-Zellen (MCF-7/DOX) eine erhebliche Fehlregulation ihres miRNAom-Profils und eine veränderte Expression der miRNA-prozessierenden Enzyme Dicer und AGO 2 aufweisen. Zu diesen fehlregulierten miRNAs gehören diejenigen, die an der Regulierung der zellulären Chemoresistenz beteiligt sind, wie z. B. miRNA-451, die auf die MDR1 Gen. Die Transfektion von MCF-7/DOX-resistenten Zellen mit microRNA-451 führte zu einer erhöhten Empfindlichkeit der Zellen gegenüber DOX, was darauf hindeutet, dass die Korrektur einer veränderten miRNA-Expression signifikante Auswirkungen auf therapeutische Strategien haben könnte, die darauf abzielen, die Resistenz von Krebszellen zu überwinden. Buet al. [144] haben die Beziehung zwischen Dicer und zellulärer Arzneimittelresistenz auf andere Weise direkt gezeigt. Sie fanden heraus, dass in der Brustkrebszelllinie MCF-7 der Knockdown von Dicer durch siRNA zu einem signifikanten G1-Arrest und einer erhöhten Empfindlichkeit gegenüber CDDP führte. Darüber hinaus ging die verminderte Expression von miRNA-21 mit der Abnahme von Dicer einher. Eine weitere Studie zeigte, dass Hyaluronsäure die Phosphorylierung des Stammzellmarkers Nanog in der Brusttumorzelllinie MCF-7 vermitteln kann. Phosphoryliertes Nanog regulierte dann die RNase III Drosha und die RNA Helicase p68 hoch. Dieser Prozess führte zur Produktion von microRNA-21 und zur Reduktion von Tumorsuppressorproteinen (z. B. PDCD4). Alle diese Ereignisse trugen zur Hochregulierung von Inhibitoren von Apoptoseproteinen (IAPs) und MDR1 bei, was zu einer Anti-Apoptose- und Chemotherapieresistenz führte [145]. Kimet al. [146] zeigten, dass der Ribonuklease/Angiogenin-Inhibitor 1 (RNH1) für die pri-miR-21-Prozessierung notwendig ist. Weitere Analysen zeigten, dass RNH1 direkt mit dem Drosha-Komplex interagierte und PTEN diese Interaktion blockierte, wodurch die Expression von miRNA-21 verringert wurde. Das heißt, die PTEN-vermittelte miRNA-21-Expressionsregulation wurde durch die Hemmung der Interaktion zwischen RNH1 und Drosha erreicht.

    Pri-miRNAs werden von einem Mikroprozessor gespalten, der das doppelsträngige RNase-III-Enzym Drosha und seinen essentiellen Cofaktor, DGCR8, umfasst, um pre-miRNAs zu produzieren [142]. MiRNA-15a/16 war an der Regulation der Chemoresistenz in Tumorzellen beteiligt (Tabelle 1), und ihre Expression korrelierte direkt mit der Nukleolinexpression. Die zelluläre Lokalisation war entscheidend für das ordnungsgemäße Funktionieren von Nukleolin in diesem Stoffwechselweg. Nukleolin interagiert direkt mit DGCR8 und Drosha im Zellkern und reguliert so die Expression von miRNA-15a/16 [147]. Interessanterweise werden auch Proteine, die an der miRNA-Verarbeitung beteiligt sind, wie Dicer, durch miRNA reguliert. Es wurde gezeigt, dass die ungenaue Spaltung einer Primär- oder Vorläufer-RNA durch Drosha bzw. Dicer eine Gruppe von miRNA-Varianten mit der Bezeichnung „IsomiR“ ergeben kann. Es gibt verschiedene Mechanismen der miRNA-31-Regulierung in verschiedenen Zellen (Tabelle 1) und in ihrer Biogenese, und es könnten drei Isoformen (miR-31-H, miR-31-P und miR-31-M) produziert werden, die unterscheiden sich nur geringfügig in ihren 5'- und/oder 3'-Endsequenzen. Chanet al. [148] ein vorhergesagtes Zielgen validiert, Würfel, ein neues Ziel von miR-31 zu sein, aber nur miR-31-P konnte direkt unterdrücken Würfel Expression sowohl in MCF-7-Brustkrebszellen als auch in A549-Lungenkrebszellen, was zu ihrer erhöhten Empfindlichkeit gegenüber CDDP, einem bekannten Merkmal des Dicer-Knockdowns, führt. Dies zeigt, dass zwischen miRNA und ihren prozessierenden Proteinen eine komplexe Beziehung besteht.

    CeRNA

    Das Konzept der ceRNA wurde erstmals von Salmena et al. im Jahr 2011 [149]. Die Hypothese schlug vor, dass neben mRNA Sequenzen von Pseudogenen, langen nicht-kodierenden Ribonukleinsäuren (lncRNAs) und zirkulären RNAs (circRNAs) miRNA-Response-Elemente (MREs) enthalten und als Köder um begrenzte Pools von miRNAs konkurrieren würden, ähnlich wie „ miRNA-Schwämme“, wodurch die Bindung von miRNA an ihr „legitimes“ Zielgen reduziert wird. Die ceRNA-Hypothese postulierte, dass jedes RNA-Transkript, das MREs enthält, miRNAs von anderen Zielen mit denselben MREs sequestrieren kann, wodurch deren Funktion reguliert wird [150]. Gegenwärtig weisen einige Studien darauf hin, dass ceRNAs die regulatorische Wirkung von chemoresistenzbezogenen miRNAs auf ihre Zielgene beeinflussen können [151, 152].

    PTEN ist ein Tumorsuppressorgen, und seine Expression ist in einer Vielzahl von Tumoren herunterreguliert. Die 3′-UTR von PTEN mRNA kann von einer Vielzahl von miRNAs angesteuert werden, wodurch ihre Expression gehemmt wird. PTENP1 ist ein Pseudogen der PTEN Tumorsuppressionsgen (TSG) und seine mRNA-Sequenz, nahe der 3′-UTR, ist hochgradig homolog zu derselben Region in PTEN. Diese Funktion von PTENP1 zeigt, dass es als ceRNA von . verwendet werden kann PTEN. Tatsächlich ist die 3′-UTR von PTENP1 und PTEN mRNA beherbergen beide MREs, die miRNA-21 binden können. Yuet al. [152] fanden heraus, dass die Überexpression von miRNA-21 in klarzelligen Nierenzellkarzinomen (ccRCC) die Zellproliferation, -migration und -invasion in vitro sowie das Tumorwachstum und die Metastasierung in vivo fördern könnte. Überexpression von PTENP1 in Zellen, die miRNA-21 exprimieren, reduziert die Zellproliferation, -invasion, das Tumorwachstum und die Metastasierung und rekapituliert die durch . induzierten Phänotypen PTEN Ausdruck. Darüber hinaus ist die Überexpression von PTENP1 in ccRCC-Zellen sensibilisierten diese Zellen gegenüber CDDP- und GEM-Behandlungen, in vitro und in vivo. In klinischen Proben sind die Ausdrücke von PTENP1 und PTEN waren invers mit der miRNA-21-Expression korreliert. CcRCC-Patienten ohne PTENP1 Expression haben eine geringere Überlebensrate. Diese Ergebnisse legen nahe, dass PTENP1 fungiert bei ccRCC als ceRNA, die das Fortschreiten von Krebs unterdrückt.

    Kurz gesagt, ceRNA ist ein relativ neues Konzept. Obwohl es einige Studien zum Zusammenhang zwischen ceRNAs und Tumorgenese gibt [153, 154], sind Berichte über ceRNAs, die mit der Regulation der Chemoresistenz assoziiert sind, selten. Es wird angenommen, dass in Zukunft weitere Chemoresistenz-bezogene ceRNAs entdeckt werden.


    3. ERGEBNISSE

    3.1 Enthaltene Datensätze und Qualitätsbewertung

    Wie im Flussdiagramm (Abbildung S1) gezeigt, haben wir Datensätze aus den Datenbanken GEO, Array Express, SRA, Oncomine, TCGA und GTEx abgerufen. Nachdem 48 Duplikate entfernt wurden, wurden insgesamt 109 Datensätze erhalten. Von diesen Datensätzen wurden 26 ausgeschlossen, deren Daten nicht verfügbar waren. Nach Überprüfung der Matrizen wurden sieben Datensätze entfernt, ohne MAOA Ausdrucksdaten. Schließlich wurden 76 Datensätze für die Analyse eingeschlossen. Um die Zuverlässigkeit unserer Studie zu untermauern, wurden die Daten unabhängig von LJD, GL und YX verifiziert und ein Konsens erreicht.

    3.2 Datensatzinformationen

    Tabelle S1 zeigt die grundlegenden Informationen der 76 enthaltenen Datensätze und eines internen Gewebe-Microarrays, die 4348 HCC-Patienten und 3624 nicht-kanzeröse Kontrollen von 2007 bis 2020 abdecken. Die Datensätze stammten aus verschiedenen Ethnien: 42 asiatische Datensätze und 34 nicht-asiatische Datensätze . Die Ausdrucksstufen von MAOA in den HCC-Patienten und Kontrollgruppen wurden entweder die Genchip-Technologie (N = 58) oder die RNA-Sequenzierungsmethode (N = 18) analysiert. Die Ausdrucksstufen von MAOA in den HCC-Patienten und Nicht-Krebs-Gruppen wurden unter Verwendung der mittleren (M) Expressionsniveaus und der Standardabweichung (SD) verglichen. Bei allen Proben handelte es sich um Lebergewebe, das von HCC-Patienten und Nicht-Krebs-Personen entnommen wurde.

    3.3 Verminderte Expression von MAOA-mRNA bei HCC-Patienten

    Die Ausdrucksstatus von MAOA bei verschiedenen Krebsarten sind in Abbildung S2A dargestellt. Unter den RNA-Sequenzierungsdatensätzen zeigten sieben Datensätze einen signifikanten Downregulationstrend von MAOA bei den HCC-Patienten im Vergleich zu den Gruppen ohne Krebs: GSE63018, GSE56545, GSE63863, GSE77509, GSE77314, TCGA-GTEx und GSE69164 (alle mit P-Werte <.05 Abbildung S2B-Q). Wie bei den Genchip-Datensätzen zeigen die Streudiagramme in Abbildung S3A-P signifikant niedrigere Expressionsniveaus von MAOA bei den HCC-Patienten im Vergleich zu den Nicht-Krebs-Gruppen in GSE6764, GSE14323, GSE14520-GPL571, GSE14520-GPL3921, GSE29721, GSE45436, GSE55092, GSE76297, GSE102079, GSE112790, GSE121248, GSE54236, GSE P-Werte <.05).Anschließend wurde der Heterogenitätstest der eingeschlossenen Datensätze durchgeführt und ein Ergebnis von ich 2 = 84.9% (P-Wert < 0,0001) zeigte eine signifikante Heterogenität an. Daher wurde eine Zufallseffektanalyse verwendet, um die SMD zu berechnen. Das in der ausgestellte Ergebnis MAOA Expressionsspiegel bei Patienten mit HCC waren signifikant niedriger als in den Nicht-Krebs-Gruppen (Abbildung 1, SMD = -0,32, 95%-KI: -0,45 bis -0,18). Darüber hinaus zeigte das Ergebnis der sensitiven Analyse keinen signifikanten Unterschied zwischen den eingeschlossenen Studien (Abbildung S4A). Der Trichterplot von Begg zeigte keinen Publikationsbias mit a P-Wert = 0,657 (Abbildung S4B). Es wurden zwei Subgruppenanalysen durchgeführt, um den Expressionsstatus von . zu beurteilen MAOA aus zwei Perspektiven (Abbildungen S5 und S6). Die Ergebnisse zeigten, dass weder die Ethnizität noch die Methoden zur Ermittlung der MAOA Die mRNA-Expressionsniveaus von HCC-Patienten waren die Quelle der Heterogenität in der vorliegenden Studie, da MAOA wurde in allen Untergruppen herunterreguliert. Um die zu validieren MAOA Expressionsstatus in HCC haben wir auch die RNA-Sequenzierungsdaten von der Broad Institute Cancer Cell Line Encyclopedia (CCLE) heruntergeladen. Überraschenderweise fanden wir das MAOA wurde in den Zelllinien von C3A_LIVER, ALEXANDERCELLS_LIVER und HLE_LIVER nicht exprimiert. Daher bestätigten die Beweise die herunterregulierte MAOA Niveau im HCC.

    3.4 Vielversprechender diagnostischer und prognostischer Wert von herunterreguliertem MAOA im HCC

    Die ROC-Kurven der folgenden sechs RNA-Sequenzierungsdatensätze zeigten die Unterscheidungskraft von MAOA in den HCC-Patienten und Nicht-HCC-Gruppen: GSE63018, GSE56545, GSE63863, GSE77509, GSE77314 und GSE69164 (alle mit AUC >0,70 und P-Werte <.05 Abbildung S7A-P). In Bezug auf den Genchip-Datensatz ist die bemerkenswerte Unterscheidungsfähigkeit von MAOA bei HCC-Patienten und Nicht-Krebspatienten wurde in GSE14520-GPL571, GSE14520-GPL3921, GSE29721, GSE45436, GSE112790 und GSE59259 (alle mit AUC >0,70 und P-Werte <.05 Abbildung S8A-I). Die AUC der sROC-Kurve, Sensitivität und Spezifität betrugen 0,77 (95 %-KI: 0,73-0,80), 0,56 (95 %-KI: 0,51 – 0,61) bzw. 0,85 (95 %-KI: 0,81-0,88) (Abbildung 2A ). Im Fagan-Diagramm mit einer Vortest-Wahrscheinlichkeit von 20 % ist die Nachtest-Wahrscheinlichkeit von HCC unter Verwendung von MAOA für ein positives Testergebnis 48% und die Wahrscheinlichkeit für ein negatives Testergebnis 11%, was darauf hindeutet, dass MAOA könnte als bemerkenswerter Marker für das HCC-Screening dienen (Abbildung 2B). Die diagnostische Likelihood-Ratio positiv (DLR P), die diagnostische Likelihood-Ratio negativ (DLR N), der diagnostische Score und die diagnostische Odd-Ratio waren 3,74 (95%-KI: 3,01-4,64), 0,51 (95%-KI: 0,46-0,57), 1,98 (95%-KI: 1,73-2,23) bzw. 7,26 (95%-KI: 5,64-9,34) (Abbildung 2C und D). Die oben genannten Ergebnisse zeigten, dass MAOA hatte eine ausgezeichnete Unterscheidungsfähigkeit für HCC. Darüber hinaus ist das herunterregulierte Expressionsniveau von MAOA war relevant für Alter (≥ 60), Rasse (asiatisch), Tumormetastasenstatus (M0), histologischen Grad des Neoplasmas (G1>G2>G3>G4) und AFP-Konzentration (>20 ng/ml) (alle mit P-Werte < 0,05 Tabelle S2 Abbildung S9A-E). Interessanterweise zeigte die Kaplan-Meier-Kurve, dass das Hoch MAOA Die mRNA-Expressionsgruppe hatte ein besseres Überlebensergebnis mit einer Hazard Ratio von 0,61 (95% CI: 0,41-0,93) (Logrank P = .019 Abbildung 3), was darauf hinweist, dass der herunterregulierte MAOAmRNA korrelierte mit einer schlechten Prognose von HCC-Patienten.

    3.5 Genetische Veränderungen und Mutationsarten von MAOA im HCC

    MAOA war bei 30 (8 %) der 440 Patienten in der Studie zum hepatozellulären Leberkarzinom (TCGA, vorläufig) verändert (Abbildung 4A). Bemerkenswert ist, dass nicht alle genetischen Veränderungsinformationen der Patienten verfügbar waren. Die genetischen Veränderungen von MAOA in HCC konzentrierten sich auf Missense-Mutation, Amplifikation, tiefe Deletion und das Niveau der mRNA-Überexpression. Weitere Studie zum Mutationstyp von MAOA bei HCC zeigte, dass Missense der vorherrschende Mutationstyp war (Tabelle S3).

    3.6 Identifizierung von CEGs von MAOA und DEGs

    Der Korrelationskoeffizient nach Pearson von MAOA und andere Gene in jedem Datensatz wurden berechnet. Basierend auf den berechneten Pearson-Korrelationskoeffizienten von GSE6222 und GSE19665 wurden zwei Korrelations-Heatmaps erstellt (Abbildung S10A und B). Anschließend erfüllten die co-exprimierten Gene die Standards des absoluten Wertes von Pearsons Korrelationskoeffizienten >0,3 und a P-Wert <.05 wurden für die weitere Analyse erhalten. Insgesamt 5099 MAOA positiv verwandte CEGs und 1565 MAOA negativ verwandte CEGs wurden identifiziert, die alle in nicht weniger als neun Datensätzen auftauchten. Hierin, PCOLCE und TBC1D8 wurden als die signifikantesten CEGs identifiziert, die positiv mit MAOA, und PKM wurde als die signifikantesten CEGs identifiziert, die positiv mit MAOA (Abbildung S11A und B). Darüber hinaus wurden 2267 herunterregulierte Gene und 1478 hochregulierte Gene identifiziert, die in nicht weniger als acht Datensätzen vorkommen. Insgesamt 597 Kreuzungsgene der MAOA positiv verwandte CEGs und herunterregulierte DEGs und 184 Kreuzungsgene der MAOA negativ verwandte CEGs und hochregulierte DEGs wurden erhalten (Abbildung 4B und C).

    3.7 GO-, DO- und KEGG-Anreicherungsanalysen und PPI-Netzwerkaufbau

    Nach den 597 Kreuzungsgenen der MAOA positiv verwandte CEGs und herunterregulierte DEGs, zeigte die GO-Analyse die Bedeutung des katabolen Prozesses organischer Säuren, der Blutmikropartikel und der Monooxygenaseaktivität in Bezug auf den biologischen Prozess (BP), die zelluläre Komponente (CC) bzw. die molekulare Funktion (MF) (Abbildung 5A .). Tabelle S4). Für die 184 Kreuzungsgene des MAOA negativ verwandte CEGs und hochregulierte DEGs, T-Zell-Aktivierung, MHC-Klasse-II-Proteinkomplex und MHC-Klasse-II-Rezeptoraktivität wurden in Bezug auf BP, CC bzw. MF hervorgehoben (Abbildung 5B Tabelle S5). Basierend auf den 597 Kreuzungsgenen zeigten die DO-Analyse und die KEGG-Anreicherungsanalyse, dass die koronare Herzkrankheit (Abbildung 6A) die überwiegend assoziierte Erkrankung war und dass der Retinolmetabolismus und die chemische Karzinogenese die beiden wichtigsten geclusterten Wege waren (Abbildung 6B). Wir wollten uns auf den chemischen Karzinogenese-Weg konzentrieren. Daher haben wir den spezifischen Prozess des chemischen Karzinogenese-Wegs analysiert (Abbildung S12) und festgestellt, dass MAOA durch mehrere Gene, nämlich CYP1A1, CYP1A2, CYP2A, CYP2E1, CYP3A4, GST, HSD11B1, NAT, NAT2 und UGT, an der Pathogenese und Progression von HCC und anderen Krebsarten beteiligt sein könnten. Unter diesen Genen spielte CYP3A4 eine wichtige Rolle im Karzinogeneseprozess von HCC, indem es die Umwandlung von Aflatoxin B1 in AFB1-exo-8,9-Epoxid förderte. Die 184 Kreuzungsgene des MAOA negativ verwandte CEGs und hochregulierte DEGs waren signifikant mit lymphozytärer Choriomeningitis verbunden ( 6C ) und wurden hauptsächlich im KEGG-Weg der rheumatoiden Arthritis ( 6D ) angereichert. Darüber hinaus wurden PPI-Netzwerke basierend auf den Genen des chemischen Karzinogenese-Wegs konstruiert, um das Zusammenspiel von Proteinen zu zeigen (Abbildung S13). CYP2E1 wurde als Hub-Gen im Netzwerk ausgewählt. Wir untersuchten auch den prognostischen Wert von CYP2E1 und in Übereinstimmung mit MAOA, die Ergebnisse, die auf niedriges CYP2E1 hinweisen, korrelierten mit dem reduzierten Gesamtüberleben bei HCC-Patienten (Abbildung S14A und B).

    3.8 Proteinexpressionsniveau und klinische Bedeutung von MAOA bei HCC

    Die Ergebnisse der Gewebe-Mikroarrays und der IHC-Färbung zeigten, dass der Expressionsspiegel des MAOA-Proteins bei HCC im Vergleich zu Nicht-HCC-Proben signifikant verringert war (Abbildung 7A), was mit dem Expressionsstatus von . übereinstimmt MAOA aus der mRNA-Ebene. Eine Kaplan-Meier-Kurve der Patienten mit hepatozellulärem Karzinom basierend auf dem MAOA-Proteinexpressionsniveau wurde gezeichnet, und es wurde kein signifikanter Unterschied zwischen den Gruppen mit niedriger und hoher MAOA-Proteinexpression bei HCC-Patienten identifiziert ( 7B ). Die HCC (Abbildung 7C, E und G) und Nicht-HCC (Abbildung 7D, F und H) immunhistochemische IHC-Färbungsbilder unter einem Mikroskop (×400) zeigten eine niedrigere MAOA-Proteinexpression in HCC im Vergleich zu Nicht-HCC-Geweben. wie durch die IHC-Färbungsergebnisse des Human Protein Atlas bestätigt

    (Abbildung 7G und H). Noch wichtiger ist, dass wir festgestellt haben, dass eine niedrigere MAOA-Proteinexpression signifikant mit dem fortgeschrittenen TNM-Stadium von HCC-Patienten korreliert (Tabelle S6).

    3.9 Einfluss von NC auf die MAOA Ausdruck im Nacktmaus-HCC-Modell

    Die Tumorvolumina der NC-behandelten Nacktmäuse waren im Vergleich zu Kontroll-Nacktmäusen signifikant reduziert (P-Wert <.05). 39 Insgesamt kamen zwei NC-behandelte und drei Kontroll-HCC-Gewebe für eine Expressionsanalyse in Frage. Die mRNA-Expressionsprofile in HCC-Geweben, die von NC-behandelten und Kontroll-Nacktmäusen seziert wurden, wurden durch Sequenzierung der nächsten Generation bestimmt. Die DEGs wurden identifiziert und ein Vulkanplot erstellt (Abbildung S15). Wie erwartet, die MAOA Expressionsniveau war in der NC-behandelten Gruppe im Vergleich zur Kontrollgruppe signifikant erhöht.


    Überleben von Krebszellen in der Knochenmikroumgebung

    Osteomimik

    Es wurde vorgeschlagen, dass Krebszellen aufgrund ihrer Fähigkeit, Gene zu exprimieren, die normalerweise als knochen- oder knochenbezogen angesehen werden, bevorzugt in Knochen metastasieren [36]. Auf diese Weise werden Krebszellen gerüstet, um sich in der Knochenmikroumgebung anzusiedeln, zu adhärieren, zu überleben und zu vermehren. Osteomimetische Faktoren umfassen Osteopontin (OPN), Osteocalcin, Osteonectin, Knochensialoprotein, RANKL und PTHrP. Einige dieser Moleküle sind mit der Rekrutierung und Differenzierung von Osteoklasten verbunden, einige sind prominente Akteure im Teufelskreis. OPN wird beispielsweise von vielen Brustkrebszellen produziert und weist eine starke klinische Korrelation mit schlechter Prognose und verringertem Überleben auf [37]. Es kann zum Überleben, zur Proliferation, zur Adhäsion und zur Migration von Tumorzellen beitragen. Im Knochen ist OPN an der Differenzierung und Aktivität von Osteoklasten und der Hemmung der Mineralablagerung im Osteoid beteiligt [37]. Die Ergebnisse einer in vivo Studie zeigte, dass OPN-defiziente Mäuse eine signifikant reduzierte Knochenmetastasierung zeigten [38].

    Runx2-Ausdruck

    Interessanterweise werden viele osteomimetische Faktoren durch denselben Transkriptionsfaktor, Runx2, reguliert, der als Hauptregulator der Osteoblastenbindung und -differenzierung gilt [39]. Es ist erforderlich, um mesenchymale Zellen zu Osteoblasten zu treiben. Dysfunktionales Runx2 führt zu einem Entwicklungsstillstand von Osteoblasten und einer Hemmung der Osteogenese. Runx2 reguliert die Proliferation herunter und induziert die Expression von p21, RANKL, MMP2, MMP9, MMP13, VEGF, OPN, Knochensialoprotein und PTHrP-Protein, um die Osteoblastendifferenzierung, Knochenentwicklung und -umsatz zu fördern [39].

    Es wurde auch vorgeschlagen, dass Runx2 ektopisch in metastasierenden Brustkrebszellen mit Knochenbestimmung exprimiert wird. Hinweise aus einem intratibialen Knochenmetastasenmodell deuten darauf hin, dass, wenn hochaggressive metastasierende MDA-MB-231-Zellen dysfunktionale Runx2- oder kleine Haarnadel-RNA für . exprimieren, Runx2, nehmen sowohl die Osteoklastogenese als auch die osteolytischen Läsionen ab [40]. Diese Ergebnisse zeigen eine wichtige Rolle für das aus Krebszellen gewonnene Runx2 im osteolytischen Prozess. Jüngste Forschungen haben gezeigt, wie die Krebszelle Runx2 andere Zellen in der Knochenmikroumgebung beeinflusst und die Osteolyse fördert. Pratap und Kollegen [40] fanden heraus, dass Runx2 auf die TGF-β-Stimulation reagiert, indem es die Expression von Indian Hedgehog (IHH) aktiviert, was den PTHrP-Spiegel weiter erhöht. Somit spielt Runx2 eine bedeutende Rolle im Teufelskreis über TGF-β-induzierte IHH-PTHrP-Wege in Brustkrebszellen, was zu einer erhöhten Osteoklastogenese und Osteolyse führt.


    Ergebnisse

    Die TAP1-Genexpression bei verschiedenen Krebsarten

    Um die mRNA-Expression für das TAP1-Gen bei verschiedenen Krebsarten zu analysieren, haben wir drei Datenbanken verwendet. Wir verwendeten ONCOMINE, um den Vergleich der TAP1-mRNA-Expression für verschiedene Krebsarten und ihre normalen Gewebe zu untersuchen. Es wurde berichtet, dass die gesamte einzigartige Analyse 453 betrug, von den 453 Analysen waren 42 signifikant (Abb. 1A). Der Vergleich in ONCOMINE erfolgte über Student’s T testen, a P-Wert von 0,0001 und eine fache Änderung von 2. Die mRNA-Spiegel wurden in der Blase, im Gehirn und im Zentralnervensystem (ZNS), Brust-, Hals-, Kopf- und Hals-, Nieren-, Leber-, Lymphom-, Eierstock- und Bauchspeicheldrüsenkrebs überexprimiert, während im Gegensatz zu gesundem Gewebe nur beim Lungenkrebs unterexprimiert. Der GEPIA2-Server wurde dann verwendet, um das Profil der TAP1-Expressionsniveaus bei mehreren Krebsarten durch ANOVA-Tests mit einem angepassten p-Wert von 0,05 zu untersuchen ( 1B ). Die Daten wurden aus TCGA extrahiert, wo wir in 33 Tumortypen gepaart mit ihren normalen Proben nach der mRNA-Expression von TAP1 fragten. Wir sahen, dass unter anderen Krebsarten BRCA (Brustkrebs), LIHC (Leber-Hepatozelluläres Karzinom), LUAD (Lungenadenokarzinom) und OV (Ovarialkarzinom) signifikant überexprimiert wurden. Wir analysierten auch die TAP1-Expression für verschiedene Tumorgewebe und ihre jeweiligen Gegenstücke unter Verwendung von GENT2 über die HG-U133Plus2-Datenbank und betrachteten zwei Stichproben t-Test P-Wert von < 0,001 (Fig. 1C). Das Boxplot zeigte eine gewebeweite Expression von TAP1 bei Krebsexperimenten. Die mRNA-Expression war für Brust, Leber, Lunge und Eierstock signifikant höher als im normalen Gewebe.

    Expression von TAP1 bei verschiedenen Krebsarten: (EIN) Krebs vs. normale Hochregulierung (rot) und Herunterregulierung (blau) in der linken bzw. rechten Spalte mit den Standardparametern a P-Wert: 1E-4, fache Änderung: 2 und ein % Gen-Ranking: 10 % für die Expression von mRNA in der ONCOMINE-Datenbank. (B) mRNA-Transkriptionsprofile für TAP1 in verschiedenen Krebsarten wurden von der TCGA-Datenbank über die GEPIA2-Website (Gene expression Profiling Interactive Analysis 2) nachgewiesen. Im Punktdiagramm stellt das rote Diagramm einen Tumor dar, und das blaue Diagramm repräsentiert normales Gewebe. Jeder Punkt repräsentierte den Ausdruck von Proben. Die Tumorproben wurden mit ihren Gegenstücken verglichen, um die Expressionskriterien zu erfüllen. (C) Das TAP1-Expressionsprofil bei verschiedenen Krebsarten und seinen Gegenstücken wurde durch Genexpression in normalem und Tumorgewebe (GENT2) mit Boxplot nachgewiesen, wobei rote Kästchen Krebszellen anzeigen, blaue Kästchen normale Zellen anzeigen, die mittlere Linie den Median zeigt und die Punkte sind die Ausreißer

    Das Muster der TAP1-Expression bei Brust-, Lungen-, Leber- und Eierstockkrebs

    Wir untersuchten weiter das TAP1-Genexpressionsmuster bei verschiedenen Krebsarten (Abb. 2). Wir verwendeten die ONCOMINE-Datenbank, um die Genexpression und Faltungsänderungen zu beobachten. Es wurde unter Berücksichtigung von vier Krebsarten fortgesetzt: Brust-, Lungen-, Leber- und Eierstockkrebs. Die Expression wurde bei Brust-, Leber-, Eierstock- und Lungenkrebs hochreguliert (Abb. 2A–2D). Das GEPIA2-Tool wurde verwendet, um die Expression des TAP1-Gens zu untersuchen (Abb. 2E–2H), wobei die Expressionsniveaus für LIHC- und OV-Krebse signifikant höher waren als in normalen Geweben. Die Expression im Primärtumor und im Normaltumor wurde mit der TCGA-Datenbank im UALCAN-Tool verglichen (Abb. 2I–2K). Eine signifikante Überexpression der TAP1-Expression wurde im Primärtumor im Vergleich zum Normaltumor bei BRCA, LIHC und LUAD beobachtet.

    Ein Vergleich zwischen Krebs und Normal wurde bei verschiedenen Krebsarten für das Muster der TAP1-Expression beobachtet. Eine Box-Plot-Analyse für Veränderungen in der TAP1-Faltung (log2-Transformation der Genexpressionsänderung) wurde unter Verwendung von vier Krebsarten durchgeführt, nämlich: Brust-, Leber-, Lungen- und Eierstockkrebs, wobei der linke Plot normale und der rechte Plot Tumorzellen darstellt und der höchste und die niedrigsten Werte werden mit einem Sternchen (A–D) unter Verwendung des Analysetools ONCOMINE angezeigt. (A) Invasives duktales Mammakarzinom, (B) hepatozelluläres Karzinom, (C) seröses Papillenkarzinom der Ovarialoberfläche, (D) Plattenepithelkarzinom der Zunge, Plattenepithelkarzinom der Lunge. (E–H) Die analytische Untersuchung des Expressionsmusters von TAP1 wurde von GEPIA2 unter Verwendung der ANOVA-Differentialmethode durchgeführt. *P-Wert: 0,01. (I–K) wurden von UALCAN web verwendet und TCGA-Proben wurden verwendet, um die Expression von TAP1 in primären Tumorzellen im Vergleich zu normalen Zellen zu analysieren

    Das Muster der TAP1-Proteinexpression bei Brust-, Lungen-, Leber- und Eierstockkrebs

    Wir untersuchten die Expression des TAP1-Proteins, das aus einem Antikörper-basierten Protein-Profiling abgeleitet wurde, unter Verwendung von Immunchemie für die verschiedenen Krebsgewebe und deren normales Gegenstückgewebe (Abb. 3). Die Proteinspiegel von TAP1 waren in allen Geweben vom Krebstyp hoch, mit hoher Färbung und starker Intensität ( 3A (ii), 3B (ii), 3C (ii) und 3D (ii)). Wir fanden jedoch auch hohe Proteingehalte für körniges Brust- und Lebergewebe (Abb. 3 A (i) und C (i)).

    Expression des TAP1-Proteins in (A) Brustgangkarzinomgewebe im Vergleich zu normalem Brustgewebe. (B) Lungenadenokarzinomgewebe im Vergleich zu normalem Lungengewebe. (C) Leber-Cholangiokarzinom-Gewebe zu normalem Lebergewebe. (D) Ovarialzystadenokarzinom-Gewebe im Vergleich zu normalem Ovarialgewebe, das ihre Immunchemie unter Verwendung der Human Protein Atlas-Datenbank beschreibt

    Expressionsanalyse des TAP1-Gens mit klinischen Merkmalen

    Wir haben die Expression des TAP1-Gens mit unterschiedlichen klinischen Merkmalen mithilfe der Online-Datenbank UALCAN analysiert. Die Expression des TAP1-Gens in normalem Gewebe wurde mit Geweben von Patienten mit unterschiedlichen klinischen Ergebnissen für Brust-, Leber-, Lungen- und Eierstockkrebs verglichen ( 4 und ergänzende Tabelle 1). Die Überexpression des TAP1-Gens bei Krebspatienten im Vergleich zu normalem Gewebe war am stärksten im Stadium 2 für LUAD (P = 3,37e-09) und LIHC (P = 2,97e-08) Krebs, Stadium 2 (P = 1,62e-12) und Stufe 4 (P = 1,08e-03) gehörten zu den höchsten für BRCA. Stufe 3 (p < 1e-12) hatte das geringste Expressionsniveau für TAP1 bei BRCA und Stufe 4 (P = 5,96e-03) zeigte das niedrigste Expressionsniveau für LIHC und Stadium 1 (P = 1,04e-10) und Stufe 4 (P = 1,33e-02) gehörten zu den niedrigsten für LUAD (Abb. 4A, B, D). Es gab keine signifikante TAP1-Expression bei Eierstockkrebs. Alle Stadien, für BRCA, LIHC und LUAD, hatten im Vergleich zu den normalen Geweben eine signifikant erhöhte mRNA-Expression. Statistisch signifikante Überexpression des TAP1-Gens bei Krebspatienten unterschiedlicher Ethnie im Vergleich zu normalen Geweben wurde bei BRCA, LIHC und LUAD beobachtet ( 4E , F, H). Die TAP1-Genexpressionsspiegel waren bei Frauen mit Brustkrebs signifikant höher als bei normalen Gegenstücken (Abb. 4I, P = 1,62e-12). Die TAP1-Expression hatte einen signifikanten Unterschied für beide, weiblich vs. normal und männlich vs. normal, für LIHC und LUAD (Fig. 4J, K).

    Der Zusammenhang der Expression von TAP1 mit verschiedenen klinischen Merkmalen bei Krebspatienten wurde in einem Boxplot gezeigt, in dem das TAP1-mRNA-Expressionsniveau über das UALCAN-Web nachgewiesen wurde. (A–D) Expressionsanalyse für Patientenattribute basierend auf spezifischen Krebsstadien für BRCA, LIHC, OV bzw. LUAD. (E–H) Der Ausdruck für die Rasse des Patienten für BRCA, LIHC, OV und LUAD und basierend auf dem Geschlecht eines Patienten (I–K) für BRCA, LIHC bzw. LUAD. Statistische Signifikanz, bewertet von der Studentin T Test (ungleiche Varianz). *P < 0,05

    Promotor-Methylierung des TAP1-Gens mit klinischen Merkmalen

    Wir analysierten den Grad der Methylierung des TAP1-Genpromotors mit verschiedenen klinischen Merkmalen mithilfe der UALCAN-Online-Datenbank. CpG-Sonden wurden verwendet, um eine Korrelation zwischen den Expressionsniveaus und der Promotor-Methylierung zu identifizieren. Die Boxplots zeigten den durchschnittlichen Beta-Wert der DNA-Methylierung in TCGA-Proben. Die Promotor-Methylierung des TAP1-Gens in normalem Gewebe wurde mit Geweben von Patienten mit unterschiedlichen klinischen Ergebnissen für Brust-, Leber-, Lungen- und Eierstockkrebs verglichen (Fig. 5 und ergänzende Tabelle 2). Die Methylierung des Promotors war in Tumorproben signifikant erhöht als in normalen Geweben für BRCA (P= 4.00e-03), LIHC (P = 2,36e-02) und LUAD (P = 5,99e-03) (Abb. 5A–C). Im Vergleich zu normalem Gewebe haben Patienten im Stadium 1 (P = 3,25e-02) und Stufe 2 (P = 4,17e-04) BRCA zeigte eine signifikante Hochregulierung des Beta-Wertes (Abb. 5D), Patienten mit LIHC hatten die höchste Promotormethylierung im Stadium 1 (P = 2,32e-02) (Fig. 5E), wiesen Patienten mit LUAD im Stadium 1 und 3 eine signifikante Erhöhung der Promotor-Methylierung auf als normales Gewebe (Fig. 5F). Im Vergleich zu normalem Gewebe hatten asiatische und afroamerikanische Patienten eine erhöhte Promotormethylierung bei BRCA und kaukasische Patienten hatten eine erhöhte Methylierung bei LIHC und LUAD (Abb. 5G–I). Bei Brust-, Leber- und Lungenkrebs war die Methylierung des TAP1-Promotors bei Frauen im Vergleich zu normalem Gewebe signifikant unverändert (Abb. 5J–L). Die Analyse legt jedoch keinen spezifischen Zusammenhang zwischen TAP1-DNA-Methylierung und klinisch-pathologischen Subtypen nahe.

    Der Zusammenhang der Promotor-Methylierung von TAP1 mit verschiedenen klinischen Charakteristika bei Krebspatienten wurde in einem Boxplot gezeigt, in dem der Methylierungslevel des TAP1-mRNA-Promotors über das UALCAN-Web nachgewiesen wurde. (A–C) Der Methylierungsgrad des Primärtumors und in den Gegenstücken in BRCA, LIHC bzw. LUAD. (D–F) Promotor-Methylierungsniveau für Patientenmerkmale basierend auf spezifischen Krebsstadien für BRCA, LIHC bzw. LUAD. (G–I) Promotor-Methylierungsniveau für die Rasse des Patienten für BRCA, LIHC und LUAD und basierend auf dem Geschlecht eines Patienten (J–L) für BRCA, LIHC bzw. LUAD. DNA-Methylierungsbereich: 0–1, 0, 0,5 bzw. 1 entsprechen unmethyliert, halbmethyliert (50% Methylierung) und vollständig methyliert. Es wurden verschiedene Cut-offs von 0,7 bis 0,5 für Hypermethylierung und 0,3–0,25 für Hypomethylierung berücksichtigt

    Hinweis: Für OV in UALCAN waren keine Daten zur Promotormethylierung verfügbar.

    Mutierte mRNA, Genmutationen und Kopienzahländerungen von TAP1

    Unter Verwendung der cBioPortal-Datenbank wurde die genetische Veränderung von TAP1 bei verschiedenen Krebsarten untersucht. Generierte Datenbank, die abgefragt wurde, um die genetische Mutation von TAP1 in 7710 Proben aus 12 Fällen von BRCA-, LIHC-, LUAD- und OV-Krebs zu beobachten. Von den insgesamt abgefragten Proben gab es eine Veränderung des Gensets oder der Pathways von 2 % mit einer somatischen Mutationshäufigkeit von 0,3 %. Unter Berücksichtigung mehrerer Probenstudien wurden insgesamt 21 Mutationen, einschließlich 9 Duplikationen, für den TAP1-Genbereich berichtet ( 6A ). Wir beobachteten zwischen 1 und 808 Aminosäuren im TAP1-Pro-Peptid und in der TAP1-Domäne für die Abfrage. Unter diesen Mutationen waren 19 Missense-Mutationen und 2 verkürzte Mutationen wurden gründlich identifiziert. Brust-Adenokarzinom und Lungenkrebs hatten die höchsten Mutationen, die in ihnen gefunden wurden, und die Mutationen lagen in einem Hotspot in R547C/H. Im R547C/H wurden zwei Mutationen identifiziert. Die Site enthielt Mutationen, wie z. B. Missense-Mutationen, die in 8 Brust-Adenokarzinom-Proben und 3 Lungenkrebs-exprimierten Missense-Mutationen entdeckt wurden. Für Eierstockkrebs-Datensätze wurde die Änderungshäufigkeit unter vier Krebsarten am höchsten (>6%) gefunden ( 6B ). Folglich erzeugte es die Expression von TAP1-mRNA (RNA Seq V2) unter 12 Krebsfällen unter Verwendung des cBioPortals ( 6C ). Brustkrebs, 8 (7 Missense- und 1 Trunkierung) Fälle, hatte die höchste Mutation in der mRNA-Expression, und anschließend war der Leberkrebs die nächste Mutation mit 4 betroffenen.

    Analyse der Expression mutierter mRNA, Genmutationen und Kopienzahländerungen des tap1-Gens für verschiedene Krebsstudien mit cBioPortal. (A) 21 Mutationen wurden an Proben zwischen 1 und 808 Aminosäureresten zwischen Pro-Peptid und Domäne des TAP1-Proteins beobachtet. (B) Die Häufigkeit der Veränderung, die Mutationen (grün), Amplifikation (rot), tiefe Deletion (blau) und multiple Veränderungen (grau) zeigt, wurde grafisch dargestellt. Datensätze mit einem Minimum von 100 Fällen wurden aufgetragen. (C) Abschneidende Mutation (tiefblau), eine Missense-Mutation (grün), keine Mutation (hellblau) und Mutation nicht profiliert (weiß) in der TAP1-Expression durch die RNA-Seq-V2-Methode für eine Stichprobe von 12 Studien

    Prognostische Untersuchung der TAP1-Expression bei Krebspatienten

    Für die Prognose der TPA1-mRNA-Expression wurden verschiedene Krebskategorien in Betracht gezogen und wir haben die Daten unter Verwendung der Prognosedatenbanken mit einem Cox-p-Wert von einer Signifikanz von (P<0,05). Um die Interaktion hinsichtlich der Expression von TAP1 mit dem Überlebensverhältnis bei Brust-, Lungen-, Leber- und Eierstockkrebspatientinnen zu analysieren, wurde die PrognoScan-Datenbank verwendet, in der die Gruppen mit hoher und niedriger TAP1-Expression durch einen Log-Rank-Test definiert wurden. Im Fall von Brustkrebs lieferten die Sets GSE9195 und GSE1456-GPL96 Daten, dass Patientinnen mit verminderter Expression des TAP1-Gens (n = 57 und n = 139) hatten ein signifikant höheres rezidivfreies Überleben im Vergleich zu denen mit einer höheren TAP1-Expression (n = 20, für beide) (Fig. 7A, 7B). Die für den Lungenkrebs-Datensatz gefundenen Ergebnisse hatten die gleichen Konsequenzen wie die Brustkrebs-Ergebnisse für OS und RFS (Abb. 7C, 7D). Hier zeigten die Datensätze GSE31210 und GSE31210 von Lungenkrebs, dass die niedrige Expression (n = 180, für beide) von TAP1-mRNA zeigte ein signifikant höheres OS im Vergleich zu der Gruppe mit einer höheren exprimierten TAP1-mRNA (n=24, für beide Fälle). Andererseits zeigte die Analyse der Datensätze GSE26712 und GSE26712 von PrognoScan ein signifikant niedrigeres OS und DFS von Eierstockkrebs, für die niedrigere TAP1-mRNA-Expression (n = 111 und n = 149) im Gegensatz zu den höheren Niveaus der Gegenstücke (n= 74 und n = 36 bzw.) (Fig. 7E, 7F). Für in der unteren TAP1-Ausdrucksgruppe (n= 203 und n= 228) auf dem KM-Plotter für Leberkrebs wurde eine hohe Überlebensrate bei OS bzw. RFS im Vergleich zu der höheren Expression der Gegenstücke (n =161 und n = 88 bzw.) (Fig. 7G, 7H). In erster Linie datenfokussiert, dass eine hohe TAP1-Expression indifferent gegenüber dem einzelnen Ovarialkarzinom-Unterschied in der Expression in einer positiven Korrelation mit der niedrigen Überlebensrate bei Brust-, Lungen- und Leberkrebs steht.

    Analyse des Patientenüberlebens auf TAP1-Expression bei verschiedenen Krebsarten. Die Überlebenswahrscheinlichkeit betroffener Personen mit hoher (rot) und niedriger (blauer) TAP1-Expression. Die Diagramme wurden auf Krebsarten analysiert: (A, B) schubfreies Überleben in der Brust, (C, D) Gesamtüberleben und schubfreies Überleben in der Lunge, (E, F) Gesamtüberleben und krankheitsfreies Überleben in den Eierstöcken und (G, H) Gesamtüberleben und rezidivfreies Überleben in der Leber wurden aus der PrognoScan-Datenbank abgerufen, mit cox P-Wert von 0,05. Die Überlebenswahrscheinlichkeit mit hoher (rot) und niedriger (schwarz) TAP1-Expressionskurve bezüglich der Zeit bei Leberkrebs (G, H) wurde aus dem KM-Plotter abgerufen

    Analysen von Signalweg- und Gen-Ontologien koexprimierter Gene von TAP1

    Schließlich haben wir mithilfe der R2-Genomanalyse- und Visualisierungsplattform die Gene herausgefunden, die positiv mit dem TAP1-Gen bei BRCA-, LIHC-, LUAD- und OV-Krebs korrelieren (Ergänzungstabelle 3). Die korrelierten Gene wurden in Venn Draw verwendet, um ein Venn-Diagramm zu zeichnen, das uns die gemeinsamen korrelierten Gene in BRCA (6058 Gene), LIHC (3773 Gene), LUAD (4012 Gene) und OV-Krebs (2901 Gene) zeigt (Abb. 8 und ). Zusatztabelle 4).

    Venn-Diagramm von positiv korrelierten Genen mit dem TAP1-Gen für BRCA, LUAD, LIHC und OV, gesammelt aus dem Webtool Draw Venn und dem webbasierten Tool R2 Genomics

    Wir extrahierten die positiv korrelierten gemeinsamen Gene, um eine ontologische Untersuchung durchzuführen. Wir verwendeten die Enrichr-Software, um zu verstehen, welche Signalwege durch die positiv koexprimierten Gene und das TAP1-Gen in BRCA, LIHC, LUAD und OV beeinflusst wurden. In der Pathway-Analyse der KEGG-Datenbank sahen wir, dass der am stärksten korrelierte 10 Kyoto Encyclopedia of Genes and Genomes (KEGG)-Weg von TAP1 und das Gen, das in positiver Korrelation mit TAP1 steht, in erster Linie mit dem Zytokin-Zytokin-Rezeptor-Weg Chemokin in Verbindung gebracht wurde Signalweg, hämatopoetische Zelllinie, primäre Immunschwäche, rheumatoide Arthritis, Zelladhäsionsmoleküle, Chagas-Krankheit, Toll-like-Rezeptor-Signalweg, Salmonellen Infektion und Infektion mit dem humanen Immunschwächevirus-1. Der Cytokin-Cytokin-Rezeptor-Weg und der Chemokin-Signalweg sind die wichtigsten zu beeinflussenden Wege ( 9A ). Die Panther-Datenbank zeigte eine signifikantere Interaktion mit Entzündungen, die durch Chemokin- und Zytokin-Signalwege vermittelt werden. Es zeigte auch Wege wie T-Zell-Aktivierung, FAS-Signalweg, Zytoskelett-Regulation durch Rho-GTPase, Apoptose-Signalweg, Huntington-Krankheit, B-Zell-Aktivierung, Integrin-Signalweg, Zellzyklus und SSKR-Signalkarte ST (Abb. 9B). Das Enrichr-Tool führte auch eine Genontologieanalyse durch, um die verschiedenen Prozesse basierend auf den koexprimierten Genen zu untersuchen. Die Co-Expression in biologischen Prozessen war am signifikantesten für den Chemokin-vermittelten Signalweg (GO 0070098), die Entzündungsreaktion und die Lymphozyten-Chemotaxis ( 9C ). Bei molekularen Funktionen wurden der T-Zell-Rezeptor-Komplex, das Tertiärgranulat und die integrale Komponente der Plasmamembran ( 9D ) und bei der zellulären GO-Komponente die Chemokinrezeptorbindung und die Chemokinaktivität am meisten beeinflusst ( 9E ).

    Die Signalanalyse von Signalwegen und Ontologien von Genen mit positiver Korrelation mit dem TAP1-Gen in BRCA, LUAD, LIHC und OV wurde mit Enricher Web grafisch dargestellt. (A) Kyoto Encyclopedia of Gene and Genomes (KEGG) Human Pathways 2019, (B) Panther 2016, (C) Enrichment of GO Biological Process (2018) Begriffe in der Proteomanalyse, (D) Enrichment of GO Molecular Function (2018) Begriffe in der Proteomanalyse und (E) Enrichment of GO Cellular Component (2018) Begriffe in der Proteomanalyse. Generierte Balken, die das Verhältnis darstellen, % Zusammensetzung der Terme in Proteomdaten: % Zusammensetzung der genomischen Annotation, werden nach geordnet P-Wert


    Ergebnisse

    Demografische Merkmale der Studienpopulation

    In dieser Studie wurden 30 Patienten mit Asbestose, 23 Patienten mit Silikose und 25 gesunde Kontrollpersonen untersucht (Tabelle 1). Keiner der Teilnehmer der Studie war Raucher. Patienten mit Silikose und gesunde Kontrollpersonen waren signifikant jünger als Patienten mit Asbestose (P < 0,01) wurde jedoch kein signifikanter Altersunterschied zwischen der Silikose- und der gesunden Kontrollgruppe beobachtet. Die PaO2 war in der Asbestose-Gruppe signifikant niedriger als in der Silikose- und Kontrollgruppe (P < 0,05). Lungenfunktionstests zeigten, dass in der Asbestose-Gruppe eine restriktive Ventilation und/oder ein beeinträchtigter Gasaustausch vorlag, während in der Silikose-Gruppe eine normale Lungenfunktion oder eine leichte Atemwegsbeschränkung und ein leicht erniedrigter DLCO vorlag.

    PD-1-Expression auf zirkulierendem CD4 + oder CD8 + T-Zellen waren bei Patienten mit Asbestose oder Silikose verringert

    Abbildung 1 zeigt keine signifikanten Unterschiede in den zirkulierenden CD4 + oder CD8 + T-Zellfraktionen zwischen den drei Gruppen (P > 0,05). Wir untersuchten zuerst die Expression von PD-1 (CD279) in PB. Wie in Abb. 2a, c gezeigt, wurde eine signifikant niedrigere PD-1-Expression auf CD4 + T-Zellen bei PB aus den Asbestose- (Mittelwert 7,753%) und Silikose- (Mittelwert 6,676%) Gruppen als bei PB aus der gesunden Kontrollgruppe (Mittelwert 11.790%, P < 0,01). In ähnlicher Weise war die PD-1-Expression auf CD8 + T-Zellen bei PB auch in den Asbestose- (Mittelwert 9,556%) und Silikose-Gruppen (Mittelwert 9,132%) im Vergleich zur gesunden Kontrollgruppe (Mittelwert 14,670%, P < 0,05) (Fig. 2b, d). Es wurde jedoch kein signifikanter Unterschied in der PD-1-Expression zwischen den Asbestose- und Silikose-Gruppen beobachtet (Abb. 2c, d).

    Prozentsätze von CD4 + oder CD8 + T-Zellen unter Lymphozyten in PB. Die Prozentsätze von CD4 + (ein) oder CD8 + (B) T-Zellen unter Lymphozyten im PB von gesunden Kontrollen und Patienten mit Asbestose oder Silikose

    Analyse der PD-1-Expression auf CD4 + T- oder CD8 + T-Zellen in PB. Repräsentative durchflusszytometrische Analyse der Expression von PD-1 auf CD4 + (ein) oder CD8 + (B) T-Zellen. Die Prozentsätze von PD-1 + CD4 + (C) oder PD-1 + CD8 + (D) T-Zellen bei gesunden Kontrollpersonen und Patienten mit Asbestose oder Silikose (C, D)

    PD-L1-Expression auf zirkulierendem CD4 + T-Zellen waren bei Patienten mit Asbestose oder Silikose verringert

    Wie in 3 gezeigt, wurde PD-L1 (CD274) hauptsächlich auf zirkulierenden CD4 + T-Zellen und nicht auf CD8 + T-Zellen in den gesunden Kontrollen nachgewiesen. Allerdings war die PD-L1-Expression auf zirkulierenden CD4 + T-Zellen in den Gruppen mit Asbestose (Mittelwert 0,212 %) und Silikose (Mittelwert 0,310 %) im Vergleich zur gesunden Kontrollgruppe (Mittelwert 0,705 %) signifikant verringert (P < 0,05) (Abb. 3a, c). Zwischen den drei Gruppen wurde kein signifikanter Unterschied in der PD-L1-Expression auf zirkulierenden CD8 + T-Zellen beobachtet ( 3b , d).

    Analyse der PD-L1-Expression auf CD4 + T- oder CD8 + T-Zellen in PB. Repräsentative durchflusszytometrische Analyse der Expression von PD-L1 auf CD4 + (ein) oder CD8 + (B) T-Zellen. Die Prozentsätze von PD-L1 + CD4 + (C) oder PD-L1 + CD8 + (D) T-Zellen bei gesunden Kontrollpersonen und Patienten mit Asbestose oder Silikose (C, D)

    Verminderte PD-L1- und PD-L2-Expression auf zirkulierendem CD14 + Monozyten bei Patienten mit Asbestose oder Silikose

    Wir haben außerdem die Expression von PD-L1 (CD274) und PD-L2 (CD273) auf CD14 + Monozyten in PB nachgewiesen. Wie in Abb. 4a, c dargestellt, waren die Prozentsätze der zirkulierenden PD-L1 + CD14 + Monozyten in den Asbestose- (Mittelwert 0,541 %) und Silikose- (Mittelwert 0,544 %) Gruppen im Vergleich zur gesunden Kontrollgruppe (Mittelwert 1,203%, P < 0,01). In ähnlicher Weise wurden in den Asbestose- (Mittelwert 0,541 %) und Silikose- (Mittelwert 0,525%) Gruppen niedrigere Prozentsätze an zirkulierenden PD-L2 + CD14 + Monozyten beobachtet als bei den gesunden Kontrollpersonen (Mittelwert 1,161%, P < 0,01) (Fig. 4b, d). Ein signifikanter Unterschied in der PD-L-Expression auf Monozyten wurde zwischen den Asbestose- und Silikose-Gruppen nicht beobachtet (Fig. 4c, d).

    Analyse der PD-L1- oder PD-L2-Expression auf CD14 + -Zellen in PB. Repräsentative durchflusszytometrische Analyse der Expression von PD-L1 (ein) oder PD-L2 (B) auf CD14 + -Zellen. Die Prozentsätze von PD-L1 + CD14 + (C) oder PD-L2 + CD14 + (D) Zellen bei gesunden Kontrollpersonen und Patienten mit Asbestose oder Silikose

    T-Zell-Aktivierungsstatus bei Patienten mit Asbestose und Silikose

    Wir untersuchten auch den Aktivierungsstatus von Effektor-T-Zellen bei Patienten mit Asbestose und Silikose. Die Prozentsätze der zirkulierenden CD28 + CD8 + T-Zellen waren bei Patienten mit Asbestose und Silikose signifikant niedriger als bei den gesunden Kontrollpersonen (P < 0,05) (Abb. 5b), und die Prozentsätze der zirkulierenden HLA-DR + CD8 + T-Zellen waren in beiden Gruppen signifikant höher als bei den gesunden Kontrollen (P < 0,05) (Fig. 5d). Es wurden keine signifikanten Unterschiede in den Prozentsätzen von CD28 + CD4 + T-Zellen, HLA-DR + CD4 + T-Zellen und CD69 + CD4 + T-Zellen zwischen den Asbestose- und Silikose-Gruppen festgestellt (P > 0,05, Abb. 5a, c und e). Der Prozentsatz an CD69 + CD8 + T-Zellen in PB war in der Asbestosegruppe im Vergleich zur gesunden Kontrollgruppe signifikant erhöht (P < 0,05), und der Prozentsatz an CD69 + CD8 + T-Zellen neigte dazu, in der Silikose-Gruppe höher zu sein als in der gesunden Kontrollgruppe (Fig. 5f). Die Prozentsätze von CD38 + CD4 + T-Zellen und CD38 + CD8 + T-Zellen in PB waren in den drei Gruppen nicht unterschiedlich (Abb. 5g–h). Bemerkenswerterweise korrelierte der Prozentsatz von PD-1 + CD8 + T-Zellen positiv mit dem Prozentsatz von CD28 + CD8 + T-Zellen in der Asbestose (r = 0,464, P = 0,019 Abb. 6a) und Silikosegruppen (r = 0,510, P = 0,032 Abb. 6b).

    Der Aktivierungsstatus von Effektor-T-Zellen in PB. Der Prozentsatz von CD28 + CD4 + (ein) oder CD28 + CD8 + (B) T-Zellen unter den drei Gruppen der Prozentsatz von HLA-DR + CD4 + (C) oder HLA-DR + CD8 + (D) T-Zellen unter den drei Gruppen der Prozentsatz von CD38 + CD4 + (e) oder CD38 + CD8 + (F) T-Zellen unter den drei Gruppen und der Prozentsatz von CD69 + CD4 + (g) oder CD69 + CD8 + (h) T-Zellen unter den drei Gruppen

    Korrelationen zwischen PD-1 + CD8 + T-Zellfraktionen mit CD28 + CD8 + T-Zellfraktionen. Die PD-1 + CD8 + T-Zell-Fraktion korrelierte positiv mit der CD28 + CD8 + T-Zell-Fraktion im PB von Patienten mit Asbestose (r = 0,464, P = 0.019) (ein) oder Silikose (r = 0,510, P = 0.032) (B)

    Die herunterregulierte PD-1-Expression korrelierte mit dem Prozentsatz der vorhergesagten FVC

    Lungenfunktionsparameter wurden verwendet, um den Schweregrad chronischer fibrotischer Lungenerkrankungen vorherzusagen [13]. Hier haben wir die Korrelationen zwischen PD-1-Expression und Lungenfunktionsparametern untersucht und festgestellt, dass die Anteile von PD-1 + CD4 + T-Zellen (r = 0,591, P = 0,008) und PD-1 + CD8 + T-Zellen (r = 0,507, P = 0,027) korrelierten positiv mit dem prognostizierten FVC-Prozentsatz in der Asbestosegruppe (Abb. 7a, b). Darüber hinaus wurden alle Patienten mit Asbestose aufgrund der CT-Befunde in die Untergruppen Stadium I, Stadium II und Stadium III eingeteilt.Obwohl zwischen den drei Stadien kein signifikanter Unterschied beobachtet wurde, war die mittlere PD-1-Expression auf CD4 + T-Zellen oder CD8 + T-Zellen bei Patienten mit Asbestose im Stadium III niedriger als bei Patienten mit Erkrankung im Stadium I und Stadium II (Zusätzliche Datei 1 : Abb. S1). Darüber hinaus haben wir die Beziehungen zwischen der PD-1-Expression und anderen Lungenfunktionsparametern untersucht: PaO2 und der zusammengesetzte physiologische Index (CPI). Wir identifizierten keine Korrelationen zwischen PD-1-Expression und DLCO% vorhergesagt, TLC% vorhergesagt, PaO2, oder CPI (Zusatzdatei 2, 3: Abb. S2–S3).

    Korrelationen zwischen PD-1-Expression und FVC% bei Patienten mit Asbestose vorhergesagt. PD-1 + CD4 + T-Zellfraktionen (r = 0,591, P = 0.008) (ein) und PD-1 + CD8 + T-Zellfraktionen (r = 0,507, P = 0.027) (B) positiv korreliert mit der vorhergesagten FVC. FVC, erzwungene Vitalkapazität


    Verweise

    Berx G, Staes K, van Hengel J, Molemans F, Bussemakers MJ, van Bokhoven A, van Roy F: Klonierung und Charakterisierung des humanen Invasionssuppressorgens E-Cadherin (CDH1). Genomik. 1995, 26: 281-289. 10.1016/0888-7543(95)80212-5.

    Guilford P: Herunterregulierung von E-Cadherin bei Krebs: Treibstoff im Feuer?. Mol Med heute. 1999, 5: 172-177. 10.1016/S1357-4310(99)01461-6.

    Gumbiner BM: Zelladhäsion: Die molekulare Grundlage der Gewebearchitektur und Morphogenese. Zelle. 1996, 84: 345-357.

    Barth AI, Nathke IS, Nelson WJ: Cadherins, Catenine and APC Protein: Wechselspiel zwischen Zytoskelett-Komplexen und Signalwegen. Curr Opin Cell Biol. 1997, 9: 683-690. 10.1016/S0955-0674(97)80122-6.

    Gallin WJ, Sorkin BC, Edelman GM, Cunningham BA: Sequenzanalyse eines cDNA-Klons, der für das Leberzelladhäsionsmolekül L-CAM kodiert. Proc Natl Acad Sci USA. 1987, 84: 2808–2812.

    Ringwald M, Baribault H, Schmidt C, Kemler R: Die Struktur des Gens, das für das Zelladhäsionsmolekül der Maus Uvomorulin kodiert. Nukleinsäuren Res. 1991, 19: 6533–6539.

    Mansouri A, Spurr N, Goodfellow PN, Kemler R: Molekulare Klonierung und chromosomale Lokalisierung des Gens, das für das menschliche Zelladhäsionsmolekül Ovomorulin kodiert. Differenzierung. 1998, 38: 67-71.

    Vleminckx K, Vakaet L, Mareel M, Fiers W, van Roy F: Die genetische Manipulation der E-Cadherin-Expression durch epitheliale Tumorzellen zeigt eine Invasionssuppressor-Rolle. Zelle. 1991, 66: 107-119.

    Bussemakers MJG, van Bokhoven A, Völler M, Smit FP, Schalken JA: Die Gene für die kalziumabhängigen Zelladhäsionsmoleküle P- und E-Cadherin sind im menschlichen Genom hintereinander angeordnet. Biochem Biophys Res Commun. 1994, 203: 291–1294.

    Kaupmann K, Becker-Follmann J, Scherer G, Jockusch H, Starzinski-Powitz A: Das Gen für das Zelladhäsionsmolekül M-Cadherin kartiert auf Mauschromosom 8 und Humanchromosom 16q24.1-qter und liegt nahe dem E-Cadherin ( Uvomorulin) Locus bei beiden Arten. Genomik. 1992, 14: 488-490.

    Humphries MJ, Newham P: Die Struktur von Zelladhäsionsmolekülen. Trends Zellbiol. 1998, 8: 78-83. 10.1016/S0962-8924(97)01188-4.

    Rietmacher D, Brinkmann V, Birchmeier CA: Gezielte Mutation im Maus-E-Cadherin-Gen führt zu einer fehlerhaften Präimplantationsentwicklung. Proc Natl Acad Sci USA. 1995, 92: 855-859.

    Yap AS, Niessen CM, Gumbiner BM: Die Juxtamembran-Region des zytoplasmatischen Schwanzes von Chaderin unterstützt laterale Clustering, adhäsive Verstärkung und Interaktion mit p120ctn. J Cell Biol. 1998, 141: 779-789. 10.1083/jcb.141.3.779.

    Huber AH, Weis WI: Die Struktur des Beta-Catenin/E-Cadherin-Komplexes und die molekularen Grundlagen der vielfältigen Ligandenerkennung durch Beta-Catenin. Zelle. 2001, 105: 391-402.

    Takeichi M: Cadherine bei Krebs: Auswirkungen auf Invasion und Metastasierung. Curr Opin Cell Biol. 1993, 5: 806-11.

    Xiang YY, Tanaka M, Suzuki M, Igarashi H, Kiyokawa E, Naito Y, Othaware Y, Shen Q, Sugimura H, Kino I: Isolierung von komplementärer DNA, die für K-Cadherin kodiert, ein neuartiges Ratten-Cadherin, das bevorzugt in fetaler Niere und Niere exprimiert wird Karzinom. Krebs Res. 1994, 54: 3034-3041.

    Berndorff D, Gessner R, Kreft B, Schnoy N, Lajouspetter AM., Loch N, Reutter W, Hortsch M, Tauber R: Leber-Darm-Cadherin: Molekulare Klonierung und Charakterisierung eines neuartigen Ca2+-abhängigen Zelladhäsionsmoleküls, das in Leber und Darm. J Cell Biol. 1994, 125: 1353-1396.

    Schneider R: Das menschliche Protoonkogen ret: Ein kommunikatives Cadherin?. Trends Biochem Sci. 1992, 17: 468-469. 10.1016/0968-0004(92)90490-Z.

    Iwamoto T, Taniguchi M, Asai N, Ohkusu K, Nakashima I, Takahashi M: cDNA-Klonierung des Maus-Ret-Proto-Onkogens und seine Sequenzähnlichkeit mit der Cadherin-Superfamilie. Onkogen. 1993, 8: 1087-1091.

    Larue L, Ohsugi M, Hirchenhain J, Kemler R: E-Cadherin-Nullmutantenembryonen bilden kein Trophektodermepithel. Proc Natl Acad Sci USA. 1994, 91: 8263–8267.

    Fleming T, Hay M, Javed Q: Epitheldifferenzierung und interzelluläre Übergangsbildung im frühen Embryo der Maus. Entwicklungshilfe 1992, 17: 105-113.

    Hyafil F, Morello D, Babinet C, Jacob F: Ein Zelloberflächen-Glykoprotein, das an der Verdichtung von embryonalen Karzinomzellen und Embryonen im Spaltungsstadium beteiligt ist. Zelle. 1980, 21: 927-934.

    Vestweber D, Kemler R: Kaninchen-Antiserum gegen ein gereinigtes Oberflächen-Glykoprotein dekompaktiert Präimplantationsembryonen von Mäusen und reagiert mit spezifischen adulten Geweben. Exp Cell Res. 1984, 152: 169-178.

    Sefton M, Johnson M., Clayton L: Synthese und Phosphorylierung von Uvomorulin während der frühen Entwicklung der Maus. Entwicklung (Cambridge, Großbritannien). 1992, 115: 313-318.

    Thiery JP: Epithel-mesenchymale Übergänge in der Tumorprogression. Nat. Rev Krebs. 2002, 2: 442-454. 10.1038/nrc822.

    Babb SG, Barnett J, Doedens AL, Cobb N, Liu Q, Sorkin BC, Yelick PC, Raymond PA, Marrs JA: Zebrafisch E-Cadherin: Expression während der frühen Embryogenese und Regulation während der Gehirnentwicklung. Entwickler Dyn. 2001, 221: 231-237. 10.1002/dvdy.1132.

    Hulsken J, Birchmeier W, Behrens J: E-Cadherin und APC konkurrieren um die Interaktion mit β-Catenin und dem Zytoskelett. J Cell Biol. 1994, 127: 2061-2069.

    Morin PJ, Sparks AB, Korinek V, Barker N, Clevers H, Vogelstein B, Kinzler KW: Aktivierung der β-Catenin-Tcf-Signalgebung bei Dickdarmkrebs durch Mutationen in β-Catenin oder APC. Wissenschaft. 1997, 275: 1787-1790. 10.1126/science.275.5307.1787.

    Pece S, Gutkind JS: Signalübertragung von E-Cadherin zum MAPK-Weg durch die Rekrutierung und Aktivierung von epidermalen Wachstumsfaktorrezeptoren bei der Zell-Zell-Kontaktbildung. J. Biol.Chem. 2000, 275: 41227-41233. 10.1074/jbc.M006578200.

    Wissensumgebung zur Signalübertragung. [http://www.stke.org]

    Peifer M, Polakis P: Wnt-Signalgebung in der Onkogenese und Embriogenese – ein Blick über den Kern hinaus. Wissenschaft. 2000, 287: 1606-1609. 10.126/science.287.5458.1606.

    Efstathiou JA, Liu D, Wheeler JMD, Kim HC, Beck NE, Ilyas M., Karayiannakis AJ, Mortensen NJMcC, Kmiot W, Playford RJ, Pignatelli M, Bodmer WF: Mutiertes epitheliales Cadherin ist mit erhöhter Tumorigenität und Verlust der Adhäsion verbunden und des Ansprechens auf den motogenen Kleeblattfaktor 2 in Kolonkarzinomzellen. PNASOnline. 1999, 96: 2316–2321. 10.1073/pnas.96.5.2316.

    Berx G, Becker KF, Höfler H, van Roy F: Mutationen des humanen E-Cadherin (CDH1) Gens. Hum Mutat. 1998, 12: 226-237. 10.1002/(SICI)1098-1004(1998)12:4<226::AID-HUMU2>3.0.CO2-D.

    Machado JC, Soares P, Carneiro F, Rocha A, Beck S, Blin N, Berx G, Sobrinho-Simoes M: E-Cadheringen-Mutationen liefern eine genetische Grundlage für die Phänotypdivergenz von gemischten Magenkarzinomen. Labor investieren. 1999, 79: 459-465.

    Christofori G, Semb H: Die Rolle des Zelladhäsionsmoleküls E-Cadherin als Tumorsuppressorgen. Trends Biochem Sci. 1999, 24: 73–76. 10.1016/S0968-0004(98)01343-7.

    Guilford P, Hopkins J, Harraway J, McLeod M, McLeod N, Harrawira P, Taite H, Scoular R, Millers A, Reeve A: E-Cadherin-Keimbahnmutationen bei familiärem Magenkrebs. Natur. 1998, 392: 402-405. 10.1038/32918.

    Huiping C, Sigurgeirsdottir JR, Jonasson JG, Eiriksdottir G, Johannsdottir JT, Egilsson V, Ingvarsson S: Chromosomenveränderungen und E-Cadheringen-Mutationen bei humanem lobulärem Brustkrebs. Br.J. Krebs. 1999, 81: 1103-1110. 10.1038/sj.bjc.6690815.

    Bukholm IK, Nesland JM, Børessen-Dale AL: Re-Expression von E-Cadherin, α-Catenin und β-Catenin, aber nicht von γ-Catenin, in metastasierendem Gewebe von Brustkrebspatientinnen. J Pathol. 2000, 190: 15-19. 10.1002/(SICI)1096-9896(200001)190:1<15::AID-PATH489>3.3.CO2-C.

    Ilyas M: Expression von Adhäsionsmolekülen bei Brustkrebs: der Phönix bei Tumormetastasen?. J Pathol. 2000, 190: 3-5. 10.1002/(SICI)1096-9896(200001)190:1<3::AID-PATH490>3.0.CO2-5.

    Tycko B: Epigenetische Gen-Stummschaltung bei Krebs. J Clin Invest. 2000, 105: 401-407.

    Becker KF, Atkinson MJ, Reich U, Becker I, Nekarda H, Siewert JR, Hoefler H: E-Cadherin-Genmutationen geben Hinweise auf Magenkarzinome vom diffusen Typ. Krebs Res. 1994, 54: 3845–3852.

    Richards FM, McKee SA, Rajpar MH, Cole TRP, Evans DGR, Jankowski JA, McKeown C, Sanders DSA, Maher ER: Germline E-Cadheringen (CDH1)-Mutationen prädisponieren für familiären Magenkrebs und Darmkrebs. Hum Mol Genet. 1999, 8: 607–610. 10.1093/hmg/8.4.607.

    Gayther SA, Gorringe KL, Ramus SJ, Huntsman D, Roviello F, Grehan N, Machado JC, Pinto E, Seruca R, Halling K, MacLeod P: Mutationen des Keimbahn-E-Cadheringens (CDH1) prädisponieren für familiären Magen- und Darmkrebs . Hum Mol Genet. 1999, 8: 607–610. 10.1093/hmg/8.4.607.

    Chun YS, Lindor NM, Smyrk TC, Petersen BT, Burgart LJ, Guilford PJ, Donohue JH: Keimbahn-E-Cadherin-Genmutationen: Ist eine prophylaktische totale Gastrektomie indiziert?. Krebs. 2001, 92: 181-187. 10.1002/1097-0142(20010701)92:1<181::AID-CNCR1307>3.0.CO2-J.

    Risinger JI, Berchuck A, Kohler MF, Boyd J: Mutationen des E-Cadheringens bei humanen gynäkologischen Krebsarten. Natur Genet. 1994, 7: 98-102.

    Pećina-Šlaus N, Pavelić K, Pavelić J: Verlust der Heterozygotie und Proteinexpression des APC-Gens in Nierenzellkarzinomen. J. Mol. Med. 1999, 77: 446-453. 10.1007/s001090050375.

    Ionov Y, Peinado MA, Malkhosyan S, Shibata D, Perucho M: Ubiquitäre somatische Mutationen in einfachen wiederholten Sequenzen offenbaren einen neuen Mechanismus für die Kolonkarzinogenese. Natur. 1993, 363: 558-561. 10.1038/363558a0.


    Schau das Video: Immune System, Part 1: Crash Course Au0026P #45 (Juni 2022).


Bemerkungen:

  1. Amiri

    Please give details

  2. Trevrizent

    I beg your pardon, this does not suit me. Are there other variations?

  3. Montaro

    Meiner Meinung nach ist das Thema sehr interessant. Ich schlage vor, Sie besprechen es hier oder in PM.

  4. Kynan

    Tut mir leid, aber meiner Meinung nach liegst du falsch. Lassen Sie uns versuchen, darüber zu diskutieren. Schreib mir per PN.

  5. Saran

    Meiner Meinung nach geben Sie den Fehler zu. Geben Sie ein, wir werden diskutieren. Schreiben Sie mir in PM, wir werden damit umgehen.

  6. Hayes

    Ich entschuldige mich, aber meiner Meinung nach haben Sie nicht Recht. Ich kann es beweisen. Schreiben Sie mir in PM, wir werden kommunizieren.

  7. Tausho

    ahahahahhh das ist cool .. beachtbar wunderbar

  8. Doshicage

    Welche Wörter ...



Eine Nachricht schreiben